Canine Bocavirus Type 2 Infection Associated With Intestinal Lesions

Abstract

Bocaviruses are small nonenveloped DNA viruses belonging to the Bocaparvovirus genus of the Parvoviridae family and have been linked to both respiratory and enteric disease in humans and animals. To date, 3 bocaviruses, canine bocaviruses 1 to 3 (CBoV-1–3), have been shown to affect dogs with different disease manifestations reported for infected animals. We used next-generation sequencing to identify a novel strain of canine CBoV-2 (CBoV TH-2016) in a litter of puppies that died in Thailand from acute dyspnea and hemoptysis, for which no causal pathogen could be identified in routine assays. Analysis of the complete coding sequences of CBoV TH-2016 showed that this virus was most closely related to a strain previously identified in South Korea (isolate 14D193), with evidence of genetic recombination in the VP2 gene with related strains from South Korea and Hong Kong. Use of quantitative polymerase chain reaction showed the presence of CBoV TH-2016 in several tissues, suggesting hematogenous virus spread, while only intestinal tissue was found to be positive by in situ hybridization and electron microscopy. Histologic small intestinal lesions associated with CBoV TH-2016 infection were eosinophilic intranuclear inclusion bodies within villous enterocytes without villous atrophy or fusion, similar to those previously considered pathognomonic for CBoV-1 infection. Therefore, this study provides novel insights in the pathogenicity of canine bocavirus infections and suggests that a novel recombinant CBoV-2 may result in atypical findings of CBoV infection. Although the specific cause of death of these puppies remained undetermined, a contributory role of enteric CBoV TH-2016 infection is possible.

Keywords

bocavirus canine minute virus dogs genetic analysis pathology recombination

The Parvoviridae family consists of small, nonenveloped, linear single-stranded DNA viruses and is divided into 2 subfamilies: Parvovirinae (infecting vertebrate hosts) and Densovirinae (infecting arthropod hosts). To date, members of 3 of the 8 Parvovirinae genera have been identified in dogs: canine parvovirus (CPV; genus Protoparvovirus), canine bocaviruses 1 to 3 (CBoV-1–3; genus Bocaparvovirus), and canine-associated parvovirus (genus Dependoparvovirus).⁷ CBoV-1 or, as it was referred to initially, canine minute virus (CnMV), was first isolated in Germany in 1967.² Although most CBoV-1 infections in dogs appear to be subclinical, several studies have indicated a pathogenic role, especially in fetal or young puppies and old dogs. This infection is largely associated with respiratory, intestinal, and reproductive problems.^29,38 Severe clinical manifestations appear to be at least partly associated with CBoV-1–induced immunosuppression.^8,30 A second canine Bocaparvovirus (CBoV-2) was identified in 2012 in association with canine respiratory diseases, in a metagenomic study looking for hitherto unknown canine viruses.¹⁸ The NS, NP, and VP genes of CBoV-2 share less than 63%, 62%, and 64% amino acid identity with those of CBoV-1, respectively.¹⁸ CBoV-2 infection also has been associated with massive enteritis in a litter of dogs with atrophied and fused villi, severe crypt regeneration, and severe bone marrow and lymphoid atrophy.³ In addition, interstitial pneumonia has been reported to be a feature of CBoV-2 infection.⁶ Therefore, CBoV-2–infected dogs may present with respiratory and enteric disease, as is also observed in human bocavirus (HBoV) infections. Finally, a third species of canine bocaparvovirus (CBoV-3) was identified in the liver of a dog coinfected with a recently identified circovirus.²⁷

In the present study, we performed next-generation sequencing to identify pathogens in a litter of puppies that died from acute dyspnea and hemoptysis, for which common causal agents were ruled out in routine assays.

Materials and Methods

Animals and Postmortem Examination

Three 2-week-old Welsh Corgi puppies died in Thailand with acute severe dyspnea and hemoptysis, while their dam had remained asymptomatic. The puppies were subjected to routine postmortem examination at the Department of Pathology, Faculty of Veterinary Science, Chulalongkorn University. Samples of viscera were fixed in 10% neutral buffered formalin, and 3-μm-thick histologic sections were routinely prepared and stained with hematoxylin and eosin (HE). Fresh tissues, including lung, liver, and tracheobronchial lymph nodes, were collected aseptically and kept at –80°C.

