Sage Journals: Discover world-class research

Abstract

Tissue function is regulated by the extracellular microenvironment including cell basement membranes, in which laminins are a major component. Previously, we found that laminin-1 promotes differentiation and survival of pancreatic islet cells. Here we characterize the expression pattern of laminins and their integrin receptors in adult pancreas. Although they are expressed in the basement membrane of acinar cells and duct epithelium, no laminin chains examined were detected extracellularly in the pancreatic islets. In contrast to laminin β₁- and γ₁-chains, the α₁-chain, unique to laminin-1, was not detected. Laminin-10 (α₅β₁γ₁) was expressed in acinar tissue, whereas laminins-2 (α₂β₁γ₁) and -10 were expressed in the blood vessels. The laminin connector molecule, nidogen-1, had a distribution similar to that of laminin β₁ and γ₁, whereas fibulin-1 and -2, which compete with nidogen-1, were mostly confined to blood vessels. Integrin subunits α₆ and α₃ were detected in acinar cells and duct epithelial cells, but α₆ was absent in islet cells. Integrin α₆β₄ was detected only in duct cells, α₆β₁ in both acinar and ductal cells, and α₃β₁ in acinar, duct, and islet cells. These findings are a basis for further investigation of the role of extracellular matrix molecules and their receptors in pancreas function.

Keywords

laminin nidogen fibulin integrin pancreas

The pancreas is derived from the foregut endoderm and comprises three main elements: exocrine tissue, which produces and secretes digestive enzymes; a duct system that transports the digestive enzymes to the intestinal tract; and endocrine tissue, the islets of Langerhans, which secrete hormones, predominantly insulin, to regulate blood glucose metabolism and homeostasis. Pancreatic development and function, as for other organs, depends on cooperative extracellular signals, both soluble hormones and growth factors and cell-associated insoluble extracellular matrix (ECM) proteins (Lelievre et al. 1996). We have shown that the ECM protein laminin-1 promotes differentiation of fetal pancreatic cells into β-cells in vitro (Jiang et al. 1999). In the adult, islet cell-ECM interactions are proposed to be required for β-cell survival and function (Wang et al. 1999), and in adult rat islets laminin-5 is known to enhance insulin secretion in vitro (Bosco et al. 2000). Laminin is the major component (80%) of the basement membrane of epithelial and endothelial cells. It is a heterotrimeric glycoprotein (Mr 850,000) composed of disulfide bonded α (400 kD)-, β (210 kD)- and γ (200 kD)-chains (Colognato and Yurchenco 2000; Tunggal et al. 2000). Altogether, 11 laminin chains have been cloned, including α_1–5-, β_1–3-, and γ_1–3-chains, and 12 laminin isoforms have been identified (Erickson and Couchman 2000; Tunggal et al. 2000). Laminin connects to collagen IV, another key component of the BM, by a bridging molecule called nidogen-1 (Timpl and Brown 1996; Pujuguet et al. 2000), which competes for binding to laminin with fibulin-1 or -2 (Yurchenco and O'Rear 1994; Timpl and Brown 1996).

Integrins, one type of receptor for laminins, comprise a family of heterodimeric cell adhesion glycoprotein molecules composed of non-covalently bound α (120–180 kD)- and β (90–110 kD)-subunits, of which there are 16 and at least 22 isoforms, respectively. In addition to mediating cell-matrix and cell-cell interactions, integrins transduce extracellular signals. All known epithelial integrin receptors for laminins comprise isoforms of α₆-, α₃-, β₁-, and β₄-subunits (Belkin and Stepp 2000), α₃ and α₆ being the only subunits with significant (40%) identity (Hogervorst et al. 1991).

The expression and localization of laminins and integrins in the pancreas are poorly documented, despite the potential importance of these molecules in pancreatic development and function. As a baseline for further investigations, we analyzed the expression of laminins and associated molecules, and of integrins, in adult mouse pancreas.

Materials and Methods

Animals and Tissues

Adult (8–12-week) CBA mice bred under specific pathogen-free conditions were sacrificed by cervical dislocation and their pancreases harvested and snap-frozen in liquid nitrogen.

Primary Antibodies

Primary antibodies available for use for indirect immunofluorescence, immunoblotting, and immunoprecipitation are listed in Table 1.

