Sage Journals: Discover world-class research

Abstract

The parasympathetic nervous system is probably involved in migraine pathogenesis. Its activation releases a mixture of signalling molecules including vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP), which subsequently stimulate VPAC₁, VPAC₂ and PAC₁ receptors. The objective of the present study was to investigate the in vivo effect of VIP, PACAP-27, PACAP-38, the selective VPAC₁ agonist ([Lys15, Arg16, Leu27]-VIP(1–7)-GRF(8–27)) and a PAC₁ agonist, maxadilan on rat middle meningeal artery (MMA) diameter using the closed cranial window model. Selective antagonists were used for further characterization of the responses. Reverse transcriptase-polymerase chain reaction experiments were also conducted to determine expression of mRNA of PACAP receptors in the MMA. The results showed that VIP, PACAP-38, PACAP-27 and the VPAC₁ specific agonist evoked significant dilations with the rank order of potency; VIP = PACAP-38 > PACAP-27 = [Lys15, Arg16, Leu27]-VIP(1–7)-GRF(8–27). Significant inhibition of dilation was only observed for the VPAC₁ antagonist PG97–269 on PACAP-38-induced dilation of MMA. The VPAC₂ antagonist PG99–465 and PAC₁ antagonist PACAP(6–38) did not significantly block VIP- or PACAP-induced dilation. Expression of mRNA of all three receptors was detected in the MMA. In conclusion, the VPAC₁ receptor seems to be predominant in mediating MMA dilation. A selective VPAC₁ antagonist may be a candidate molecule in the treatment of migraine headache.

Keywords

Migraine VIP PACAP receptors

Introduction

Migraine attacks are associated with facial flushing and vomiting together with vasodilation of intracranial arteries. Due to these and other facts, the parasympathetic nervous system has been suggested to be involved in migraine pathophysiology (1, 2). Moreover, release of vasoactive peptides from the parasympathetic nervous system may activate or sensitize intracranial sensory nerve fibres, leading to the perception of pain (3). Trigeminal nerve stimulation activates the parasympathetic nervous system with subsequent release of vasoactive peptides such as vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) (3–5). PACAP belongs to the secretin/glucagons/VIP superfamily containing nine peptides in all so far (6) and exerts numerous effects, including dilation of cranial blood vessels (7, 8). Vasodilation of cranial arteries such as the middle meningeal artery (MMA) as well as the middle cerebral artery (MCA) activates trigeminovascular nociceptive pathways (9). PACAP occurs in two biologically active forms (7, 10): PACAP-27 and PACAP-38. Both peptides are derived from the same precursor, with PACAP-38 being predominant in rat brain tissue (7, 11). Although PACAP-27 and the first 27 amino acids in PACAP-38 show homology with VIP (12), PACAP is more potent than VIP in stimulating adenylate cyclase in pituitary cells (13).

VIP and PACAP exert their effects through three G-protein coupled receptors, VPAC₁, VPAC₂ and PAC₁, by activating adenylate cyclase. The VPAC₁ and VPAC₂ receptors show similar affinity for VIP and PACAP (7, 14), whereas the PAC₁ receptor has higher affinity for PACAP-27 and PACAP-38 than VIP, as shown in Table 1.

Table 1

pKi and pIC₅₀ values for all agonists and antagonists for the three receptors

	VPAC₁	VPAC₂	PAC₁
VIP	9.7 (46)	8.7 (47)	5.8 (48)
PACAP-27	8.9 (46)	8.0∗ (48)	8.8 (49)
PACAP-38	8.2 (46)	NA	8.8 (48)
VPAC₁ agonist	9.1 (50)	4.5 (50)	NA
Maxadilan	NA	NA	8.9 (21)
PACAP(6-38)	NA	NA	8.1-7-4∗ (48)
PG97-269	8.7 (51)	6.4 (51)	4.5 (51)
PG99-465	6.7∗ (52)	8.7∗ (52)	NA

^∗Indicates the pIC₅₀ values.

Numbers in parentheses indicate the corresponding reference number.

NA, not available.

In human studies, infusion of VIP and, even more, PACAP-38 elicits headache in healthy volunteers (15, 16). In vivo studies investigating the pharmacology of VIP and PACAP with respect to their effect on cranial arteries are limited. To address this limitation and based on the headache-inducing potential of these endogenous peptides, the aim of the present study was to: (i) investigate the potential of VIP, PACAP-38, PACAP-27 and additional peptides to increase the rat MMA diameter, using the in vivo closed cranial window model (17); (ii) characterize the receptors with selective agonists and antagonists; and (iii) study messenger RNA expression (mRNA) for VPAC₁, VPAC₂ and PAC₁ receptors in the rat MMA.