Routine Diagnostic Virology, Bacteriology and Immunohistochemistry

Fresh tissues were subjected to routine virological and bacteriological diagnostic assays. Samples were individually homogenized (FastPrep-24 5G; MP Biomedicals, Santa Ana, CA) and centrifuged to collect the supernatant, which was used for nucleic acid isolation. Total viral nucleic acids were extracted (Viral Nucleic Acid Extraction Kit II; GeneAid, Taipei, Taiwan) according to the manufacturer’s protocol. Total complementary DNA (cDNA) was synthesized using 100 ng RNA as the template for cDNA synthesis (Omniscript Reverse Transcription Kit; Qiagen GmbH, Hilden, Germany). Samples were tested by multiplex polymerase chain reaction (PCR) protocols to detect the presence of canine influenza virus, canine parainfluenza virus, canine distemper virus, canine respiratory coronavirus, canine adenovirus types 1 and 2, and canine herpesvirus type 1.³⁵ Moreover, pan-PCR assays specific for paramyxovirus, coronavirus, and herpesvirus were carried out on the extracted nucleic acid as previously described with minor modifications.^21,41,42 Small intestine and lymph node sections were subjected to immunohistochemistry (IHC) using a mouse monoclonal anti–canine parvovirus antibody 1.B.450 (Abcam, Cambridge, UK). For routine diagnostic bacteriology, the frothy tracheal exudate was cultured on standard agar under aerobic conditions (Department of Veterinary Microbiology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand).

Sample Preparation for Next-Generation Sequencing and Genome Assembly

As the puppies were suspected to have died of a respiratory problem, lung samples of 3 puppies were individually prepared for deep sequencing using a modified sequence-independent single-primer amplification protocol.¹ Briefly, after homogenization, RNA was extracted (Qiamp Viral RNA mini kit; Qiagen GmbH) following the manufacturer’s recommendation. Extracted RNA was then transcribed to cDNA using a mixture of random¹ and nonribosomal hexamers¹⁰ (SuperScript IV; Invitrogen, Thermo Fisher Scientific, Waltham, MA),¹⁰ followed by a Klenow reaction. Samples were randomly amplified using described primers and Taq polymerase (Invitrogen, Thermo Fisher Scientific),¹ and PCR products were purified. Final DNA concentrations were measured using PicoGreen (Invitrogen, Thermo Fisher Scientific). After samples were prepared, a DNA library was constructed following the NexteraXT protocol (Illumina, San Diego, CA) and deep-sequenced on an Illumina MiSeq system using MiSeq Reagent kit V3 (300 × 2 cycles). Raw reads were initially screened by an in-house metagenomics pipeline to identify viral reads. The software Trimmomatic version 0.36 (RWTH Aachen University, Germany) was used for quality-based trimming and adapter removal. The passed and processed reads were mapped to the full viral NCBI GenBank DNA and Peptide database using the software Bowtie 2 version 2.2.9 (Johns Hopkins University, Baltimore, Maryland, USA) for DNA mapping and Pauda version 1.0.1 (University of Tübingen, Baden-Württemberg, Germany) for translation and amino acid mapping.^16,23 Species were ranked according to the number of reads mapped to each species, and read positions of the top findings were visualized for further selection of biologically reasonable taxa. Reference assembly was performed with CLC Genomics Workbench 9.0 software (CLC Bio, Aarthus, Denmark).

CBoV-2–Specific PCR

Upon identification of CBoV-2 sequences, specific CBoV-2 primers were designed based on sequences obtained from next-generation sequencing (NGS) reads (Suppl. Table S1) to obtain a complete consensus sequence. PCR reactions with a total volume of 50 μl were prepared as follows: 5× Phusion HF Buffer, 10 mM dNTP, 1 U Phusion DNA polymerase (New England Biolab, Ipswich, MA), 10 μM final concentration of each primer, and 2 μl template. Conditions for CBoV-2–specific PCR were as follows: initial denaturation at 98°C for 30 seconds, followed by 45 cycles of 98°C for 20 seconds, 50°C for 30 seconds, 72°C for 1 minute, and a final extension at 72°C for 7 minutes. The PCR products were run on a 1% agarose gel, and amplified products were purified and Sanger sequenced (Eurofins Genomics, Munich, Germany). Previously known CBoV-2 DNA and no template control (NTC) were used as positive and negative controls, respectively.

Genome Analyses

The newly obtained CBoV-2 sequence from Thailand (GenBank accession No. MG025952) was compared to those of other strains of CBoV-2 using MAFFT alignment version 7(Computational Biology Research Consortium, Tokyo, Japan). Phylogenetic analyses were carried out with MEGA 7 (The Biodesign Institute, Tempe, AZ).²² A phylogenetic tree was constructed using the neighbor-joining method with GTR+G+I as a best-fit model of nucleotide substitution according to the Bayesian information criterion. Bootstrap analysis was performed using 1000 replicates. Pairwise distance of CBoV-2 genome, NS1, NP, VP1/2, and ORF4 was calculated using BioEdit (Ibis Biosciences, Carlsbad, CA). Genetic recombination was analyzed by using the similarity plot and bootscan tools in the SimPlot software package version 3.5.1 (SCRoftware Baltimore, MD) modeled with a window size of 200 bp and step size of 20 bp.²⁸

