Sage Journals: Discover world-class research

Abstract

During mouse embryogenesis, hematopoietic development takes place in several distinct anatomic locations. The microenvironment of different hematopoietic organs plays an important role in the proliferation and maturation of the hematopoietic cells. We hypothesized that fetal stromal cells would be distinct to adult bone marrow (BM)-derived stromal cells because the BM contributes mainly to the homeostasis of hematopoietic stem cells (HSCs), while extensive expansion of HSCs occurs during fetal development. Here we report the establishment of stromal cell lines from fetal hematopoietic organs, namely aorta-gonad-mesonephros (AGM), midgestation placenta (PL), and fetal liver (FL) together with adult bone marrow (BM). The growth patterns and hematopoietic supportive potential were studied. Their phenotypic and molecular gene expression profiles were also determined. Stromal cell lines from each tissue were able to support cobblestone area formation of BM c-Kit⁺Sca-1⁺ hematopoietic cells: 22 (22/47) from AGM, three (3/4) from PL, three (3/4) from FL, and three (3/3) from BM. There were similar levels of expansion of total mononuclear cells (TMNs) when HSCs were cocultured with fetal stroma and adult BM stroma. However, PL-derived stromal cells supported higher levels of generation of colony-forming progenitor cell (CFU-C), indicated by more colonies and colonies with significantly larger size. Flow cytometric analysis of the PL1 cells demonstrated a phenotype of CD45^-, CD105⁺, Sca-1⁺, CD34⁺, and CD49d⁺, compared to adult BM1 cells, which were CD45^-, CD105⁺, Sca-1⁺, CD34^-, and CD49d^-. Using Affymetrix microarray analysis, we identified that genes specifically express in endothelial cells, such as Tie1, Tek, Kdr, Flt4, Emcn, Pecam1, Icam2, Cdh5, Esam1, Prom1, Cd34, and Sele were highly expressed in stroma PL1, consistent with an endothelial phenotype, while BM1 expressed a mesenchymal stromal phenotype. In summary, these data demonstrate distinct characteristics of stromal cells that provide insights into the microenvironmental control of HSCs.

Keywords

Hematopoietic stem cell Stromal cells Microenvironment Transcriptional gene expression

Introduction

During mouse embryogenesis, hematopoietic development is a complex process, which takes place in several distinct anatomic locations (56). The initial hematopoietic activity occurs in the yolk sac at E7.5 (37). Adult-type, definitive hematopoiesis can be detected first at E10.5 in the intraembryonic aorta-gonado-mesonephros (AGM) region (33). Thereafter, hematopoietic cells colonize the fetal liver where they undergo expansion and maturation (25), before finally moving to the bone marrow. Recent studies have independently reported that clonogenic hematopoietic progenitors and multipotent hematopoietic stem cells (HSCs) can also be detected in the placental region during midgestation, identifying a novel fetal hematopoietic site (1,19,38).

It is now widely accepted that the microenvironment in different organs (the so-called “stem cell niche”) plays an important role in the development and maturation of the hematopoietic cells during embryogenesis (56). This niche is believed to be composed of stromal cells and various extracellular matrices. Stromal cells, being the principal component of the microenvironment, interact and regulate the generation, proliferation, and maintenance of hematopoietic cells possibly by cell–cell contact and/or local paracrine molecules (22).

Adult bone marrow (BM) is thought to maintain and support hematopoiesis throughout normal life. Hence, a number of BM-derived stromal cell lines—MS-5 (44), S17 (12), and HESS-5 (49)—have been established and studies have demonstrated their ability to maintain primitive hematopoietic cells. But the adult BM microenvironment mostly maintains homeostasis as HSCs exist as slow-cycling cells in a quiescent state without undergoing significant expansion. The quiescent state is thought to be an essential mechanism to protect HSCs from stress and to sustain long-term hematopoiesis (2,54).