Methods

In vivo preparations

All experiments were performed in accordance with the guidelines and regulations of the Danish Animal Experimentation Inspectorate (file 2004/561–850) on the care and use of laboratory animals. Male Sprague-Dawley rats (n = 73) weighing 350–400 g were used. The details regarding the surgical preparation and intravital microscopy have been described previously (18). Briefly, the animals were anaesthetized with pentobarbital (Mebumal^® 50 mg/kg intraperitoneally), which was continuously given intravenously (20 mg/mg/h) throughout the experiment, via an infusion pump. Following intubation, the rat was cannulated in both the left and right femoral vein and artery to be used for infusion of anaesthetic, test substances, measurement of mean arterial blood pressure and sampling of arterial blood for gas tension analyses. The right parietal bone was then thinned, making a window through which the MMA was visualized via a video camera and TV monitor. A video dimension analyser (V94; Living Systems Instrumentation, Burlington, VT, USA) was connected to the camera, which continuously measured the diameter of the MMA by a scan line. Thereby, changes in dimensions arising from vessel constriction or dilation were automatically followed by rapid time resolution and displayed on a digital panel. Simultaneously, changes in mean arterial blood pressure were registered by connecting the catheter to a transducer (Transducer TCM4-7; World Precision Instruments, Sarasota, FL, USA).

Experimental protocols

In the present study operator blinding was not performed due to the experimental set-up. Furthermore, each animal was used as its own control, thus avoiding inter-animal variation. To study a dose-dependent response of VIP, PACAP-38, PACAP-27, maxadilan and VPAC₁ agonist, doses of 1, 3 and 10 μg/kg were administered. Responses to the agonists were characterized using antagonist drugs at VPAC₁ (PG97-269) (19), VPAC₂ (PG99-465) (19) and PAC₁ receptors [PACAP(6-38)] (20). For these interaction experiments, the 3 μg/kg dose of the agonists and the 10 μg/kg dose of the antagonists were chosen; these doses are consistent with the high affinity of the drugs at their receptors (Table 1). Since PACAP(6-38) displayed intrinsic efficacy, a dose–response experiment with the doses of 10, 20 and 50 μg/kg of this drug was performed. Thus, for these experiments the protocol was as follows: infusion of 3 μg/kg of the agonist followed 20 min later by 10 μg/kg of the antagonist. After 2 min the agonist (3 μg/kg) was infused again. When values had returned to baseline, 0.5 μg/kg of the potent vasodilator calcitonin gene-related peptide (CGRP) (21) was infused as an internal standard to check the responsiveness of the artery. All drugs were administered intravenously over 1 min followed by a flush of 150 μl isotonic saline in the same catheter. Changes in MMA diameter and in mean arterial blood pressure were measured 1 min prior to (baseline) and 1–2 min after the administration of the agonists and antagonists. In all studies arterial blood samples were analysed prior to, during and at the end of the experiment. The partial pressures of oxygen (P_aO₂), carbon dioxide (P_aCO₂) and pH (NPT 7; Radiometer, Br⊘nsh⊘j, Denmark) were kept within physiological limits (pH 7.3–7.4, P_aCO₂ 35.2–42.7 mmHg and P_aO₂ 81.7–127.5 mmHg).

Data presentation and statistical analysis

Changes in MMA diameter and in mean arterial blood pressure were measured and calculated as percentage change from baseline. Mean arterial blood pressure is given in mmHg. All data are expressed as mean ±s.e.m. of the percentage change from baseline values with n indicating the number of rats used for the analysis. To the agonist dose–response experiments a one-way ANOVA was applied followed by a Kruskal–Wallis post hoc test, determining whether the response was significantly different from baseline values. The non-parametric Wilcoxon matched pairs test was used in the interaction experiments to test for significant differences between agonist response prior and post antagonist administration. For all statistical tests P < 0.05 was considered statistically significant indicated by an asterisk (∗). GraphPrism^® (GraphPad Software Inc., La Jolla, CA, USA) was used for the statistical analysis.

Test substances

Rat VIP, PACAP-38, PACAP-27 and PACAP(6-38) were obtained from NeoMPS (Strasbourg, France), together with rat α-CGRP. The selective VPAC₁ agonist ([Lys¹⁵,Arg¹⁶,Leu²⁷]-VIP(1-7)-GRF(8-27)) and the VPAC₁ antagonist (PG97-269) (19) were obtained from Phoenix Europe GmbH (Karlsruhe, Germany). The VPAC₂ antagonist (PG99-465) (19) was a kind gift from Dr Patric Robberecht, (Universite Libre de Bruxelles, Belgium). Maxadilan, a PAC₁ agonist (22), was given by Dr Ethan Lerner (Massachusetts General Hospital, Charlestown, MA, USA). All test substances were dissolved in isotonic saline (0.9% NaCl) and stored at −20 °C. Prior to use the samples were diluted in isotonic saline to the desired concentration. Heparinized saline (10 IU/ml) was used in the arterial catheters to prevent coagulation of the blood.