Screening for CBoV-1 and CBoV-2

To distinguish between CBoV-1 and CBoV-2 infection, nucleic acids of fresh lung, liver, and lymph node tissue samples were extracted as described previously. DNA from formalin-fixed, paraffin-embedded (FFPE) containing small intestine tissue was extracted using QIAamp DNA FFPE Tissue Kit (Qiagen GmbH) following the manufacturer’s recommendations. The extracted DNA was tested with CBoV-2–specific primers (forward: GCTGTACGGATGTGTGAA; reverse: CAGACACTTGGCCTGCTCTA).³ For CBoV-1, 3 sets of specific primers were used as described previously—CBoV-1_596+, AACGCGATTTGCACCTTCAT; CBoV-1_1113–, CATCAAACATTTCTCCGGCA;⁵ CBoV-1_3514+, GTGGTATGCACCTATATACAACGGAC; CBoV-1_4765–, GATGGAACTCTGCCTATGTCGCATCCG;³¹ CBoV-1_4376+, AGGACCATCGCTTGGATACATT; CBoV-1_4445–, TACTGGTCCGAGGGCTTGTT⁴⁰—and designed primers based on alignment of CBoV-1 sequences available in GenBank as CBoV-1_401+, TCTCGATGATCCATCCGTGT and CBoV-1_491–, GGAATCAGGTCCA TGTGTCTC were used for CBoV-1 detection. The synthetic CBoV-1 sequence was retrieved from consensus NS1 regions of CBoV-1 strains available in GenBank and used as positive control for PCR. The reactions consisted of 5× OneTaq Buffer, 10 mM dNTP, 1 U Hot start Taq polymerase (New England Biolab), 10 μM final concentration of each primer, and 2 μl template. The PCR conditions were as follows: initial denaturation at 94°C for 5 minutes, followed by 45 cycles of 94°C for 30 seconds, 50°C for 30 seconds, 72°C for 30 seconds, and a final extension at 72°C for 10 minutes. The PCR products were run on a 2% agarose gel, and all positive samples were Sanger sequenced.

To estimate the amount of CBoV-2 DNA in different organs, a SYBR Green–based quantitative PCR (qPCR) (Brilliant III Ultra-Fast SYBR Green qPCR; Agilent, Santa Clara, CA) was performed in the AriaMx Real-time PCR system (Agilent, Santa Clara, CA). The reaction comprised 250 nM of each CBoV-2 specific primer (forward: GCTGTACGGATGTGTGAA; reverse: CAGACACTTGGCCTGCTCTA), 2 μl template, and 1× SYBR Green mix. The PCR conditions were as follows: 95°C for 3 minutes followed by 40 cycles of 95°C for 10 seconds, 50°C for 10 seconds, and 60°C for 10 seconds. The amplicon melting temperature profile consisted of 95°C for 30 seconds, 60°C for 30 seconds, and 95°C for 30 seconds. A positive amplicon was expected to melt at 82.5°C. An output Ct value was used to estimate the amount of virus present. Previously known CBoV-2 genome and the NTC were used as positive and negative controls.³ All positive samples were subsequently sequenced (Eurofins Genomics, Munich, Germany).

In Situ Hybridization and Transmission Electron Microscopy

To confirm the presence of CBoV-2, in situ hybridization (ISH) was performed on FFPE tissues, including heart, trachea, lung, liver, gallbladder, spleen, kidney, pancreas, small intestine, and lymph nodes. Probes covering 124 bp of the NS1 gene of the canine bocavirus (GenBank Accession number KF771828; nt 1490-1513) were used as described previously.³ Briefly, FFPE sections were deparaffinized using xylene, hydrated in graded ethanol, and washed in diethyl pyrocarbonate (DEPC)–treated water. For proteolytic digestion of samples, 1μg/ml proteinase K (Roche Diagnostics, Basel, Switzerland) was applied. Following postfixation, acetylation, and prehybridization, an overnight incubation with 500 ng/100 μl sense and antisense probe, respectively, at 52°C was performed. For detection, an anti-DIG antibody (diluted 1:200) conjugated with alkaline phosphatase (Roche Diagnostics) was used in combination with nitrobluetetrazoliumchloride (NBT; Sigma-Aldrich, St Louis, MO) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, X-Phosphate; Sigma-Aldrich) as substrates. Purple precipitates with a clear, cellular association were considered positive. A known CBoV-2–positive section was used as a positive control.³ A nonprobe incubation served as a negative control.

Transmission electron microscopy for demonstration of virus particles within intranuclear inclusions of enterocytes was performed using the pop-off technique as described.²⁶

Results

Gross and Histopathology

Gross pathological examination of the 3 carcasses showed nasal discharge with frothy and bloody tracheal fluid, multifocal discoloration of lung lobes, slightly blunted edges of the liver and spleen, and brownish mucus with milk curd in the stomach and small intestines. Microscopic examination revealed multiple eosinophilic intranuclear inclusion bodies within villous and, to a lesser extent, crypt enterocytes of the small intestine (Fig. 1). One of the animals showed mild to moderate, multifocal infiltration of the small intestinal mucosa with neutrophils and low to moderate numbers of intraluminal nematodes. No atrophy or fusion of villi was detected. Apart from variable degrees of alveolar edema and emphysema, lungs and trachea displayed no inflammation or other significant histologic lesions (Suppl. Fig. S1).

