Sage Journals: Discover world-class research

Abstract

Prostate cancer is the second most common cancer in men worldwide. Although the aetiology of this disease remains largely unclear, several lines of evidence suggest that oxidative stress plays a role in prostate carcinogenesis. The antioxidant enzyme glutathione peroxidase 1 (GPX1) is part of the enzymatic antioxidant defence, preventing oxidative damage to DNA, proteins and lipids by detoxifying hydrogen and lipid peroxides that may contribute to prostate cancer development. Some studies indicate an association between GPX1 Pro198Leu polymorphism and an increased risk of cancer. The purpose of the present study was to determine the possible association of GPX1 Pro198Leu polymorphism and erythrocyte GPX activity with the risk of developing prostate cancer and to clarify whether erythrocyte GPX activity levels were correlated with the GPX1 Pro198Leu genotype in the Turkish population. The GPX1 Pro198Leu genotype was determined in 33 prostate cancer patients and 91 control individuals. As evident from our results, there was no difference between genotype and/or allele frequencies in prostate cancer patients and controls. No significant difference was found in GPX1 genotype or allele frequency between aggressive and non-aggressive prostate cancer patients. It can be suggested with these findings that individual susceptibility of prostate cancer may be modulated by GPX1 polymorphism, but it needs further studies.

Keywords

prostate cancer glutathione peroxidase 1 genetic polymorphism oxidative stress

Introduction

Prostate cancer continues to be a major age-related malignancy with most incidences occurring between 54 and 75 years and rapid onset after 45 years. Evidence from epidemiological, experimental and clinical studies suggests that prostate cancer cells are exposed to an increased oxidative stress.^1,2 Reactive oxygen species (ROS), most notably the hydroxyl radicals, generated endogenously by cellular metabolism are known to cause oxidative DNA damage that has been implicated in prostate carcinogenesis.³

The antioxidant enzyme glutathione peroxidase 1 (GPX1) is part of the enzymatic antioxidant defence, preventing oxidative damage to DNA, proteins and lipids by detoxifying hydrogen and lipid peroxides.^4,5 The cytosolic form of GPX1 belongs to a family of selenium-dependent peroxidases that include cytosolic GPX,⁶ plasma-based GPX3⁷ and phospholipids hydroperoxidase GPX4.⁸ GPX1 knockout mice have a normal phenotype but are highly sensitive to oxidative stressors.⁹ Human GPX1 gene was found to possess several polymorphisms. The GPX1 gene has a GCG repeat polymorphism in exon 1, coding for a polyalanine tract of five to seven alanine residues. However, already there was a case–control study published by Kote-Jarai et al.¹⁰ that showed no significant association between the GPX1 GCG repeat polymorphism and prostate cancer. On the other hand, GPX1 Pro198Leu is supposed to be functional. This polymorphism is associated with C to T substitution in the exon 2 of GPX1, which results in the amino acid change from proline (Pro) to leucine (Leu) at codon 198.¹¹

Studies that examine the possible association of the GPX1 Pro198Leu polymorphism with cancer have given contradictory results. Some studies reported that the Leu allele was associated with an increased risk of breast cancer,^4,12 while others could not confirm these results.^13,14 No association was found between the risk of basal cell carcinoma¹⁵ and colorectal cancer.¹⁶ However, most recent studies reported that the variant Leu allele was associated with a significant lower risk of lung cancer.^17,18 The studies conducted on humans do not explicitly support the functional link between GPX1 genotype and GPX1 enzyme.¹¹ Ravn-Haren et al.⁴ found that GPX1 activity was significantly lowered for the Leu allele compared to the Pro allele. However, this result is not consistent with one study,¹⁹ suggesting no correlation between GPX1 activity and GPX1 genotype. Additionally, several factors have been observed to affect the activity of GPX1. Dietary intake of selenium increases GPX1 activity. Intake of fruit and vegetables, alcohol consumption and smoking may also influence the enzyme activity.²⁰ In the present study, we evaluated the possible association of the following three elements: GPX1 Pro198Leu polymorphism, erythrocyte GPX activity and prostate cancer.