mRNA expression studies

Three male Sprague-Dawley rats (320–350 g) were anaesthetized with pentobarbital and perfused transcardially with a 300 ml ice-cold buffer solution composed of (mM): NaCl 119, NaHCO₃ 15, KCl 4.6, CaCl₂ 1.5, NaH₂PO₄ 1.2, MgCl₂ 1.2 and glucose 5.5. The brain was removed and the MMA carefully dissected out of the dura mater and submerged in a RNA stabilization solution (RNAlater™; Ambion, Austin, TX, USA). For each mRNA expression study, tissue known to express target mRNA was dissected out in parallel, serving as a control for the target-specific primers and the experimental set-up. Total RNA was purified from the tissues using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Yield and purity of the purified RNA were determined spectrophotometrically. Complementary DNA (cDNA) was synthesized from 500 ng purified RNA in a final reverse transcriptase-polymerase chain reaction (RT-PCR) volume of 20 μl, using the Quantiscript Reverse Transcription Procedure (Qiagen). A negative control (no RT added to the RT-PCR mixture) was included for each mRNA study, serving as a control for genomic contamination in cDNA preparations. One microlitre of the cDNA and non-cDNA preparations was mixed with 0.5 μM of the target-specific primer pair, water, RedTaq ReadyMix™ PCR reaction Mix and MgCl₂ (Sigma, St Louis, MO, USA). The PCR program used for amplification was as follows; pre-denaturation at 94 °C for 2 min, 40 amplification cycles of template denaturation for 1 min at 94 °C, primer annealing for 45 s at 58 °C and extension for 2 min at 72 °C. The PCR products were loaded on an agarose gel containing ethidium bromide and the PCR products were separated by electrophoresis along with a PCR 100 base pair Low Ladder (Sigma). The gel was photographed and the products were cut out of the gel, purified using the QIAquick Gel Extraction Kit (Qiagen) and sequenced at MWG Biotech (Ebersberg, Germany). Each set of target-specific primers (Table 2) used for the amplification and detection of mRNA was designed from National Center for Biotechnology Information GenBank extracted sequences with the aid of primer design software.

Table 2

Primers used in the reverse transcriptase-polymerase chain reaction analysis that was designed to cross exon/intron boundaries and/or to anneal to sequences in two different exons

Gene	Species	NCBI gene bank accession number	Primer sequence	Primer sequence	Amplified sequence	Expected size (bp)
Gene	Species	NCBI gene bank accession number	Forward primer (5′-3′)	Reverse primer (5′-3′)	Amplified sequence	Expected size (bp)
VPAC1	Rat	NM_012685	CATCCTCCTCTCCATCCTGGTGAA	TGGATACCTGCGTGCTGCATGT	995-1401	407
VPAC2	Rat	NM_017238	CCTGGTGGTCGCAGTTCTATATTGC	AATCGAGTTAAGGACCAGGGCTGAC	1216-1548	333
PAC1	Rat	NM_133511	ACCTGTCGGTGAAGGCTCTCTACA	CACCACAGAGCTGTGCTGTCATTC	783-1254	472

Results

Agonist dose–response experiments

Administration of 1, 3 and 10 μg/kg of VIP evoked dose-dependent dilation of the MMA with a maximum dilation of 62 ± 9% elicited by 3 μg/kg (Fig. 1A). The same doses of PACAP-38, PACAP-27 and the selective VPAC₁ agonist were used. This resulted in significant dilations of the artery; for PACAP-38 the values were 22 ± 5, 44 ± 5 and 45 ± 13%, respectively, for each dose and for PACAP-27 13 ± 1, 28 ± 6 and 60 ± 9%, respectively (Fig. 1B,C). The selective VPAC₁ agonist caused a dose-dependent dilation (9 ± 3, 33 ± 9 and 63 ± 13%, respectively, for each dose) (Fig. 1D). Finally, identical doses of the PAC₁ agonist maxadilan failed to induce significant changes of artery diameter (data not shown). Thus, the apparent rank order of agonist potency was VIP = PACAP-38 > PACAP-27 = VPAC₁ agonist >>> maxadilan. In all cases, CGRP produced significant dilator responses that were, in general, larger in magnitude than those evoked by the agonists (Fig. 1). The agonists also produced concomitant decreases in mean arterial blood pressure with a similar rank order of potency: PACAP-38 > VIP > PACAP-27 = VPAC₁ agonist >>> maxadilan (Table 3).

Table 3

Percent decrease in mean arterial blood pressure in agonist dose–response experiments

	1 μg/kg	3 μg/kg	10 μg/kg
VIP	−18 ± 4	−42 ± 4∗	−45 ± 5∗
PACAP-38	−25 ± 9∗	−26 ± 4∗	−28 ± 5∗
PACAP-27	−4 ± 2	−30 ± 4∗	−42 ± 4∗
VPAC₁ agonist	−5 ± 3	−26 ± 6∗	−41 ± 3∗
Maxadilan	−11 ± 9	−9 ± 3	−22 ± 8

	10 μg/kg	20 μg/kg	50 μg/kg
PACAP(6-38)	−13 ± 5	−17 ± 5	−32 ± 8∗

All values are given as percentage means ±s.e.m. with n = 4 − 9 observations. For statistical analysis a one-way ANOVA Kruskal–Wallis test was used to determine whether each dose was significantly different from baseline values, indicated by ^∗(P < 0.05).