Indirect Immunofluorescence Microscopy

Cryostat sections (8 μm) were air-dried for 40–60 min and fixed in cold (−20C) acetone for 10 min before indirect immunofluorescence staining, or were stored at −80C if not used immediately. Before antibody staining, nonspecific protein binding was blocked by incubation for at least 30 min with warm MT-PBS containing 2% bovine serum albumin or 2% normal rabbit serum. Controls were performed by replacing the first antibody with isotype control antibodies [for monoclonal antibodies (MAbs)] or with pre-immune serum from the appropriate species (for polyclonal antibodies). Tissues were incubated with primary antibodies for 90 min at 25C, followed by three thorough washes with MT-PBS. Fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse or anti-rat immunoglobulins (DAKO; Glostrup, Denmark) were incubated for 30 min at 25C, followed by three thorough washes. Slides were observed and photomicrographed under a Zeis Axiophot fluorescent microscope.

Table 1

Primary antibodies

Antibody to	Clone	Isotype	Sources
Laminin	Polyclonal	Rabbit, Ig	Sigma
Laminin α₁	198	Rat, Ig	Dr L.M. Sorokin
Laminin β₁	LT3	Rat, IgG_1k	Chemicon
Laminin γ₁	A5	Rat, IgG_2a	Chemicon
Laminin α₂	4H8	Rat, Ig	Dr L.M. Sorokin
Laminin γ₂	D4B5	Mouse, IgG₁	Chemicon
Laminin α₅	4G6	Rat, Ig	Dr L.M. Sorokin
Nidogen-1	913, 914	Rabbit, Ig	” “ “
Fibulin-1	1034	Rabbit, Ig	” “ “
Fibulin-2	1028	Rabbit, Ig	” “ “
Integrin α₆	GoH3	Rat, IgG_2a	Chemicon
Integrin α₃	P1B5	Mouse, IgG₁	Gibco BRL
		−	Mouse, IgG₁	Santa Cruz
Integrin β₁	W1B10	Mouse, IgG₁	Sigma
		−	Rabbit, IgG	Santa Cruz
Integrin β₄	3E1	Mouse, IgG₁	Gibco BRL
		−	Goat, IgG	Santa Cruz

Immunoprecipitation and Immunoblotting

To further characterize integrin expression in islet cells, immunoprecipitation and immunoblotting analysis was undertaken. A β-cell line, rat insulinoma RIN A12 cells (Gazdar et al. 1980), reported to express several integrin subunits (Kantengwa et al. 1997), was grown in RPMI + 10% FCS almost to confluence, washed with MT-PBS, and collected by scraping. The cell pellet was resuspended in lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 10 mM Na₂HPO₄ with the protease inhibitors 1 mM PMSF, 1 μg/ml pepstatin A, and 0.15 U/ml aprotinin) and incubated on ice for 15 min. The lysate was centrifuged at 13,000 rpm for 15 min at 4C and the supernatant pre-cleared with protein G-Sepharose beads. The pre-cleared supernatant was mixed with protein G beads that had been pre-bound with anti-α₆ or -α₃ integrin antibodies and rotated at 4C for 2 hr. The beads were washed five times with the lysis buffer, resuspended in reducing SDS sample buffer, and boiled for 3 min. The lysate was electrophoresed in a 10–20% SDS-PAGE gel (Novex; Invitrogen, Carlsbad, CA) and transferred to nitrocellulose membrane. After blocking for 1 hr in 5% milk powder in MT-PBS, the membrane was incubated with anti-β₁ or -β₄ integrin antibodies diluted in 1% milk powder in MT-PBS with 0.05% Tween-20 (PBS-T) for 2 hr at RT, washed five times for 10 min with PBS-T, and then incubated with secondary antibodies diluted in 1% milk powder in PBS-T for 1 hr at RT. After five washes with PBS-T, the immunoblot was developed for 5 min with Lumi-Light Western Blotting Substrate (Roche; Indianapolis, IN) and exposed to Hyperfilm MP (Amersham Pharmacia Biotech; Poole, UK).