Materials and methods

Subjects

A total of 33 men diagnosed with primary, histologically confirmed prostate cancer (mean age: 67.52 ± 9.31 years) and 91 controls (mean age: 64.57 ± 8.72 years) were enrolled in the study. All patients were recruited from the outpatient clinic of the Urology Department of Gulhane Military Medical Academy, Turkey. Age-matched male subjects, who were admitted to the same hospital with histologically confirmed non-neoplastic diseases, served as controls. The study was approved by the Ethical Committee of Gulhane Military Medical Academy. Written informed consent was obtained from all participants of the study before collecting blood specimens. A questionnaire was used to elicit detailed information on demographic and clinical variables, smoking, prior disease history, and family history of cancer. None of the participants were taking antioxidant or vitamin supplements, including selenium, at the time of the study. None of the subjects had a drinking habit, and none of them had consumed any alcohol, starting at least 48 h prior to blood collection.

All tumours were diagnosed histologically with specimens obtained at biopsy or surgical resection by a senior pathologist at the Department of the Pathology. The cancerous tissue from prostate biopsies and prostatectomy specimens was graded according to the Gleason histopathological grading system, based on the architecture of the glandular tissue, glandular differentiation and cellular and nuclear appearance.²¹

Genotyping of GPX1 polymorphism

Blood samples were drawn from the antecubital vein, following an overnight fast, into tubes containing ethylenediaminetetraacetic acid (EDTA). Erythrocyte lysates were stored at −70°C until assayed, while genomic DNA was extracted from peripheral blood lymphocytes following standard proteinase K, phenol/chloroform extraction or ethanol precipitation procedure.²²

The GPX1 Pro198Leu polymorphism was genotyped by real-time polymerase chain reaction (PCR) as described by Ratnasinghe et al.²³ Briefly, oligonucleotide sequences for primers and probes to detect the C to T polymorphism in codon 198 were PCR forward TGTGCCCCTACGCAGGTACA, PCR reverse CCCCCGAGACAGCAGCA, C allele probe ^VICCTGTCT CAAGGGCCCAGCTGTGC^TAMRA and T allele probe ^FAMCTGTCTCAAGGGCTCAGCTGTGCCT^TAMRA. Reactions (10 μl) contained approximately 20 ng genomic DNA isolated from whole blood, 2× TaqMan Master Mix, dual-labelled probes (100 nM each) and PCR primers (900 nM each). The PCR reaction was run on a Mx3005P™ QPCR System (Stratagene, La. Jolla, CA, USA) under the following conditions: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 62°C for 1 min. Genotyping was repeated on a random 10% samples and results were identical to the original run.

Erythrocyte GPX activity

GPX activity was measured in erythrocyte lysates as previously described by Eken et al.²⁴ Briefly, a reaction mixture containing 1 mmol/L Na₂EDTA, 2 mmol/L reduced glutathione, 0.2 mmol/L NADPH, 4 mmol/L sodium azide and 1000 U glutathione reductase in 50 mmol/L TRIS buffer (pH 7.6) was prepared. A total of 20 µl of erythrocyte lysate and 980 µl of the reaction mixture were mixed and incubated for 5 min at 37°C. The reaction was initiated by adding 8.8 mmol/L hydrogen peroxide and the decrease of absorbance was recorded at 340 nm for 3 min. GPX activity is expressed in U/ml.

Statistical analysis

Demographic information stratified by case–control status was tabulated as a mean ± standard deviation for continuous variables and a number (and percentage) for categorical variables. Pearson’s χ ² test was used to assess group differences on categorical variables and a two-sample t test was used to assess group differences for continuous variables. Comparison of the erythrocyte GPX activity between cases and controls was carried out by a two-sample t test. A Kruskal–Wallis non-parametric analysis of variance (ANOVA) was used to assess whether mean concentration of erythrocyte GPX activities varied by genotype among the controls. Allele and genotype frequencies of cases and controls were compared with values predicted by Hardy–Weinberg equilibrium using the χ ² test. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated to evaluate the associations between GPX1 genotypes and prostate risk. Calculation for the case–control study was performed using the DeFinetti computer program, http://ihg.gsf.de/cgi-bin/hw/hwa1.pl. In all cases, p values ≤0.05 were considered statistically significant.

Additionally, study subjects were stratified according to age (based on age at diagnosis for cases or age at selection for controls) to evaluate the relationship of the GPX1 polymorphism with early-onset prostate cancer.

The association of the GPX1 polymorphism and disease status was studied with refitted models for non-aggressive and aggressive prostate cancer, respectively. Men diagnosed with high-grade cancer (Gleason score of 7–10) were categorized as having aggressive disease; those diagnosed with low-grade prostate cancer (Gleason score 2–6) were categorized as having non-aggressive disease.