Figures 1–2. Canine bocavirus 2 infection, small intestine, dog. Figure 1. Multiple intranuclear inclusion bodies (inset) are present within villous enterocytes. Hematoxylin and eosin. Figure 2. Strong positive signals (purple color) within the nuclei of enterocytes corresponding to the intranuclear inclusion bodies seen in hematoxylin and eosin-stained sections. In situ hybridization for CBoV-2.

Detection of CBoV-2 by NGS

The multiplex and pan-virus family PCR assays were negative, while no CPV antigen was detected in small intestine by IHC. Aeromonas hydrophila and Klebsiella sp bacteria were cultivated from tracheal fluid but were associated with pneumonia and considered nonpathogenic. Analyses of NGS data obtained from the metagenomics investigation identified the presence of CBoV-2 (66, 36, and 58 reads) in lung samples from all 3 puppies (Suppl. Figs. S2–S4). Approximately 0.005% of reads were mapped to the CBoV-2 genome. A reference assembly was performed using reads from all 3 CBoV-2–positive puppies to construct a consensus viral genome. However, as gaps were still present in this sequence, multiple conventional PCR assays were performed using primers designed for the newly identified CBoV-2, named CBoV TH-2016 (GenBank Accession No. MG025952). A 5126-bp nearly complete genome sequence was recovered, which comprised the 3 main open reading frames (ORFs). ORF1 encoded the overlapping nonstructural proteins (NS), NS1 (nt 226–2607; 794 amino acids) and NS2 (nt 226–2137 and nt 2212–2607; 637 and 132 amino acids). ORF2 encoded the overlapping viral capsid proteins VP1 (nt 2943–5060; 706 amino acids) and VP2 (nt 3357–5060; 568 amino acids). ORF3 encoded the nucleoprotein (NP) (nt 2372–2959; 196 amino acids). Furthermore, ORF4 (nt 2173–2607) was also detected downstream of the NS1 in this consensus sequence (Fig. 3). Phylogenetic analyses of the complete CBoV-2 genomes revealed that CBoV TH-2016 was most closely related to a strain from South Korea (GenBank accession No. KP281718; 93.3% pairwise nucleotide and 87.8% amino acid identity) (Suppl. Fig. S5). However, the phylogenetic tree based on VP1/2 and NS1 sequences revealed that CBoV TH-2016 grouped to the clades of South Korea and Hong Kong strains, respectively (Suppl. Figs. S6, S7). In addition, a deletion of 18 nucleotides was present in the VP1/2 gene, starting from nt 3699 to nt 3716. The pairwise distances of NS1/2, NP, VP1/2, and ORF4 between CBoV TH-2016 and other CBoV-2 strains are shown in Table 1.

Figure 3.

Genome scheme of CBoV-2 TH-2016 coding for the genes NS1/2, NP1, ORF4, and VP1/2.

Table 1.

Pairwise Comparison of Nucleotide and Deduced Amino Acid Sequences of CBoV TH-2016 With CBoV-2 Strains in Other Countries.

CBoV-2 Strains		Nucleotides/Amino acids Similarity (%)
		Whole Genome^a	Nonstructural Regions		Structural Region	ORF4^e
		Whole Genome^a	NS1/2^b	NP^c	VP1/2^d	ORF4^e
United States, 2010	JN648103 Con-161	87.4/79.1	79.2/91.0	97.4/98.4	88.7/91.0	NA
Hong Kong, 2010	JQ692591 HK831F	91.7/84.4	79.4/91.4	98.4/99.4	88.9/91.4	98.1/97.9
	JQ692590 HK882U	92.8/84.7	79.7/92.5	99.1/99.4	89.1/92.5	98.6/98.6
	JQ692588 HK880N	92.0/84.2	79.7/92.4	99.1/99.4	89.0/92.4	98.6/98.6
	JQ692589 HK882F	91.8/84.0	79.7/92.5	99.1/99.4	89.1/92.5	98.6/98.6
Germany, 2013	KF771828, F13000791S	91.2/82.8	80.7/91.7	96.7/98.4	89.0/91.7	NA
South Korea, 2014	KP281720 14Q216	90.7/82.8	81.9/91.5	98.4/98.4	88.6/91.5	98.1/97.9
	KP281715 13D226-1	91.0/83.4	82.0/92.4	98.8/99.4	89.1/92.4	97.7/98.6
	KP281716 13D250	90.9/83.1	79.5/91.4	99.4/99.4	88.7/91.4	98.6/97.9
	KP281717 14D142	91.2/83.7	81.9/92.1	98.8/99.4	89.7/92.1	NA
	KP281719 14Q209	93.2/87.6	81.4/97.5	98.8/99.4	94.7/97.5	97.9/97.9
	KP281718 14D193	93.3/87.8	97.7/97.8	99.3/99.4	94.8/97.8	97.9/98.6
	KP281714 13D095	93.2/87.5	97.2/98.1	98.8/98.9	95.1/98.1	NA
	KP281713 13D003	91.6/86.0	82.0/97.5	98.9/99.4	95.2/97.5	NA
China, 2016	KY038922 GZHD15	91.0/83.4	97.8/91.5	98.9/100	89.1/91.5	NA

Abbreviations: CBoV, canine bocavirus; NA, no data available.