RT-PCR Analysis of Laminin RNAs

Total RNA from mouse pancreas or RIN cells was extracted with RNAzol B (Cinna/Biotecx; Houston, TX) and treated with DNase I (Gibco BRL; Gaithersburg, MD). mRNA was reverse-transcribed with Superscript II reverse transcriptase (Gibco BRL) in 1 X transcription buffer containing 0.5 μM oligo (dT)16–18 primer (Gibco BRL) and 400 μM dNTPs. Aliquots of cDNAs were amplified by PCR in 1 X PCR buffer (Roche) containing 200 μM dNTPs, 1 μM of each primer pair, and 1 U Taq polymerase. The primers for laminin α₁ (5’ GACCGCCATGCCGATTTAGC 3', 5’ GACCGCCGTGTTGTTGATGC 3'), laminin α₅ (5’ CCCTGGGGCCTTGAACTTCTCCTACTC 3', 5’ GCATTGCGCCGATCCACCTCAG 3'), laminin β₁ (5’ ACCAGACGGGCCTTGCTTGTGAAT 3', 5’ AGTTGTGGCCCGTGGTGTAGTCCTG 3') and for the control “housekeeping” gene β-actin (5’ GTGGGCCGCCCTAGGCACCA 3', 5’ CTCTTTGATGTCACGCACGATTTC 3') all yielded PCR products of 530 bp. PCR reactions were performed for 35 cycles (95C, 30 sec; 60C, 30 sec; 72C, 30 sec), and amplified products were separated in 1.5% agarose gels.

Figure 1

Distribution of laminin chains in the adult mouse pancreas. Laminin, detected by rabbit anti-mouse laminin IgG and fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit immunoglobulins (Ig), was extensively distributed in the ECM, in arteries, and in veins (A), the BM of the acinar cells (B), and in the islets (C). Laminin β₁-chain, detected by an MAb rat anti-mouse laminin β₁ IgG_1k and FITC-conjugated rabbit anti-rat Ig, had a similar pattern to laminin in arteries (D; higher magnification E) and islets (F). Laminin γ₁-chain, detected by an MAb rat anti-mouse laminin γ₁ IgG_2a and FITC-conjugated rabbit anti-rat Ig, had identical distribution to laminin β₁ (G-H). Laminin γ₂, detected by an MAb mouse anti-human laminin γ₂ IgG₁ and FITC-conjugated rabbit anti-mouse Ig, was expressed in interlobular (I) and intralobular (J) blood vessels. Laminin α₅-chain, detected by MAb rat anti-laminin α₅ antibody and FITC-conjugated rabbit anti-rat Ig, was expressed in the interlobular (K and L) and intralobular (M and N) blood vessels and in intra-islet capillaries (O).

Table 2

Summary: distribution of laminin chains in adult mouse pancreas

		α₁	β₁	γ₁	α₂	α₅	γ₂
Acinar cells	BM	−	++	++	−	+/-	−
Islets	Extracellular	−	−	−	−	−	−
	Capillary BM	−	++	++	−	++	−
Arteries	Endothelial BM	−	++	++	−	++	−
	Smooth muscle ECM	−	++	++	++	++	+
Veins	Endothelial BM	−	++	++	−	+	+
	Smooth muscle ECM	−	++	++	++	+	++
Ducts	Epithelial BM	−	++	++	−	++	−
	Myeloid cell ECM	−	++	++	−	+	++

Results

Laminin Expression

Laminin, detected with polyclonal rabbit anti-laminin antibodies, was expressed in the basement membrane (BM) of several tissues in the pancreas. In the basal lamina of exocrine cells, intra-islet capillary plexuses, duct epithelia, and smooth muscle of arteries and veins (Figures 1A-1C). This antibody, generated to murine Engelbreth-Holm–Swarm tumor BM, identifies α₁-, β₁-, and γ₁-chains (Ferletta and Ekblom 1999) and detects all laminin isoforms, except for laminin-5 (α₃β₃γ₂), reported to be preferentially expressed in BM of squamous and transitional epithelia (Burgeson et al. 1994).

Laminin chains detected with specific monoclonal antibodies (MAbs) had a unique distribution pattern in the pancreas (Table 2). Laminin α₁, specific for laminin-1 (α₁β₁γ₁), was not detected in the adult mouse pancreas, consistent with our RT-PCR analysis (see below) and with previous reports (Falk et al. 1999; Virtanen et al. 2000). The expression patterns of laminins β₁ and γ₁ were the same as those revealed with the rabbit anti-laminin antibody (Figures 1D-1H). Laminin α₂, a component of laminin-2 (α₂β₁γ₁), laminin-4 (α₂β₂γ₁), and laminin-12 (α₂β₁γ₃), and laminin γ₂, which is present in laminin-5, were detected only in the basal lamina of smooth muscle cells in arteries and veins (Figures 1I and 1J). Laminin α₅, a component of laminin-10 (α₅β₁γ₁) and laminin-11 (α₅β₂γ₁), was richly distributed in the BM of endothelia, in the basal lamina of smooth muscle cells in arteries and veins and of myoid cells in interlobular ducts, consistent with other reports (Sorokin et al. 1997; Maatta et al. 2001). It was spirally distributed along arteries, being less orderly in the veins and irregular in ducts (interlobular and intralobular). Laminin α₅ also appeared in the peripheral islet and penetrated into the islets along intra-islet capillaries (Figures 1K-1O). The pattern of nidogen-1 expression (Figures 2A-2D) was the same as that of laminins β₁ and γ₁. The distributions of fibulin-1 and -2 were similar (Figures 2E-2H), resembling that of laminin α5.