Figure 1

Agonist dose–response experiments illustrating the effect of (A) VIP, (B) PACAP-38, (C) PACAP-27 and (D) VPAC₁ agonist [Lys¹⁵,Arg¹⁶,Leu²⁷]-VIP(1-7)-GRF(8-27) on the MMA diameter. Data are expressed as the mean ±s.e.m. of 4–10 observations. A one-way ANOVA was applied followed by a Kruskal–Wallis post hoc test, determining whether the responses were significantly different from baseline values (P < 0.05), indicated by an asterisk (∗). MMA, middle meningeal artery.

Interaction experiments

PACAP-38 and PACAP-27 show similar affinity profiles compared with VIP towards the three receptors. Only PACAP-38, due to its predominant form of the two PACAPs in rat brain tissue (7) and VIP, was included in the interaction experiments. Infusion of the VPAC₁ antagonist PG97-269 (10 μg/kg) alone had no effect on the investigated parameters. A dilatory effect of 21 ± 2% was observed after the first VIP infusion. The second VIP infusion was preceded by the antagonist, which failed to block the response elicited by VIP (27 ± 10%) (Fig. 2A); the antagonist also failed to block VIP-induced hypotensive effects (Table 4). Thus, the experiment was repeated with a higher dose of PG97-269 (20 μg/kg) against VIP, which also failed to block VIP-induced responses (not shown). PACAP-38 induced a dilation of 53 ± 17%, which was significantly reduced to 26 ± 12% in the presence of 10 μg/kg PG97-269 (P < 0.05, Fig. 2B). The decrease in mean arterial blood pressure induced by PACAP-38 was concomitantly reduced from 32 ± 5 to 15 ± 6%; however, the attenuation was not significant (P = 0.06) (Table 4).

Table 4

Percent decrease in mean arterial blood pressure in interaction experiments

Agonist vs. antagonist (μg/kg)	Pre-antagonist	Antagonist	Post-antagonist	P-value paired t-test	n
VIP (3) vs. VPAC₁ antagonist (10)	−40 ± 9	−6 ± 5	−45 ± 6	0.75	5
PACAP-38 (3) vs. VPAC₁ antagonist (10)	−32 ± 5	−6 ± 5	−15 ± 6	0.06	6
VIP (3) vs. PACAP(6-38) (10)	−36 ± 6	1 ± 1	−31 ± 9	0.31	5
PACAP-38 (3) vs. PACAP(6-38) (10)	−35 ± 8	−21 ± 8	−31 ± 8	0.69	4
VIP (3) vs. VPAC₂ antagonist (10)	−29 ± 6	0 ± 0	−33 ± 5	0.38	7

All values are given as percentage means ±s.e.m. with n = 4−7 observations. For statistical analysis a non-parametric Wilcoxon matched pairs test was used to test for statistical significance between pre- and post-antagonist administration. Numbers in parentheses indicate corresponding dose (μg/kg) used.

Figure 2

Interaction experiments illustrating the effect of the VPAC₁ antagonist PG97-269 against (A) VIP and (B) PACAP-38. (C,D) The effect of the PAC₁ antagonist PACAP(6-38) against VIP- and PACAP-38-induced responses, respectively. (E) The effect of the VPAC₂ antagonist, PG99-465, on responses to VIP. Each bar is expressed as the mean ±s.e.m. of four to seven observations. A non-parametric Wilcoxon matched pair test was applied to test for significant difference (P < 0.05), indicated by an asterisk (∗), between the response of the agonist infusion prior and post antagonist infusion. MMA, middle meningeal artery.

Infusion of the VPAC₂ antagonist PG99-465 per se had no effect on any of the investigated parameters. PG99-465 (10 μg/kg) did not inhibit VIP-induced dilation (43 ± 14% compared with 50 ± 13% without antagonist) (Fig. 2E) or mean arterial blood pressure (Table 4). VIP infusion after PACAP(6-38) (10 μg/kg) resulted in a dilation of 45 ± 16% compared with 41 ± 15% when infusing VIP alone (Fig. 2C). Infusion of PACAP-38 caused a MMA dilation of 53 ± 13%, whereas a second PACAP-38 infusion in the presence of PACAP(6-38) (10 μg/kg) resulted in a non-significant reduction of the dilation to 33 ± 13% (Fig. 2D) as well in mean arterial blood pressure (Table 4). Due to the fact that neither 10 nor 20 μg/kg (data not shown) of PACAP(6-38) inhibited VIP or PACAP-38, but actually showed partial agonistic properties, we chose to perform a dose–response experiment with PACAP(6-38). As 10 and 20 μg/kg had been given in the interaction experiments, a higher dose of 50 μg/kg PACAP(6-38) was administered. All three doses resulted in MMA dilation [28 ± 10, 34 ± 10 and 95 ± 19%∗, respectively, for each dose (∗P < 0.05)]; the corresponding reduction in mean arterial blood pressure is given in Table 3.

mRNA expression studies

mRNA expression of the VPAC₁, VPAC₂ and PAC₁ receptors in rat MMA was analysed by RT-PCR. PCR products of the expected size from both the positive control fractions and rat MMA fractions were sequenced. Alignment of all sequences (250–450 base read lengths) to the target Genbank mRNA sequences resulted in 99–100% identity, verifying the target specificity of the primers. mRNA expression was shown for all three receptors (Fig. 3) in the rat MMA.