^aMean similarity: 92.2%/86.1%.

^bMean similarity: 91.9%/94.4%.

^cMean similarity: 98.3%/98.8%.

^dMean similarity: 90.1%/94.4%.

^eMean similarity: 97.5%/97.4%.

Similarity plot and bootscan analysis revealed that CBoV TH-2016 shared sequences of putative parental CBoV-2 strains detected in South Korea and China/Hong Kong. A potential recombination break point was identified near the start codon of VP2 gene, which had high similarity to CBoV-2 detected in South Korea (Suppl. Figs. S8, S9).

Screening Tissues for the Presence of CBoV-1 and CBoV-2

Due to the close relationship of CBoV-1 and CBoV-2, the observation that intestinal lesions were found that had been considered pathognomonic for CBoV-1 infection and confirmation of CBoV-2 infection in various organs in the absence of CBoV-1, CBoV-1–specific conventional PCRs were used to confirm the unique presence of CBoV-2, concordant with the NGS findings. CBoV-2 was identified by PCR in lung, liver, tracheobronchial lymph node, and intestinal FFPE samples, whereas CBoV-1 could not be detected in any of the analyzed tissues. Sequences of all CBoV-2–positive samples were identical to the NGS-derived CBoV-2 sequence. CBoV-2 was also detected by qPCR in all analyzed tissues except the lymph nodes of 2 dogs. The lowest Ct value (highest amount of viral nucleic acid) was observed in FFPE-derived intestinal samples, followed by lung, liver, and lymph node samples (Table 2).

Table 2.

Detection of Canine Bocavirus 2 by Using Conventional PCR, qPCR, and ISH in Various Organs of 3 Puppies With Respiratory Disease.

Animal	Samples	Methods
Animal	Samples	PCR	qPCR (Ct value)	ISH
1	Lung	+	+ (20.00)	–
	Intestine	+	+ (13.72)	+
	Liver	+	+ (26.71)	–
	Lymph node	–	+ (30.44)	–
	Others^a	NA	NA	–
2	Lung	+	+ (20.17)	–
	Intestine	+	+ (15.00)	+
	Liver	+	+ (20.23)	–
	Lymph node	+	–	–
	Others^a	NA	NA	–
3	Lung	+	+ (20.4)	–
	Intestine	+	+ (19.24)	+
	Liver	+	+ (15.74)	–
	Lymph node	+	–	–
	Others^a	NA	NA	–

Abbreviations: ISH, in situ hybridization; NA, no data available; PCR, polymerase chain reaction; qPCR, quantitative polymerase chain reaction.

^aOther organs, including gallbladder, heart, kidneys, pancreas, spleen, and trachea, were tested with ISH.

ISH and Transmission Electron Microscopy

Tissue samples from the 3 puppies, including heart, trachea, lung, lymph nodes, liver, gallbladder, pancreas, small intestine, kidneys, and spleen, were examined by ISH to determine the cellular tropism of CBoV-2. Within several sections of small intestine, a nuclear signal for CBoV-2 was observed in many enterocytes, which were mainly located at the villus tips (Fig. 2) and, to a lesser extent, within crypts. Similarly, a positive signal was obtained in sloughed enterocytes within the small intestinal lumen, compared with the negative control (Suppl. Fig. S10). No ISH signal was detected in any of the other tissues investigated.

Transmission electron microscopy was used to verify the presence of virus particles within apical small intestinal enterocytes. Numerous electron-dense, icosahedral virus particles measuring about 20 nm in diameter were found, aggregated to large, intranuclear inclusion bodies in these cells (Fig. 4).

Figure 4.

Canine bocavirus 2 infection, small intestine, dog. An inclusion body (IB) within a nucleus (arrows) with marginalized heterochromatin of a small intestinal enterocyte contains aggregates of numerous virions (inset). Bar = 1 μm and 0.1 μm (inset). Transmission electron microscopy.