Figure 2

Distribution of nidogen and fibulin in adult mouse pancreas. Nidogen, detected by rabbit anti-mouse nidogen Ig and FITC-conjugated goat anti-rabbit Ig, was expressed in interlobular blood vessels (A; higher magnification in B), islets (C; higher magnification in D). Fibulin (E-H), detected by rabbit anti-mouse fibulin Ig and FITC-conjugated goat anti-rabbit Ig, was expressed in various orders of blood vessels.

Figure 3

RT-PCR analysis of laminin chains in adult mouse pancreas. mRNAs were incubated with (+) or without (-) reverse transcriptase and subjected to PCR with specific primers as described in Materials and Methods.

To provide additional evidence that the laminin α₁-chain is not expressed in adult pancreas, RT-PCR analysis of mRNAs was performed. Consistent with the immunofluorescence studies, laminin α₁ transcripts were barely detectable, whereas those for laminin β₁ were readily detected (Figure 3). mRNA for laminin α₅ was detected only in E17.5 pancreas and RIN cells (Figure 3).

Table 3

Summary: distribution of integrins in adult mouse pancreas

	Acinar cells	Islets	Duct epithelium
α₆β₁	+	−	+
α₆β₄	−	−	+
α₃β₁	+	+	+

Integrin Expression

Integrin subunits exhibited a striking cell-specific expression pattern (Table 3). Integrin α₆-subunit was strongly expressed basally in acinar cells, where it interacts with laminin, but was not detected in interlobular arteries or in veins and ducts. It also appeared to be expressed in epithelial cells of various orders of pancreatic ducts from interlobular to intercalated ducts, and in endothelial cells (Figures 4A-4C). However, islet cells clearly did not express this integrin subunit (Figure 4D). Integrin α₃ was expressed weakly in acinar cells but strongly in arteries, veins, and intralobular ducts (Figures 4K and 4L). Integrin β₁ was expressed in various compartments of the pancreas, with strong expression in interlobular duct epithelial cells and endothelial cells (Figures 4E and 4F), and in islet cells (Figure 4G), but with weak expression in acinar cells. β₄ appeared to be expressed in epithelial cells in various orders of the duct system (Figures 4H and 4I), including within islets (Figure 4J) but not in acinar cells.

To provide additional evidence that the absence of the integrin α₆-subunit in mouse islet cells was not species-specific, a rat β-cell line, RIN-A12, was analyzed by immunoprecipitation-blotting. Neither α₆β₁ nor α₆β₄ integrin was detected in the RIN cells (Figure 5), supporting the findings of our immunocytochemical studies. Immunoprecipitation-blotting further demonstrated that the α₃-subunit is probably associated with β₁ to form α₃β₁-integrin in mouse islet cells.

Discussion

This study has characterized the expression pattern of laminins and their integrin receptors in the adult pancreas. Laminin isoform expression varied with tissue compartments in the pancreas but was not detected extracellularly in islets. Integrin receptor subunit expression had a cell-specific pattern. Laminin-1 was undetectable in the adult pancreas. We previously showed that laminin α₁, unique for laminin-1, is expressed in the BM of developing pancreatic duct epithelium between E13.5 and E17.5 (Jiang et al. 1999). However, laminin α₁ was not detected in any compartment of the adult pancreas, consistent with our RT-PCR analysis and a recent report (Virtanen et al. 2000). These data support the current view that laminin α₁ is expressed in the epithelial BM during early development but not in the adult (Miner et al. 1997; Virtanen et al. 2000), and imply that laminin-1 may be involved in the proliferation (through α₆ integrins) and differentiation (via α-dystroglycan) of the pancreatic precursor cells (Jiang et al. 2001). Strong staining of laminin β₁- and γ₁-chains and weak staining of laminin α₅-chain indicated the existence of laminin-10 (α₅β₁γ₁) in the BM of acinar cells, consistent with the notion that laminin-10 is an adult isoform of epithelial laminin (Ferletta and Ekblom 1999). Laminin α₂, α₅, β₁, γ₁ and γ₂ were detected in blood vessels, especially arteries, indicating that laminin-2 (α₂β₁γ₁), -8 (α₄β₁γ₁), and -10 are expressed in the BM of these tissues. The functional significance of these laminin isoforms expressed in the blood vessels remains to be determined.