Figure 3

The expression of (A) PAC₁ (472 bp), (B) VPAC₁ (407 bp) and (C) VPAC₂ (333 bp) receptors in rat middle meningeal artery (MMA) demonstrated by reverse transcriptase-polymerase chain reaction (RT-PCR) in lane 3. The following rat tissue cDNA (lane 1) served as positive controls for the designed target-specific primers: (A) PAC₁: cerebellum, (B) VPAC₁: lung and (C) VPAC₂: olfactory bulb. PCR products were not observed in lane 4, where no RT was added to the RT-PCR mixture, both serving as a control for genomic contamination in the cDNA preparation and verifying that target-specific mRNA was detected in MMA samples. The lower additional bands observed in (A) PAC₁ and (B) VPAC₁ were also sequenced and found not to be splice variants of the receptors, but non-specific products.

Discussion

This is the first in vivo study to investigate the effect of selective agonists and antagonists for the VPAC₁, VPAC₂ and PAC₁ receptors in rat MMA. In addition, the presence of mRNA encoding for all three receptors in MMA was shown using RT-PCR.

Although all physiological values were within their limits, approximately 10% of rats did not respond to the treatment. To avoid drawing the conclusion that non-responding was due to a lack of response to the drug, we used the potent vasodilator CGRP as an internal standard. CGRP responses also provided yardsticks to check variability in amplitude of responses induced by the peptides. Thus, the amount of dilation to VIP/PACAP and their agonists must be compared with CGRP responses. For example, comparing the VIP-induced responses of the dural artery in the dose–response study (Fig. 1A) with the VIP-induced response in the VPAC₁ antagonist experiment (Fig. 2A), an approximately threefold variation was observed. However, this variation is similar to that of the CGRP-induced response in the same experiments and can thus be ascribed to variability among the rats.

VIP and PACAP are present in the parasympathetic nerve fibres surrounding human temporal (23, 24) and middle cerebral arteries (25). In the initial experiments PACAP-27 and PACAP-38 induced dose-dependent dilation of the MMA with no significant difference in their maximal effects. A similar concentration-dependent relaxation has also been shown in isolated rat intracerebral arterioles (26). Both PACAPs produced dose-dependent dilation of piglet pial arteriolar diameter when given topically (29 and 36%, respectively) (27). Femoral arterial blood flow in dogs was three to four times higher after PACAP-38 than after VIP or PACAP-27 (28). Thus, the activity of the two peptides varies between species and is tissue dependent. In line with a previous study on haemodynamic effects evoked by intravenous PACAP-27 in rats (29), we observed a dose-dependent decrease in mean arterial blood pressure during infusion of VIP, PACAP-27, PACAP-38 and the selective VPAC₁ agonist. Hypotension caused by the agonists may be partially or wholly responsible (via autoregulation) for the observed dilation of the pial artery, but not of the MMA (30, 31). The dilatory effect of PACAPs and VIP in the MMA in the present study was therefore a direct pharmacological effect. Since VIP and PACAPs produced dilation in the MMA (Fig. 1A–C) as well as hypotensive responses (Table 3) with a similar rank order of potency (see Results), and they all display high affinity at VPAC₁ receptors (Table 1), it is likely that both responses involve activation of VPAC₁ receptors. This is supported by the ability of the selective VPAC₁ agonist to elicit similar meningeal dilator (Fig. 1D) and hypotensive responses (Table 3).

Systemic administration of 10 pmol/kg/min (approximately 0.045 μg/kg/min) of PACAP-38 for 20 min in healthy human subjects was given, resulting in a total dose of 200 pmol/kg (approximately 0.9 μg/kg) (15). Remarkably, the peptide administration resulted in headache associated with parasympathetic features such as sustained skin flushing and an increase in middle cerebral artery diameter in 11 out of 12 subjects (15). The dose of PACAP-38 used in the present study was approximately three times higher than that used in the human study. The need for a higher dose in rat compared with man can be explained by the half-life of PACAP-38, which is 0.82 min in rats (32) compared with 3.5 min in man (15). The dilatory effect of VIP in MMA has been shown also in human MMA (33). In the present study, VIP dilated the artery with a peak at 3 μg/kg. In healthy human volunteers, VIP (8 pmol/kg/min for 25 min; total 200 pmol/kg, approximately 0.675 μg/kg) induced a short-lasting increase in middle cerebral artery diameter and dilation of the superficial temporal artery together with a mild and short-lasting headache (16). In addition, a similar study in migraineurs receiving VIP resulted in marked dilation of cranial arteries (34). The VIP dose we utilized was approximately four times higher than that used in the human study (0.675 μg/kg), which is explained by VIP's half-life being approximately 2 min in man (35) compared with only 0.44 min in rat (36).