For all analysis, we first examined the association of GPX1 Pro/Leu and Leu/Leu genotype, using Pro/Pro genotype as a reference. Next, as a result of the lack of complete information on the functional significance of GPX1 Pro198Leu polymorphism, we analysed the data under the assumption of both dominant (grouping heterozygous with homozygous rare allele) and recessive models (grouping heterozygous with wild type).

Results

Subject characteristics

Table 1 shows a case–control comparison of selected baseline subject characteristics. As expected, free prostate specific antigen (PSA) levels were significantly different in cases compared with controls. Age and smoking status were not different in prostate cancer cases compared to controls.

Table 1.

Comparison of cases and controls by selected demographic and clinical variables

Characteristic	Cases	Controls	p Value^a
Age (years, mean ± SD)	67.52 ± 9.31	64.57 ± 8.72	0.115
Smoking status (n, %)			0.088
Never	11 (33.3)	29 (31.9)
Current	4 (12.1)	19 (20.9)
Former	18 (54.5)	43 (47.3)
PSA (ng/ml)	0.003–100	0.003–10.31
Free PSA (ng/ml)	0.16 ± 0.25	0.65 ± 0.67	0.004
Risk level (n, %)
Non-aggressive disease	10 (30.3)
Aggressive disease	23 (69.7)

SD: standard deviation, PSA: prostate specific antigen.

^a P from Pearson’s χ ² test (categorical variables) or a two-sample t test (continuous variables).

Erythrocyte GPX activity

As evident from the results shown in Table 2 , we found significantly lower erythrocyte GPX activity in the prostate cancer patients group versus controls (p < 0.001).

Table 2.

Comparison of GPX erythrocyte activity between cases and controls

Parameter	Cases	Controls	p Value^a
Samples (n)	33	91
GPX activity (mean ± SD, U/ml)	7.14 ± 1.20	8.17 ± 1.56	0.0007

SD: standard deviation, GPX: glutathione peroxidase.

^a P from a two-sample t test.

GPX1 polymorphism and prostate cancer risk

Table 3 shows the association between GPX1 genotype and prostate cancer risk in Turkish study group. The genotype distribution of GPX1 Pro198Leu was in Hardy–Weinberg equilibrium among the controls. The frequencies of the variant Leu allele were 40.9% and 33.5% in cases and controls, respectively. Genotype frequencies were 33.3% (Pro/Pro), 51.5% (Pro/Leu) and 15.2% (Leu/Leu) for cases, and the respective frequencies were 44.0%, 45.1% and 11.0% for control individuals. As evident from our results, there was no difference between genotype and/or allele frequencies in prostate cancer cases and controls.

Table 3.

Association between GPX1 genotype and prostate cancer risk

GPX1 genotype	Cases (n, %)	Controls (n, %)	OR	95% CI	p Value
Genotype frequencies
Pro/Pro	11 (33.3)	40 (44.0)	1.00	Reference
Pro/Leu	17 (51.5)	41 (45.1)	0.62	0.22–1.76	0.367
Leu/Leu	5 (15.2)	10 (11.0)	1.82	0.51–6.44	0.350
Pro/Pro and Pro/Leu	28 (84.8)	81 (89.1)	1.00	Reference
Leu/Leu	5 (15.2)	10 (11.0)	0.8	0.36–1.76	0.572
Pro/Pro	11 (33.3)	40 (44.0)	1.00	Reference
Pro/Leu and Leu/Leu	22 (66.7)	51 (56.1)	1.57	0.68–3.61	0.288
Allele frequencies
Pro	39 (59.1)	121 (66.5)	1.00	Reference
Leu	27 (40.9)	61 (33.5)	1.16	0.59–2.28	0.660

GPX1: glutathione peroxidase 1, OR: odds ratio, CI: confidence interval.

GPX1 polymorphism and age at diagnosis of prostate cancer

The relationship between the GPX1 polymorphism and prostate cancer risk among the cases and the controls stratified by age at diagnosis (for cases) and age at selection (for controls) is shown in Table 4 . In the group of men above 65 years, individuals with at least one variant Leu allele (Pro/Leu or Leu/Leu) had higher risk than homozygous carriers of Pro-allele (OR, 5.96; 95% CI, 1.48–24.08; p = 0.008). Overall, in this older age subgroup, the variant Leu allele was associated with a higher risk of prostate cancer than the Pro allele (OR, 2.79; 95% CI, 1.22–6.36; p = 0.013).