Midgestation fetal liver (FL) is believed to be the organ where the HSC compartment undergoes expansion through self-renewal in addition to differentiation (37). Cloned stromal cell lines from FL have been shown to promote proliferation and differentiation of hematopoietic cells in vitro (36,45,55). In particular, AFT024, a FL stromal cell line immortalized with a retroviral vector encoding a temperature-sensitive SV40 T antigen, has been studied extensively for its ability to support hematopoiesis (36,55).

Recent work by several groups has suggested that the stromal cells derived from the AGM region of E10.5 mouse embryos promoted the generation of both mouse and human progenitors from primitive hematopoietic cells without additional cytokines (57). Although, the AGM region was assumed to be the source of definitive hematopoiesis colonizing the FL (15), the number of HSCs in the AGM region remains low throughout embryonic development (19,34). This means that while the AGM region may provide a favorable microenvironment for the generation of definitive HSCs, it seems to have limited contribution for the expansion of HSCs.

Other studies have reported that clonogenic hematopoietic progenitors and multipotent HSCs can be detected in the placental region during midgestation, thus identifying a third prehepatic hematopoietic site (1,19,38). One study showed that the placental HSC pool expands until E12.5–E13.5 and contains >15-fold more HSCs than the AGM (19). Another study found that the earliest progenitors that yielded high proliferative potential colony-forming cells (HPP-CFCs) were two to four times more frequent in the placenta than in the yolk sac or FL. In the FL, late progenitors were more frequent (1). So far, only a few studies have documented the derivation of human placenta mesenchymal stroma and its hematopoietic supportive property (60).

The molecular milieu elaborated by different stromal cell lines has been previously studied, especially AFT024 (21). These studies revealed gene products of several categories, which differ between hematopoietic supportive and nonsupportive lines. No study, to date, has examined the gene expression of the placenta stromal cells.

Hence, in this study, we derived stromal cell lines from fetal hematopoietic organs: mouse midgestation placenta (E11.5–13.5) together with those from the AGM region of E10.5–11.5, FL of E13.5 to 14.5, and adult BM from a commonly used mouse strain B6D2F1. These specific embryonic days were chosen based on previous reports (35). We have compared the hematopoietic supportive potential of these stromal cell lines and their gene expression profiles.

Materials and Methods

Embryo Generation

To generate embryos, timed matings were set up using B6D2F1 mice (NCI Jackson Laboratory, Bar Harbor, ME). Embryonic development was estimated by considering the day of vaginal plug discovery as E0.5. Pregnant mice were sacrificed by cervical dislocation and the embryos were isolated from the uterus. The animal use protocols were approved by the University of Miami Institutional Animal Care and Use Committee.

Establishment of Murine Stromal Cell Lines and Culture Conditions

Murine stromal cell lines were established from the BM, the AGM region, midgestation placenta, and FL.

AGM stromal cell lines were derived from E10.5–11.5 embryos. The region surrounding the aorta, genital ridge, and mesonephros was dissected using a dissecting microscope and organ cultures were set up as previously described (57) with modifications. Briefly, the AGM tissues were cultured in 96-well plates (Evergreen Scientific, Los Angeles, CA) with 100 μl medium. Adherent cells started to appear around the tissues 2–3 days later, and the AGM tissues were removed 1 week later. The adherent cells were harvested from the wells using 0.05% trypsin-EDTA (GIBCO BRL, Grand Island, NY) and were transferred to 24-well plates, 6-well plates, etc., for culture expansion. The medium was replaced twice weekly.

The E11.5–E13.5 placenta (PL), separated from the decidua and fetal hematopoietic tissues, were dissected from embryos and prepared as previously described (19). Tissues were first mechanically dissociated and then incubated with collagenase (Sigma Chemical, St. Louis, MO) at a final concentration of 0.12% v/v for 1 h at 37°C in phosphate-buffered saline supplemented with 1% fetal bovine serum (FBS; Hyclone, Logan, UT). The cell suspension was washed once in PBS with 1% FBS, and subsequently incubated in Murine Mesenchymal Medium with Supplements (Stem Cell Technologies, Vancouver, BC). The medium was replaced twice weekly. When the cultures reached approximately 50–90% monolayer confluence, cells were recovered by using 0.05% trypsin-EDTA for culture expansion. FL stroma lines from E13.5 to 14.5 embryos were established using similar method.