Figure 4

Distribution of integrin subunits in the adult mouse pancreas. Integrin α₆-subunit, detected by rat anti-mouse integrin α₆ MAb IgG_2a and FITC-conjugated rabbit anti-rat Ig, was expressed in acinar cells and intercalated (A), intralobular (B), and interlobular duct epithelial cells (C), but not in islet cells (D). Integrin β₁ (F,G), β₄ (H-J), and α₃ (K,L) subunits were detected by monoclonal mouse anti-chicken integrin IgG₁ (for β₁), mouse anti-human integrin IgG₁ (for β₄ and α₃), and FITC-conjugated rabbit anti-mouse Ig. The integrin β1-subunit was detected in the interlobular (E) and intralobular duct epithelium and weakly in the acinar cells (F) and with various densities in islet cells (G). The integrin β₄-subunit was detected in the epithelial cells of intralobular (H) and intercalated ducts (I) and in islets (J). The integrin α₃ subunit was expressed in the endothelium and smooth muscle cells of the blood vessels (K), in intralobular duct cells and weakly in acinar cells (L).

Our results show that major ECM proteins are absent extracellularly between islet cells, as are nidogen-1 and fibulin-1 and -2. Similarly, a range of collagen isoforms—fibronectin, vitronectin, and elastin—were not detected between islet cells (van Deijnen et al. 1992; Meyer et al. 1997).

These studies provide molecular evidence to support a previous electron microscopic study (Like et al. 1978) that a BM structure is not found around islet cells. This feature may be related to the diffusion of secreted hormones into intra-islet capillary networks. Lack of ECM proteins between islet cells indicates that the function of islet cells in vivo is regulated mainly by soluble factors and cell-cell interactions mediated, for example, by integrins (see below). However, in an artificial environment, the function of dispersed islet cells can be partially maintained by attachment to ECM in vitro. Thus, insulin secretion can be boosted by attachment to laminin-5 secreted by a rat carcinoma cell line (G804) (Baker et al. 1996; Bosco et al. 2000). Similarly, proinsulin, insulin content, and stimulated insulin release in cultured rat islets can be partially preserved by attachment to collagen II and fibronectin (Wang et al. 1999).

Figure 5

Expression of integrin subunits in RIN A12 β-cells. Pancreas cell lysate (A) served as a control for antibodies and experimental procedures. RIN cell lysates (B,C) were precipitated with rat monoclonal anti-mouse α₆ integrin antibody (B) and mouse monoclonal anti-human α₃ integrin antibody (C) blotted with rabbit anti-β₁ and goat anti-β₄ integrin antibodies, detected by peroxidase-conjugated sheep anti-rabbit and donkey anti-goat Ig.

Only a limited amount of information on the expression pattern of integrin subunits in the adult pancreas has hitherto been available. We found that the integrin α₆-subunit was undetectable in adult mouse islet cells by indirect immunofluorescence and immunoprecipitation, consistent with previous immunochemical studies in several species, including humans (Terpe et al. 1994; Kantengwa et al. 1997; Wang et al. 1999). This suggests that α₆ integrin signaling is not required for adult β-cell function. Because α₆ integrins transduce a moderate proliferation signal in the developing pancreas (Jiang et al. 2001), absence of α6 integrin expression in the adult islet cells may, at least partially, be attributed to the low proliferative potential of these cells. However, our observation contrasts with a report (Bosco et al. 2000) that the α₆-subunit is presen on primary rat β-cells. This discrepancy may be partially due to differences in experimental techniques and antibody used.