Discussion

In the present study, we investigated the cause of death of a litter of puppies in Thailand. Although respiratory failure was initially suspected, gross and histopathological analyses did not show any significant lesions in respiratory tissues. Routine postmortem investigations aiming at identifying pathogens known to be associated with canine respiratory disease were also negative. This prompted us to search for other viral pathogens by NGS, resulting in the identification of CBoV-2 in all puppies. Recently discovered viruses of the genus Bocaparvovirus have been associated with gastrointestinal and respiratory disease in several mammalian species, including humans and dogs.^3,6,12,37 Based on comparative phylogenetic analyses of the nucleotide sequences generated, CBoV TH-2016 was found to be a novel strain of CBoV-2,^3,5 most closely related to previously identified CBoV-2 strains from South Korea and Hong Kong. However, the histopathological presentation of CBoV TH-2016 infection was different from that of previously described CBoV-2 infections,^3,6 and it was similar to that described for natural and experimental CBoV-1 (or CnMV) infections: intranuclear inclusion bodies in enterocytes without substantial inflammatory reaction.^4,17,33 In contrast, previously reported cases of CBoV-2 infections in puppies had lesions of severe enteritis with massive atrophy of villi, as well as bone marrow and generalized lymphoid depletion with evidence of virus replication in the cytoplasm of lymphoid cells.³ However, these lesions were not present in the 3 puppies in the current report. Most of the viruses belonging to the Parvoviridae family replicate in mitotically active cells such as intestinal crypt epithelial cells; however, recent studies demonstrated the presence of parvoviruses in typically nonmitotic cells such as neurons.^11,34,36 Furthermore, the pathogenesis of bocaviruses with respect to tissue tropism and replication is not well documented. In this way, the CBoV-2 infection in these puppies resembled that of CBoV-1, which shows viral inclusion bodies in enterocytes.¹³ Therefore, further studies of CBoV-2 pathogenesis are needed.

The demonstration of CBoV-2 in lungs and other organs by NGS and PCR, in the absence of CBoV-2 ISH signal outside the intestinal tract, was consistent with hematogeneous spread of CBoV TH-2016 from the infected intestinal tract. Similar findings of PCR-positive but ISH-negative tests in the lungs in CBoV-2–infected dogs were also recently reported⁶ and are consistent with previous detection of CBoV-2 in both respiratory and intestinal tract samples.^3,6,18,24 Since CBoV-1 has been associated with enteric lesions quite similar to those described here,² we confirmed the absence of CBoV-1 infection in these puppies using 4 different CBoV-1–specific PCR assays carried out on the tissues that were CBoV-2-positive (data not shown).

The newly identified CBoV TH-2016 was found to contain a unique 18-nucleotide deletion in the VP2 gene of CBoV-2, a finding previously reported to be associated with respiratory disease in puppies,¹⁸ while CBoV-2 strain F13000791 S, associated with severe enteritis, did not contain this deletion.³ However, the significance of this deletion for association with respiratory disease remains to be determined, as no amino acid deletions were detected in the VP2 gene in another recent case of a CBoV-2 infection of a dog with severe respiratory disease.⁶ Interestingly, the presence of ORF4 in CBoV TH-2016, which was not associated with any lesions in respiratory tissues, is in line with the observation of the absence of ORF4 in dogs with respiratory disease.⁶ Finally, CBoV TH-2016 has a relatively long NS1 region, encoding 793 amino acids. This finding is consistent with a previous study suggesting that some strains of the CBoV-2 genome possess a putative second exon encoding the C-terminal region of NS1 and conserved RNA-splicing signals close to the NS1 gene that may lead to the generation of a longer NS1 protein.^18,24 Recent studies have documented, however, that the longer NS1 protein is observed in dogs showing respiratory disease.^6,18

In contrast to many DNA viruses that show limited evolutionary kinetics, parvoviruses are capable of rapid evolution, resulting in novel species and genotypes and species with similar evolutionary dynamics to that observed for RNA viruses.^9,32,39 Similarly, recent studies have indicated that human and animal bocaviruses, such as HBoV, porcine bocavirus (PBoV), and feline bocavirus (FBoV), readily undergo genetic rearrangement and recombination.^{14,15,19,20,24,25} Phylogenetic analyses of the CBoV TH-2016 genome and VP1/2 sequences show a close evolutionary relationship with CBoV-2 strains detected in South Korea. However, analysis of the NS1 region alone suggested that this strain is most closely related to CBoV-2 strains identified in Hong Kong. Indications for genetic recombination located at the VP1/2 gene of CBoV TH-2016 as identified in this study should be subject to further investigation.

Since these studies collectively indicated that a unique deletion in the VP1/2 gene, the absence of ORF4, and the presence of a longer NS1 gene may all be associated with changes in viral pathogenesis and virulence of CBoV-2,^6,18 further studies linking viral pathogenesis and virulence with molecular CBoV-2 markers are warranted. As clinical manifestations and genetic organization of animal and human bocaviruses appear to be similar, further studies of natural and experimental infections of bocaviruses in dogs may shed light on the molecular basis of the pathogenesis and virulence of members of the genus Bocaparvovirus in humans and animals.