Table 4.

GPX1 genotype and allele frequencies and ORs (95% CI) in cases and controls stratified by age at diagnosis (for cases) and age at selection (for controls)

GPX1 genotype	Cases (n, %)	Controls (n, %)	OR	95% CI	p Value
Age ≤65 years
Genotype frequencies
Pro/Pro	8 (57.1)	20 (37.0)	1.00	Reference
Pro/Leu	4 (28.6)	26 (48.1)	0.39	0.1–1.46	0.152
Leu/Leu	2 (14.3)	8 (14.8)	0.63	0.11–3.6	0.597
Pro/Pro and Pro/Leu	12 (85.7)	46 (85.1)	1.00	Reference
Leu/Leu	2 (14.3)	8 (14.8)	0.958	0.18–5.11	0.960
Pro/Pro	8 (57.1)	20 (37.0)	1.00	Reference
Pro/Leu and Leu/Leu	6 (42.9)	34 (62.9)	0.44	0.13–1.46	0.173
Allele frequencies
Pro	20 (71.4)	66 (61.1)	1.00	Reference
Leu	8 (28.6)	42 (38.9)	0.63	0.25–1.56	0.313
Age ≥65 years
Genotype frequencies
Pro/Pro	3 (15.8)	19 (52.8)	1.00	Reference
Pro/Leu	13 (68.4)	15 (41.7)	5.49	1.32–22.85	0.014
Leu/Leu	3 (15.8)	2 (5.6)	9.5	4.09–82.73	0.024
Pro/Pro and Pro/Leu	16 (84.2)	34 (94.5)	1.00	Reference
Leu/Leu	3 (15.8)	2 (5.6)	0.34	0.09–1.3	0.103
Pro/Pro	3 (15.8)	19 (52.8)	1.00	Reference
Pro/Leu and Leu/Leu	16 (84.2)	17 (97.3)	5.96	1.48–24.08	0.008
Allele frequencies
Pro	19 (50.0)	53 (73.6)	1.00	Reference
Leu	19 (50.0)	19 (26.4)	2.79	1.22–6.36	0.013

GPX1: glutathione peroxidase 1, OR: odds ratio, CI: confidence interval.

GPX1 polymorphism, aggressive versus non-aggressive prostate cancer

No significant difference was found in GPX1 genotype or allele frequency between subgroups of cases divided by disease status (aggressive vs. non-aggressive prostate cancer; Table 5 ).

Table 5.

GPX1 genotype and allele frequencies and ORs (%95 CI) in aggressive and non-aggressive prostate cancer

GPX1 genotype	Aggressive prostate cancer^a (n, %)	Non-aggressive prostate cancer^b (n, %)	OR	95% CI	p Value
Genotype frequencies
Pro/Pro	8 (34.8)	3 (30.0)	1.00	Reference
Pro/Leu	11 (47.8)	6 (60.0)	0.69	0.13–3.6	0.657
Leu/Leu	4 (17.4)	1 (10.0)	1.5	0.12–19.44	0.756
Pro/Pro and Pro/Leu	19 (82.6)	9 (90.0)	1.00	Reference
Leu/Leu	4 (17.4)	1 (10.0)	1.26	0.27–5.93	0.767
Pro/Pro	8 (34.8)	3 (30.0)	1.00	Reference
Pro/Leu and Leu/Leu	15 (65.2)	7 (70.0)	0.8	0.16–3.99	0.789
Allele frequencies
Pro	27 (58.7)	12 (60.0)	1.00	Reference
Leu	19 (41.3)	8 (40.0)	1.06	0.36–3.08	0.921

GPX1: glutathione peroxidase 1, OR: odds ratio, CI: confidence interval.

^a Aggressive prostate cancer: Gleason score 7–10.

^b Non-aggressive prostate cancer: Gleason score 2–6.

GPX1 genotype and GPX activity correlation

Table 6 shows GPX1 genotype and corresponding GPX erythrocyte activity levels. When measured in erythrocytes, the GPX activity was not significantly different between the groups of individuals representing the Pro/Pro, Pro/Leu and Leu/Leu genetic variants, both in cases and in control subjects.

Table 6.