What is the dimerization partner for the integrin β₁ subunit on islet cells? There are six known members of the β₁ integrin subfamily: α₁β₁, α₂β₁, α₃β₁, α₆β₁, α₇β₁, and α₉β₁. Our study has demonstrated that the α₆β₁ integrin is absent on mouse islet cells. However, we observed that the α₃-subunit was weakly detected on islet cells, suggesting the existence of α₃β₁ integrin. This was supported by our immunoprecipitation—blotting experiments on RIN cells and by the findings of others on primary and transformed rat islet cells (Kantengwa et al. 1997; Wang et al. 1999). α₃β₁ integrin may also be at least partially responsible for binding to laminin-5 secreted by 804G cells, a rat carcinoma cell line, and for increasing proliferation of human fetal islet cells (Beattie et al. 1996). In addition, the function of α₃β₁ integrin may partially overlap with α₆ integrins because the islet cell lineage develops normally in homozygous α₆ gene knockout (α₆ ^−/-) mice (Jiang et al. 2001), but not in double α₆ ^−/-/α₃ ^−/- mice (De Arcangelis et al. 1999).

Integrin β₄-subunit expression is primarily restricted to cells of ectoderm- and endoderm-derived tissues, such as skin and intestine (Belkin and Stepp 2000). This subunit is unique among integrins in that it has a very large cytoplasmic domain (∼1000 amino acid residues compared to less than 50 residues in other integrin β-subunits). The expression of α₆β₄ in epithelial cells of various orders of pancreatic ducts may be associated with hemidesmosome formation along the basement membrane (Dowling et al. 1996; van der Neut et al. 1996).

In conclusion, laminin and its integrin receptors exhibit a selective pattern of expression in the adult pancreas. Understanding the functions of these molecules may facilitate the engineering of specific pancreatic cells such as insulin-producing β-cells.

Footnotes

Acknowledgements

Supported by a Juvenile Diabetes Research Foundation Fellowship and a Diabetes Australia Research Grant (2001) (F-XJ) and by the National Health and Medical Research Council of Australia (LCH).

We thank Dr L.M. Sorokin (Institute of Experimental Medicine, University of Erlangen-Nurnburg, Germany), who kindly provided rat monoclonal anti-mouse laminin α₁ (clone 198), α₂ (clone 4H8), and α₅ (clone 4G6) antibodies and rabbit anti-nidogen-1 (#913 and 914), fibulin-1 (#1034), and fibulin-2 (#1028) antibodies. We also thank Catherine O'Shea for secretarial assistance.

References

Baker

DiPasquale

Stock

Quaranta

Fitchmun

Jones

(1996) Morphogenetic effects of soluble laminin-5 on cultured epithelial cells and tissue explants. Exp Cell Res 228:262–270

Beattie

Rubin

Mally

Otonkoski

Hayek

(1996) Regulation of proliferation and differentiation of human fetal pancreatic islet cells by extracellular matrix, hepatocyte growth factor, and cell-cell contact. Diabetes 45:1223–1228

Belkin

Stepp

(2000) Integrins as receptors for laminins. Microsc Res Tech 51:280–301

Bosco

Meda

Halban

Rouiller

(2000) Importance of cell-matrix interactions in rat islet beta-cell secretion in vitro: role of alpha6beta1 integrin. Diabetes 49:233–243

Burgeson

Chiquet

Deutzmann

Ekblom

Engel

Kleinman

Martin

. (1994) A new nomenclature for the laminins. Matrix Biol 14:209–211

Colognato

Yurchenco

(2000) Form and function: the laminin family of heterotrimers. Dev Dyn 218:213–234

De Arcangelis

Mark

Kreidberg

Sorokin

Georges-Labouesse

(1999) Synergistic activities of alpha3 and alpha6 integrins are required during apical ectodermal ridge formation and organogenesis in the mouse. Development 126:3957–3968

Dowling

Fuchs

(1996) Beta4 integrin is required for hemidesmosome formation, cell adhesion and cell survival. J Cell Biol 134:559–572

Erickson

Couchman

(2000) Still more complexity in mammalian basement membranes. J Histochem Cytochem 48:1291–1306

10.

Falk

Ferletta

Forsberg

Ekblom

(1999) Restricted distribution of laminin alpha1 chain in normal adult mouse tissues [in process citation]. Matrix Biol 18:557–568

11.

Ferletta

Ekblom

(1999) Identification of laminin-10/11 as a strong cell adhesive complex for a normal and a malignant human epithelial cell line. J Cell Sci 112:1–10

12.

Gazdar

Chick

Oie

Sims

King

Weir

Lauris

(1980) Continuous, clonal, insulin- and somatostatin-secreting cell lines established from a transplantable rat islet cell tumor. Proc Natl Acad Sci USA 77:3519–3523

13.