Since both VIP and PACAP show similar affinity for the VPAC₁ receptor (Table 1), we used a specific VPAC₁ antagonist, PG97-269, against VIP and PACAP-38. PG97-269 significantly inhibited the dilation induced by PACAP-38. In contrast, neither 10 μg/kg nor 20 μg/kg of PG97-269 had any effect on VIP-induced responses. In fact, the 20 μg/kg elicited VIP response resulted in an increase in dilation in two of five rats. A slight blockade was found in the remaining three animals. In vitro PG97-269 has shown antagonistic properties in an assay involving VIP-, PACAP-38- and PACAP-27-induced cAMP production in cells expressing the human VPAC₁ receptor (19). Species and/or differences in receptor composition may account for this unexpected result. The results suggest, however, an important role for the VPAC₁ receptor in mediating PACAP-38 vasodilation in vivo in rat.

The VPAC₂ receptor antagonist PG99-465 failed to inhibit the VIP-induced responses. In vitro PG99-465 decreased the ability of VIP and PACAP-38 to induce lipolysis in rat adipocytes (37); however, a [cAMP]_i assay revealed that PG99-465 acted as a partial agonist on the human VPAC₂ receptor (19). In the same study, PG99-465 was described as a full agonist on the human VPAC₁ and PAC₁ receptors (19); thus, selectivity and potency for this receptor is questionable.

In our hands, the PAC₁ agonist maxadilan, a 61 amino acid peptide extracted from the saliva of the sand fly, did not elicit any significant increase in MMA diameter or reduction in mean arterial blood pressure. However, previous in vivo studies are very limited and dealt only with its ability to induce erythema in rabbit skin (38). Moreover, in vitro studies comprise receptor-ligand studies of established cell lines and primary cultures presenting binding of maxadilan in brain membrane fractions from rat, rabbit and human tissue (39). Thus, previous studies do not explain our observations; however, the negligible effect cannot be attributed to a lack of PAC₁ receptors, as we observed mRNA expression of this receptor in our RT-PCR studies. The PAC₁ receptor possesses at least four splice variants in the rat (40) and up to 14 in humans (41). Thus, maxadilan might not be active on all the PAC₁ splice variants and the meningeal arteries could be equipped with one of these.

PACAP(6-38) has been described as the most potent antagonist of the PAC₁ receptor in a cAMP stimulation study of human neuroblastoma cells (42). PACAP(6-38) did not inhibit the vasodilatory effect of VIP or PACAP-38. An in vivo cranial window study of piglet pial arterioles showed that topical application of PACAP-38 and PACAP-27 co-applied with PACAP(6-38) caused statistically significant inhibition of the effect. In the same study PACAP(6-38) (10⁻⁵ M, approximately 40 μg/ml) was not vasoactive per se (27), in contrast to this study, where 10, 20 and 50 μg/kg (approximately 0.14, 0.29 and 0.71 μg/ml, respectively) of PACAP(6-38) elicited dose-dependent dilation. However, taking the lack of response of maxadilan together with the lack of antagonistic effect of PACAP(6-38) into consideration, we believe that PAC₁ receptor might not play a significant role in MMA dilation in rats.

Our RT-PCR expression studies have demonstrated the presence of mRNA of all three receptors. In line with this, mRNA expression for all three receptors has been demonstrated in human cerebral arteries, including the perivascular nerves and in trigeminal, otic and sphenopalatine ganglia (43). The VPAC₁ receptor has, furthermore, been shown in rat smooth muscle cells from cerebral arteries and arterioles (14, 44). There is a close structural homology between rat and human among the VPAC₁, VPAC₂ and PAC₁ receptors (45).

In order to delineate further the pharmacology of these receptors and their role in migraine, the development of more selective and potent agonists as well as antagonists for these receptors is clearly crucial. RT-PCR revealed mRNA expression of VPAC₁, VPAC₂ and PAC₁ receptors. Lack of activity of the PAC₁ agonist maxadilan and antagonist PACAP(6-38) point to the negligible role of this receptor. VPAC receptors, especially the VPAC₁ receptor, seem promising targets to be further evaluated in preclinical models of migraine.

Footnotes

Acknowledgements

This study was supported by The Lundbeck Foundation as part of the Lundbeck Foundation Centre for Neurovascular Signalling (LUCENS) and by Copenhagen County's Research Council, Danish Agency of Science, Technology and Innovation, the Danish Research Council, the Augustinus Foundation, the Family Hede Nielsen Foundation and the Beckett Foundation.

References

1 Thomsen

Iversen

Boesen

Olesen

. Transcranial Doppler and cardiovascular responses during cardiovascular autonomic tests in migraineurs during and outside attacks. Brain 1995; 118:1319–27.

2 Thomsen

Olesen

. The autonomic nervous system and the regulation of arterial tone in migraine. Clin Auton Res 1995; 5:243–50.

3 Edvinsson

Goadsby

. Neuropeptides in headache. Eur J Neurol 1998; 5:329–41.

4 Gulbenkian

Uddman

Edvinsson

. Neuronal messengers in the human cerebral circulation. Peptides 2001; 22:995–1007.