Erythrocyte GPX activity by the Pro198Leu polymorphism in the GPX 1 gene in cases and controls

GPX1 genotype	Cases (n = 33)		Controls (n = 91)
GPX1 genotype	GPX activity (U/ml)^a	n (%)	GPX activity (U/ml)^a	n (%)
Pro/Pro	7.42 ± 1.50	11 (33.3)	8.37 ± 1.36	40 (44.0)
Pro/Leu	7.05 ± 0.99	17 (51.5)	7.88 ± 1.61	41 (45.1)
Leu/Leu	6.81 ± 1.24	5 (15.2)	8.60 ± 2.00	10 (11.0)
p ^b	0.6008		0.254

GPX1: glutathione peroxidase 1, GPX: glutathione peroxidase, SD: standard deviation, ANOVA: analysis of variance.

^a Values are indicated by mean ± SD.

^b p from Kruskal–Wallis non-parametric ANOVA test for difference in GPX activity by GPX1 genotype.

Discussion

In the present study, we found there was no difference between genotype and/or allele frequencies in prostate cancer cases and controls. Few studies have investigated the relationship of GPX1 Pro198Leu and prostate cancer risk.^2,25 Choi et al.²⁵ failed to find associations between GPX1 Pro198Leu polymorphism and prostate cancer risk among men with a history of smoking and/or asbestos exposure. Further analyses stratified by factors related to environmental oxidative stress did not modify associations.²⁵ On the contrary, Arsova-Sarafinovska et al.² found an overall protective effect of the variant Leu allele of the GPX1 polymorphism on the prostate cancer risk.

Furthermore, in our study we found lower erythrocyte GPX activity in the cancer group than in the healthy controls. These data confirmed our results obtained both in Macedonian and Turkish populations. It was also published in previous studies in which we reported that lower GPx activity was associated with prostate cancer.^2,26 There are variable reports on the activity of this enzyme in prostate cancer. Jung et al.²⁷ found no differences in the antioxidant enzymatic activities of prostatic epithelial cell cultures between benign and malign tissue. In other studies, malignant epithelial cells in prostatic adenocarcinoma have been found to express lower levels of antioxidant enzymes than do benign prostatic epithelium²⁸ or almost no super-oxide dismutase (SOD), GPX and catalase (CAT) enzyme.²⁹ With the lowered GPX activity in the cancer group, an accumulation of H₂O₂ might occur, resulting in higher production of OH radicals. This highly reactive oxidant molecule binds and oxidizes DNA, lipids and proteins, and it reacts with structures in its close neighbourhood. Any oxidative lesion that is not repaired can lead to mutations, increasing the risk of carcinogenesis.³⁰

GPX is part of the defence system that neutralizes hydrogen peroxide. Heterozygous and homozygous carriers of the variant allele of the GPX1 Pro198Leu polymorphism are at 1.8-fold (95% CI, 1.2–2.8) and 2.3-fold (95% CI, 1.3–3.8) higher risk of lung cancer, respectively.¹⁵ Homozygous carriers of the variant allele are at 1.9-fold (95% CI, 1.0–3.6) increased risk of breast cancer.¹⁵ In this study, we determined the erythrocyte GPX activity in 33 cases and 91 controls and found no significant difference by genotype. Our results agree with previous studies that investigated the genotype–activity relationship of the GPX1 polymorphism and reported no difference in activity by genotype.^2,19 Hansen et al.²⁰ also did not find any association between the GPX1 Pro198Leu polymorphism and colorectal cancer risk. On the contrary, the results of Ravn-Haren et al.⁴ indicated that there were relationships between a well-known GPX1 polymorphism, erythrocyte GPX activity and breast cancer risk among postmenopausal women. They found that carriers of the variant T-allele of the GPX1 Pro198Leu polymorphism had a slightly higher risk of breast cancer compared with homozygous wild-type individuals. Our findings might seem somewhat contradictory: the effect of the GPX1 genotype on prostate cancer risk would be expected if GPX enzyme activity differs between the genotypes, such that a low-activity allele would be associated with a relatively high risk of prostate cancer due to less efficient prevention of oxidative damage to DNA caused by oxygen radicals. Thus, we must consider explanations other than the GPX enzyme activity.