Hogervorst

Kuikman

van Kessel

Sonnenberg

(1991) Molecular cloning of the human alpha 6 integrin subunit. Alternative splicing of alpha 6 mRNA and chromosomal localization of the alpha 6 and beta 4 genes. Eur J Biochem 199:425–433

14.

Jiang

Cram

DeAizpurua

Harrison

(1999) Laminin-1 promotes differentiation of fetal mouse pancreatic beta-cells. Diabetes 48:722–730

15.

Jiang

Georges-Labouesse

Harrison

(2001) Regulation of laminin 1-induced pancreatic beta-cell differentiation by alpha6 integrin and alpha-dystroglycan. Mol Med 7:107–114

16.

Kantengwa

Baetens

Sadoul

Buck

Halban

Rouiller

(1997) Identification and characterization of alpha 3 beta 1 integrin on primary and transformed rat islet cells. Exp Cell Res 237:394–402

17.

Lelievre

Weaver

Bissell

(1996) Extracellular matrix signaling from the cellular membrane skeleton to the nuclear skeleton: a model of gene regulation. Re Prog Horm Res 51:417–432

18.

Appel

Williams

Rossini

(1978) Streptozotocin-induced pancreatic insulitis in mice. Morphologic and physiologic studies. Lab Invest 38:470–486

19.

Maatta

Virtanen

Burgeson

Autio-Harmainen

(2001) Comparative analysis of the distribution of laminin chains in the basement membranes in some malignant epithelial tumors: the alpha1 chain of laminin shows a selected expression pattern in human carcinomas. J Histochem Cytochem 49:711–726

20.

Meyer

Czub

Chodnewska

Beutner

Hamelmann

Klock

Zimmermann

. (1997) Expression pattern of extracellular matrix proteins in the pancreas of various domestic pig breeds, the Goettingen Minipig and the wild boar. Ann Transplant 2:17–26

21.

Miner

Patton

Lentz

Gilbert

Snider

Jenkins

Copeland

. (1997) The laminin alpha chains: expression, developmental transitions, and chromosomal locations of alpha1-5, identification of heterotrimeric laminins 8–11, and cloning of a novel alpha3 isoform. J Cell Biol 137:685–701

22.

Pujuguet

Simian

Liaw

Timpl

Werb

Bissell

(2000) Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression. J Cell Sci 113:849–858

23.

Sorokin

Pausch

Durbeej

Ekblom

(1997) Differential expression of five laminin alpha (1–5) chains in developing and adult mouse kidney. Dev Dyn 210:446–462

24.

Terpe

Stark

Ruiz

Imhof

(1994) Alpha 6 integrin distribution in human embryonic and adult tissues. Histochemistry 101:41–49

25.

Timpl

Brown

(1996) Supramolecular assembly of basement membranes. Bioessays 18:123–132

26.

Tunggal

Smyth

Paulsson

Ott

(2000) Laminins: structure and genetic regulation. Microsc Res Tech 51:214–227

27.

van Deijnen

Hulstaert

Wolters

van Schilfgaarde

(1992) Significance of the peri-insular extracellular matrix for islet isolation from the pancreas of rat, dog, pig, and man. Cell Tissue Res 267:139–146

28.

van der Neut

Krimpenfort

Calafat

Niessen

Sonnenberg

(1996) Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nature Genet 13:366–369

29.

Virtanen

Gullberg

Rissanen

Kivilaakso

Kiviluoto

Laitinen

Lehto

Ekblom

(2000) Laminin alpha1-chain shows a restricted distribution in epithelial basement membranes of fetal and adult human tissues. Exp Cell Res 257:298–309

30.

Wang

Paraskevas

Rosenberg

(1999) Characterization of integrin expression in islets isolated from hamster, canine, porcine, and human pancreas. J Histochem Cytochem 47:499–506

31.

Yurchenco

O'Rear

(1994) Basal lamina assembly. Curr Opin Cell Biol 6:674–681

Distinct Distribution of Laminin and Its Integrin Receptors in the Pancreas

Abstract

Keywords

Materials and Methods

Animals and Tissues

Primary Antibodies

Indirect Immunofluorescence Microscopy

Immunoprecipitation and Immunoblotting

RT-PCR Analysis of Laminin RNAs

Results

Laminin Expression

Integrin Expression

Discussion

Footnotes

Acknowledgements

References