Taken together, we have identified a novel strain of CBoV-2 (CBoV TH-2016) that shares genetic traits with previously identified strains in Hong Kong and South Korea, with evidence for genetic recombination. Naturally infected dogs showed histopathological intestinal lesions similar to those described in CBoV-1 infection and quite distinct from those hitherto described for CBoV-2 infections. Testing for the novel virus in samples from diseased dogs with negative results in routine laboratory investigations may be warranted, as an emergence of novel recombinant CBoV-2 may lead to atypical findings. Although the cause of death of the puppies could not be established unequivocally, a contributory role of enteric CBoV TH-2016 infection cannot be excluded.

Supplemental Material

Supplemental Material, DS1_VET_10.1177_0300985818755253 - Canine Bocavirus Type 2 Infection Associated With Intestinal Lesions

Supplemental Material, DS1_VET_10.1177_0300985818755253 for Canine Bocavirus Type 2 Infection Associated With Intestinal Lesions by Chutchai Piewbang, Wendy K. Jo, Christina Puff, Martin Ludlow, Erhard van der Vries, Wijit Banlunara, Anudep Rungsipipat, Jochen Kruppa, Klaus Jung, Somporn Techangamsuwan, Wolfgang Baumgärtner, and Albert D. M. E. Osterhaus in Veterinary Pathology

Footnotes

Acknowledgements

Outstanding techniques were supported by Mareike Schubert, Kerstin Rohn, and Danuta Waschke, University of Veterinary Medicine Hannover, Germany.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was in part supported by the Niedersachsen–Research Network on Neuroinfectiology (N-RENNT) of the Ministry of Science and Culture of Lower Saxony, Germany, and also by the COMPARE project, which received funding from the European Union’s Horizon 2020 research and innovation program COMPARE (grant agreement no. 643476). C.P. was supported by the 100th Anniversary Chulalongkorn University Fund for Doctoral Scholarship and Oversea Research Experience Scholarship for Graduate Students. This work was partially funded by the Thailand Research Fund (S.T., grant number TRG5780250); grant for Joint Funding of External Research Project, Ratchadaphiseksomphot Endowment Fund, Veterinary Science Research Fund, Chulalongkorn University (S.T., grant number RES_57_397_31_037); and the National Research Council of Thailand (S.T., grant number GRB_APS_38_59_31_02).

Supplementary material for this article is available online.

References

Allander

Emerson

Engle

. A virus discovery method incorporating DNase treatment and its application to the identification of two bovine parvovirus species. Proc Natl Acad Sci U S A. 2001;98(20):11609–11614.

Binn

Lazar

Eddy

. Recovery and characterization of a minute virus of canines. Infect Immun. 1970;1(5):503–508.

Bodewes

Lapp

Hahn

. Novel canine bocavirus strain associated with severe enteritis in a dog litter. Vet Microbiol. 2014;174(1–2):1–8.

Carmichael

Schlafer

Hashimoto

. Minute virus of canines (MVC, canine parvovirus type-1): pathogenicity for pups and seroprevalence estimate. J Vet Diagn Invest. 1994;6(2):165–174.

Choi

J-W

Jung

J-Y

Lee

J-I

. Molecular characteristics of a novel strain of canine minute virus associated with hepatitis in a dog. Arch Virol. 2016;161(8):2299–2304.

Choi

J-W

Lee

K-H

Lee

J-I

. Genetic characteristics of canine bocaviruses in Korean dogs. Vet Microbiol. 2015;179(3):177–183.

Cotmore

Agbandje-McKenna

Chiorini

. The family Parvoviridae. Arch Virol. 2014;159(5):1239–1247.

Decaro

Altamura

Pratelli

. Evaluation of the innate immune response in pups during canine parvovirus type 1 infection. New Microbiol. 2002;25(3):291–298.

Duffy

Shackelton

Holmes

. Rates of evolutionary change in viruses: patterns and determinants. Nat Rev Genet. 2008;9(4):267–276.

10.

Endoh

Mizutani

Kirisawa

. Species-independent detection of RNA virus by representational difference analysis using non-ribosomal hexanucleotides for reverse transcription. Nucleic Acids Res. 2005;33(6):e65.

11.

Garigliany

Gilliaux

Jolly

. Feline panleukopenia virus in cerebral neurons of young and adult cats. BMC Vet Res. 2016;12:28.

12.

Guido

Tumolo

Verri

. Human bocavirus: current knowledge and future challenges. World J Gastroenterol. 2016;22(39):8684–8697.

13.

Harrison

Styer

Pursell

. Fatal disease in nursing puppies associated with minute virus of canines. J Vet Diagn Invest. 1992;4(1):19–22.

14.

Hoelzer

Shackelton

Holmes

. Within-host genetic diversity of endemic and emerging parvoviruses of dogs and cats. J Virol. 2008;82(22):11096–11105.

15.

Hogan

Faust

. Nonhomologous recombination in the parvovirus chromosome: role for a CTATTTCT motif. Mol Cell Biol. 1986;6(8):3005–3009.