5 Bellamy

Cady

Durham

. Salivary levels of CGRP and VIP in rhinosinusitis and migraine patients. Headache 2006; 46:24–33.

6 Somogyvari-Vigh

Reglodi

. Pituitary adenylate cyclase activating polypeptide: a potential neuroprotective peptide. Curr Pharm Des 2004; 10:2861–89.

7 Vaudry

Gonzalez

Basille

Yon

Fournier

Vaudry

. Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol Rev 2000; 52:269–324.

8 Uddman

Goadsby

Jansen

Edvinsson

. PACAP, a VIP-like peptide: immunohistochemical localization and effect upon cat pial arteries and cerebral blood flow. J Cereb Blood Flow Metab 1993; 13:291–7.

9 De Vries

Villalon

Saxena

. Pharmacological aspects of experimental headache models in relation to acute antimigraine therapy. Eur J Pharmacol 1999; 375:61–74.

10.

10 Seki

Suzuki

Baskaya

Kano

Saito

Takayasu

. The effects of pituitary adenylate cyclase-activating polypeptide on cerebral arteries and vertebral artery blood flow in anesthetized dogs. Eur J Pharmacol 1995; 275:259–66.

11.

11 Fahrenkrug

. PACAP—a multifacetted neuropeptide. Chronobiol Int 2006; 23:53–61.

12.

12 Laburthe

Couvineau

. Molecular pharmacology and structure of VPAC receptors for VIP and PACAP. Regul Pept 2002; 108:165–73.

13.

13 Tatsuno

Uchida

Tanaka

Saeki

Hirai

Saito

. Maxadilan specifically interacts with PAC1 receptor, which is a dominant form of PACAP/VIP family receptors in cultured rat cortical neurons. Brain Res 2001; 889:138–48.

14.

14 Fahrenkrug

Hannibal

Tams

Georg

. Immunohistochemical localization of the VIP1 receptor (VPAC1R) in rat cerebral blood vessels: relation to PACAP and VIP containing nerves. J Cereb Blood Flow Metab 2000; 20:1205–14.

15.

15 Birk

Sitarz

Petersen

Oturai

Kruuse

Fahrenkrug

Olesen

. The effect of intravenous PACAP38 on cerebral hemodynamics in healthy volunteers. Regul Pept 2007; 140:185–91.

16.

16 Hansen

Sitarz

Birk

Rahmann

Oturai

Fahrenkrug

. Vasoactive intestinal polypeptide evokes only a minimal headache in healthy volunteers. Cephalalgia 2006; 26:992–1003.

17.

17 Williamson

Hargreaves

Hill

Shepheard

. Intravital microscope studies on the effects of neurokinin agonists and calcitonin gene-related peptide on dural vessel diameter in the anaesthetized rat. Cephalalgia 1997; 17:518–24.

18.

18 Juhl

Edvinsson

Olesen

Jansen-Olesen

. Effect of two novel CGRP-binding compounds in a closed cranial window rat model. Eur J Pharmacol 2007; 567:117–24.

19.

19 Dickson

Aramori

McCulloch

Sharkey

Finlayson

. A systematic comparison of intracellular cyclic AMP and calcium signalling highlights complexities in human VPAC/PAC receptor pharmacology. Neuropharmacology 2006; 51:1086–98.

20.

20 Ciccarelli

Svoboda

De Neef

Di Paolo

Bollen

Dubeaux

. Pharmacological properties of two recombinant splice variants of the PACAP type I receptor, transfected and stably expressed in CHO cells. Eur J Pharmacol 1995; 288:259–67.

21.

21 van Rossum

Hanisch

Quirion

. Neuroanatomical localization, pharmacological characterization and functions of CGRP, related peptides and their receptors. Neurosci Biobehav Rev 1997; 21:649–78.

22.

22 Moro

Lerner

. Maxadilan, the vasodilator from sand flies, is a specific pituitary adenylate cyclase activating peptide type I receptor agonist. J Biol Chem 1997; 272:966–70.

23.

23 Uddman

Edvinsson

Jansen

Stiernholm

Jensen

Olesen

Sundler

. Peptide-containing nerve fibres in human extracranial tissue: a morphological basis for neuropeptide involvement in extracranial pain? Pain 1986; 27:391–9.

24.

24 Jansen

Uddman

Hocherman

Ekman

Jensen

Olesen

. Localization and effects of neuropeptide Y, vasoactive intestinal polypeptide, substance P, and calcitonin gene-related peptide in human temporal arteries. Ann Neurol 1986; 20:496–501.

25.

25 Edvinsson

Ekman

Jansen

Ottosson

Uddman

. Peptide-containing nerve fibers in human cerebral arteries: immunocytochemistry, radioimmunoassay, and in vitro pharmacology. Ann Neurol 1987; 21:431–7.

26.

26 Anzai

Suzuki

Takayasu

Kajita

Mori

Seki

. Vasorelaxant effect of PACAP-27 on canine cerebral arteries and rat intracerebral arterioles. Eur J Pharmacol 1995; 285:173–9.

27.