Additionally, different dietary and lifestyle factors may influence GPX enzyme activity. In a recent human intervention study, it was shown that the intake of fruit and vegetables significantly increased the activity of GPX in human erythrocytes.³¹ Several studies have shown selenium intake to be associated with GPX activity and gene expression⁴, particularly in populations with a low daily intake, less than 40 µg per day.^12,20,32 The actual dietary intake, alcohol consumption or smoking of that specific day may have influenced the GPX activity.²⁰ Alcohol induces lipid peroxidation and has been also reported to decrease erythrocyte GPX activity in some human studies but not in others.^4,18 The complete story of the GPX1 genotype is probably complex, a situation that has proven true for many or most single-nucleotide polymorphisms.

Risk of prostate cancer increases with age, indicating that inflammatory processes and cumulative exposure to ROS over the life course could be related to carcinogenesis in the prostate. In this study, there was an association in the subgroup of men older than 65 years, whereas no significant association was found in the subgroup of younger men. Vogel et al.¹⁵ also found that age at diagnosis of basal cell carcinoma did not modify the association between genotype and cancer risk. More studies are needed to draw a firm conclusion on the associations between the GPX1 Pro198Leu polymorphism, GPX activity and age in relation with cancer risk.

We also tested the associations stratified by disease status, but the GPX1 genotype was not associated with non-aggressive or aggressive prostate cancer. This is an agreement with results from other studies.^2,25

In conclusion, prostate carcinoma in Turkish subjects is associated with alterations in systemic antioxidant activities, which may play an important role in carcinogenesis. These changes in GPX1 activity may break the balance between oxidative stress and antioxidant defences, and therefore influence the cancer risk. In this context our findings suggest that ROS may play an important role in prostate carcinogenesis, and individual susceptibility of prostate cancer may be modulated by GPX1 polymorphism. We expected that intake of antioxidants would be protective against prostate cancer risk particularly among individuals with a lowered defence against oxidative stress. Nonetheless, more functional studies of the GPX1 polymorphism in other oxidative stress response genes in large-pooled studies will help to clarify their role in prostate carcinogenesis. If confirmed by other studies, these findings could improve the assessment of prostate cancer risk and clinical management in these patients.

Footnotes

This research was supported by grants from the Turkish Scientific and Technical Research Association, Tubitak (to AA) and grants from the Ministry of Education and Science of the Republic of Macedonia (to AJD and AS).

The authors declared no conflicts of interest.

References

Khandrika

Kumar

Koul

Oxidative stress in prostate cancer. Cancer Lett 2009; 282: 125–136.

Arsova-Sarafinovska

Matevska

Eken

Glutathione peroxidase 1 (GPX1) genetic polymorphism, erythrocyte GPx activity, and prostate cancer risk. Int Urol Nephrol 2009; 41: 63–70.

Trzeciak

Nyaga

Jaruga

Cellular repair of oxidatively induced DNA base lesions is defective in prostate cancer cell lines, PC-3 and DU-145. Carcinogenesis 2007; 28: 1359–1370.

Ravn-Haren

Olsen

Tjonneland

Associations between GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol consumption and breast cancer risk in a prospective cohort study. Carcinogenesis 2006; 27: 820–825.

Arthur

. The glutathione peroxidases. Cell Moll Life Sci 2000; 57: 1825–1835.

Chu

Doroshow

Esworthy

. Expression, characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase, GSHPx-GI. J Biol Chem 1993; 268: 2571–2576.

Takahashi

Akasaka

Yamamoto

Primary structure of human plasma glutathione peroxidase deduced from cDNA sequences. J Biochem 1990; 108: 145–148.

Maiorino

Chu

Ursini

Phospholipid hydroperoxide glutathione peroxidase is the 18-kDa selenoproteins expressed in human tumor cell lines. J Biol Chem 1991; 266: 7728–7732.

de Haan

Bladier

Griffiths

. Mice with a homozygous null mutation for the most abundant glutathione peroxidase, GPX1, show increased susceptibility to the oxidative stress-inducing agents paraquat and hydrogen peroxide. J Biol Chem 1998; 273: 22528–22536.

10.

Kote-Jarai

Durocher

Edwards

Association between the GCG polymorphism of the selenium dependent GPX1 gene and the risk of young onset prostate cancer. Prostate Cancer Prostatic Dis 2002; 5: 189–192.

11.

Jablonska

Gromadzinska

Reszka

Association between GPx1 activity and plasma selenium concentration in humans. Eur J Nutr 2009; 48: 383–386.

12.

Diamond

. Role of glutathione peroxidase 1 in breast cancer: loss of heterozygosity and allelic differences in the response to selenium. Cancer Res 2003; 63: 3347–3351.

13.