16.

Huson

Xie

. A poor man’s BLASTX—high-throughput metagenomic protein database search using PAUDA. Bioinformatics. 2014;30(1):38–39.

17.

Jarplid

Johansson

Carmichael

. A fatal case of pup infection with minute virus of canines (MVC). J Vet Diagn Invest. 1996;8(4):484–487.

18.

Kapoor

Mehta

Dubovi

. Characterization of novel canine bocaviruses and their association with respiratory disease. J Gen Virol. 2012;93(pt 2):341–346.

19.

Kapoor

Simmonds

Slikas

. Human bocaviruses are highly diverse, dispersed, recombination prone, and prevalent in enteric infections. J Infect Dis. 2010;201(11):1633–1643.

20.

Kapoor

Slikas

Simmonds

. A newly identified bocavirus species in human stool. J Infect Dis. 2009;199(2):196–200.

21.

Ksiazek

Erdman

Goldsmith

. A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med. 2003;348(20):1953–1966.

22.

Kumar

Stecher

Tamura

. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870–1874.

23.

Langmead

Salzberg

. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357–359.

24.

Lau

Woo

Yeung

. Identification and characterization of bocaviruses in cats and dogs reveals a novel feline bocavirus and a novel genetic group of canine bocavirus. J Gen Virol. 2012;93(pt 7):1573–1582.

25.

Lau

Woo

Yip

. Co-existence of multiple strains of two novel porcine bocaviruses in the same pig, a previously undescribed phenomenon in members of the family Parvoviridae, and evidence for inter- and intra-host genetic diversity and recombination. J Gen Virol. 2011;92(pt 9):2047–2059.

26.

Lehmbecker

Rittinghausen

Rohn

. Nanoparticles and pop-off technique for electron microscopy: a known technique for a new purpose. Toxicol Pathol. 2014;42(6):1041–1046.

27.

Pesavento

Leutenegger

. A novel bocavirus in canine liver. Virol J. 2013;10:54.

28.

Lole

Bollinger

Paranjape

. Full-length human immunodeficiency virus type 1 genomes from subtype C–infected seroconverters in India, with evidence of intersubtype recombination. J Virol. 1999;73(1):152–160.

29.

Macartney

Parrish

Binn

. Characterization of minute virus of canines (MVC) and its pathogenicity for pups. Cornell Vet. 1988;78(2):131–145.

30.

Manteufel

Truyen

. Animal bocaviruses: a brief review. Intervirology. 2008;51(5):328–334.

31.

Mochizuki

Hashimoto

Hajima

. Virologic and serologic identification of minute virus of canines (canine parvovirus type 1) from dogs in Japan. J Clin Microbiol. 2002;40(11):3993–3998.

32.

Nguyen

Wong

Heegaard

. Identification and characterization of a second novel human erythrovirus variant, A6. Virology. 2002;301(2):374–380.

33.

Ohshima

Kawakami

Abe

. A minute virus of canines (MVC: canine bocavirus) isolated from an elderly dog with severe gastroenteritis, and phylogenetic analysis of MVC strains. Vet Microbiol. 2010;145(3–4):334–338.

34.

Pfankuche

, Vries

Evd

. Neuronal vacuolization in feline panleukopenia virus infection [published online ahead of print January 1, 2017]. Vet Pathol.

35.

Piewbang

Rungsipipat

Poovorawan

. Development and application of multiplex PCR assays for detection of virus-induced respiratory disease complex in dogs. J Vet Med Sci. 2016;78(12):1847–1854.

36.

Schaudien

Polizopoulou

Koutinas

. Leukoencephalopathy associated with parvovirus infection in Cretan hound puppies. J Clin Microbiol. 2010;48(9):3169–3175.

37.

Schildgen

Muller

Allander

. Human bocavirus: passenger or pathogen in acute respiratory tract infections? Clin Microbiol Rev. 2008;21(2):291–304.

38.

Schwartz

Green

Carmichael

. The canine minute virus (minute virus of canines) is a distinct parvovirus that is most similar to bovine parvovirus. Virology. 2002;302(2):219–223.

39.

Servant

Laperche

Lallemand

. Genetic diversity within human erythroviruses: identification of three genotypes. J Virol. 2002;76(18):9124–9134.

40.

Sun

Chen

Cheng

. Molecular characterization of infectious clones of the minute virus of canines reveals unique features of bocaviruses. J Virol. 2009;83(8):3956–3967.

41.

Tong

Chern

. Sensitive and broadly reactive reverse transcription–PCR assays to detect novel paramyxoviruses. J Clin Microbiol. 2008;46(8):2652–2658.

42.

VanDevanter

Warrener

Bennett

. Detection and analysis of diverse herpesviral species by consensus primer PCR. J Clin Microbiol. 1996;34(7):1666–1671.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

3.72 MB