27 Lenti

Domoki

Kis

Hegyi

Toth

Busija

Bari

. Pituitary adenylate cyclase-activating polypeptide induces pial arteriolar vasodilation through cyclooxygenase-dependent and independent mechanisms in newborn pigs. Brain Res 2007; 1165:81–8.

28.

28 Naruse

Suzuki

Ozaki

Nokihara

. Vasodilator effect of pituitary adenylate cyclase activating polypeptide (PACAP) on femoral blood flow in dogs. Peptides 1993; 14:505–10.

29.

29 Whalen

Johnson

Lewis

. Hemodynamic actions of systemically injected pituitary adenylate cyclase activating polypeptide-27 in the rat. Eur J Pharmacol 1999; 365:205–15.

30.

30 Petersen

Birk

Doods

Edvinsson

Olesen

. Inhibitory effect of BIBN4096BS on cephalic vasodilatation induced by CGRP or transcranial electrical stimulation in the rat. Br J Pharmacol 2004; 143:697–704.

31.

31 Petersen

Dyrby

Williamson

Edvinsson

Olesen

. Effect of hypotension and carbon dioxide changes in an improved genuine closed cranial window rat model. Cephalalgia 2005; 25:23–9.

32.

32 Banks

Kastin

Komaki

Arimura

. Passage of pituitary adenylate cyclase activating polypeptide1-27 and pituitary adenylate cyclase activating polypeptide1-38 across the blood–brain barrier. J Pharmacol Exp Ther 1993; 267:690–6.

33.

33 Edvinsson

Gulbenkian

Barroso

Cunha e Sa

Polak

Mortensen

. Innervation of the human middle meningeal artery: immunohistochemistry, ultrastructure, and role of endothelium for vasomotility. Peptides 1998; 19:1213–25.

34.

34 Rahmann

Wienecke

Hansen

Fahrenkrug

Olesen

Ashina

. Vasoactive intestinal peptide causes marked cephalic vasodilation, but does not induce migraine. Cephalalgia 2008; 28:226–36.

35.

35 Domschke

Domschke

Bloom

Mitznegg

Mitchell

Lux

Strunz

. Vasoactive intestinal peptide in man: pharmacokinetics, metabolic and circulatory effects. Gut 1978; 19:1049–53.

36.

36 Hassan

Refai

Andersson

Schnell

Jacobsson

. In vivo dynamical distribution of 131I-VIP in the rat studied by gamma-camera. Nucl Med Biol 1994; 21:865–72.

37.

37 Akesson

Ahren

Edgren

Degerman

. VPAC2-R mediates the lipolytic effects of pituitary adenylate cyclase-activating polypeptide/vasoactive intestinal polypeptide in primary rat adipocytes. Endocrinology 2005; 146:744–50.

38.

38 Moro

Wakita

Ohnuma

Denda

Lerner

Tajima

. Functional characterization of structural alterations in the sequence of the vasodilatory peptide maxadilan yields a pituitary adenylate cyclase-activating peptide type 1 receptor-specific antagonist. J Biol Chem 1999; 274:23103–10.

39.

39 Moro

Tsomides

Tajima

Lerner

. Maxadilan binds to membrane fractions of brain tissue. Biochem Biophys Res Commun 1995; 216:234–41.

40.

40 Spengler

Waeber

Pantaloni

Holsboer

Bockaert

Seeburg

Journot

. Differential signal transduction by five splice variants of the PACAP receptor. Nature 1993; 365:170–5.

41.

41 Lutz

Ronaldson

Shaw

Johnson

Holland

Mitchell

. Characterization of novel splice variants of the PAC1 receptor in human neuroblastoma cells: consequences for signaling by VIP and PACAP. Mol Cell Neurosci 2006; 31:193–209.

42.

42 Robberecht

Gourlet

De Neef

Woussen-Colle

Vandermeers-Piret

Vandermeers

Christophe

. Structural requirements for the occupancy of pituitary adenylate-cyclase-activating-peptide (PACAP) receptors and adenylate cyclase activation in human neuroblastoma NB-OK-1 cell membranes. Discovery of PACAP(6-38) as a potent antagonist. Eur J Biochem 1992; 207:239–46.

43.

43 Knutsson

Edvinsson

. Distribution of mRNA for VIP and PACAP receptors in human cerebral arteries and cranial ganglia. Neuroreport 2002; 13:507–9.

44.

Baeres

Moller

Origin of PACAP-immunoreactive nerve fibers innervating the subarachnoidal blood vessels of the rat brain. J Cereb Blood Flow Metab 2004; 24:628–35.

45.

45 Dickinson

Fleetwood-Walker

. VIP and PACAP: very important in pain? Trends Pharmacol Sci 1999; 20:324–9.

The in vivo Effect of VIP,PACAP-38 and PACAP-27 and mRNA Expression of Their Receptors in Rat Middle Meningeal Artery

Abstract

Keywords

Introduction

Methods

In vivo preparations

Experimental protocols

Data presentation and statistical analysis

Test substances

mRNA expression studies

Results

Agonist dose–response experiments

Interaction experiments

mRNA expression studies

Discussion

Footnotes

Acknowledgements

References