Knight

Onay

Wells

Genetic variants of GPX1 and SOD2 and breast cancer risk at the Ontario site of breast cancer family registry. Cancer Epidemiol Biomark Prev 2004; 13: 146–149.

14.

Cox

Hankinson

Kraft

No association between GPX1 Pro198Leu and breast cancer risk. Cancer Epidemiol Biomark Prev 2004; 13: 1821–1822.

15.

Vogel

Olsen

Wallin

No association between GPX Pro198Leu and risk of basal cell carcinoma. Cancer Epidemiol Biomark Prev 2004; 13: 1412–1413.

16.

Hansen

Saebo

Skjelbred

GPX Pro198Leu and OGG1 Ser326-Cys polymorphisms and risk of development of colorectal adenomas and colorectal cancer. Cancer Lett 2005; 29: 85–91.

17.

Yang

Bamlet

Ebbert

Glutathione pathway genes and lung cancer risk in young and old populations. Carcinogenesis 2004; 25: 1935–1944.

18.

Raaschou-Nielsen

Sorensen

Hansen

GPX1 Pro198Leu polymorphism, interactions with smoking and alcohol consumption, and risk for lung cancer. Cancer Lett 2007; 247: 293–300.

19.

Forsberg

de Faire

Marklund

Phenotype determination of a common Pro-Leu polymorphism in human glutathione peroxidase 1. Blood Cells Mol Dis 2000; 26: 423–426.

20.

Hansen

Krath

Frederiksen

GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, interaction with alcohol consumption and smoking, and risk of colorectal cancer. Mut Res 2009; 664: 13–19.

21.

Bostwick

. Grading prostate cancer. Am J Clin Pathol 1994; 102: 38–56.

22.

Poncz

Solowiejczyk

Harpel

Construction of human gene libraries from small amounts of pheripheral blood: analysis of beta-like globin genes. Hemoglobin 1982; 6: 27–36.

23.

Ratnasinghe

Tangrea

Andersen

Glutathione peroxidase codon 198 polymorphism variant increases lung cancer risk. Cancer Res 2000; 60: 6381–6383.

24.

Eken

Aydın

Sayal

The effects of hyperbaric oxygen treatment on oxidative stress and SCE frequencies in humans. Clin Biochem 2005; 38: 1133–1137.

25.

Choi

Neuhouser

Barnett

Polymorphisms in oxidative stress- related genes are not associated with prostate cancer risk in heavy smokers. Cancer Epidemiol Biomarkers Prev 2007; 16: 1115–1120.

26.

Aydin

Arsova-Sarafinovska

Sayal

Oxidative stress and antioxidant status in non-metastatic prostate cancer and benign prostatic hyperplasia. Clin Biochem 2006; 39: 176–179.

27.

Jung

Seidel

Rudolph

Antioxidant enzymes in malignant prostate cell lines and in primary cultured prostatic cells. Free Radic Biol Med 1997; 23: 127–133.

28.

Baker

Oberley

Cohen

. Expression of antioxidant enzymes in human prostatic adenocarcinoma. Prostate 1997; 32: 229–233.

29.

Gate

Paul

Nguyen Ba

Oxidative stress induced in pathologies: the role of antioxidants. Biomed Pharmacother 1990; 53: 169–180.

30.

Forsberg

de Faire

Morgenstern

. Oxidative stress, human genetic variation, and disease. Arch Biochem Biophys 2001; 389: 84–93.

31.

Dragsted

Pedersen

Hermetter

The 6-a-day study: effects of fruit and vegetables on markers of oxidative stress and antioxidative defense in healthy nonsmokers. Am J Clin Nutr 2004; 79: 1060–1072.

32.

Neve

. Human selenium supplementation as assessed by changes in blood selenium concentration and glutathione peroxidase activity. J Trace Elem Med Biol 1995; 9: 65–73.

Association of GPX1 polymorphism,GPX activity and prostate cancer risk

Abstract

Keywords

Introduction

Materials and methods

Subjects

Genotyping of GPX1 polymorphism

Erythrocyte GPX activity

Statistical analysis

Results

Subject characteristics

Erythrocyte GPX activity

GPX1 polymorphism and prostate cancer risk

GPX1 polymorphism and age at diagnosis of prostate cancer

GPX1 polymorphism, aggressive versus non-aggressive prostate cancer

GPX1 genotype and GPX activity correlation

Discussion

Footnotes

References