BM cells were collected by flushing the femurs and tibiae of 6-12-week-old mice with PBS supplemented with 1% FBS. Cells were dissociated by gentle pipetting and passed through a 70-μM nylon cell strainer (BD Falcon, Bedford, MA). Red blood cell-depleted bone marrow mononuclear cells (BMMNCs) were plated at a density of 10⁶ cells/cm² in Murine Mesenchymal Medium with Supplements. Nonadherent cells were eliminated with removal of half the media and replacement with fresh media at day 3.

AFT024 stromal cells (kindly provided by K. A. Moore; Princeton University, Princeton, NJ) from FL, which have been shown to support hematopoiesis previously, were used as a control cell line. The AFT024 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; GIBCO BRL) supplemented with 10% FBS and 5 × 10⁻⁵ mol/L β-mercaptoethanol (2-ME; Sigma) at 32°C, 5% CO₂, and 100% humidity (36,55).

Hematopoietic Stem/Progenitor Cell Purification

To harvest adult hematopoietic stem/progenitor cells, 6–12-week-old GFP⁺ mice [C57BL/6-Tg(UBC-GFP)] (NCI Jackson Laboratory, Bar Harbor, ME) were injected with 150 mg 5-fluorouracil (5-FU) (Sigma) in 0.9% sodium chloride (NaCl, Abbott Laboratories, Chicago, IL) per kilogram of body weight intraperitoneally. Three days later they were killed and single cell suspensions prepared from their femurs and tibiae. To sort GFP⁺Sca-1⁺c-Kit⁺ cells, nucleated cells were incubated with anti-c-Kit-allophycocyanin (anti-c-Kit-APC, BD Bioscience) and anti-Sca-1-phycoerythrin (anti-Sca-1-PE, BD Bioscience) and sorted on a FACSVantage (Becton Dickinson, Mountain View, CA). More than 95% of the sorted cells were GFP⁺Sca-1⁺c-Kit⁺ by flow cytometric analysis.

Coculture of Hematopoietic Stem/Progenitor Cells with Stromal Cells

Stromal cells were prepared on six-well tissue culture plates and grown at 37°C, 5% CO₂, and 100% humidity. To determine cobblestone area (CA) formation, enriched Sca-1⁺c-Kit⁺ adult BM hematopoietic cells (1,000 cells/well in six-well plates) were seeded onto irradiated (20 Gy, Gammacell 40; Atomic Energy of Canada Limited) stromal monolayers. And the cultures were maintained in α-minimum essential medium (α-MEM; Mediatech Inc., Herndon, VA) supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin (Pen/Strep; GIBCO-BRL), and 20% FBS without cytokine supplement. CA development was evaluated at day 7. The same volume of culture medium was added to the wells on day 7. At different time points (day 7 and 14) of cocultures, individual wells were harvested. The cultured cells (including hematopoietic cells and stromal cells) were stained with trypan blue and counted, the rest replated into cytokine-supplemented semisolid clonogenic progenitor assays (CFU-C). All experiments of coculture were started in triplicate.

Lineage content of the coculture products was determined by Wright/Giemsa staining of a cytospin slide preparation. The harvests were also analyzed by flow cytometry using pan-leukocyte marker anti-CD45 and lineage-specific marker Mac-1, CD3, and CD45RO/B220 (all from BD Bioscience).

In Vitro Hematopoietic Progenitor Cell Assay

The progenitor content of hematopoietic cell/stromal cell cocultures was assessed using in vitro methylcellulose colony-forming assay.

Recombinant murine (rm) interleukin-3 (IL-3) and granulocyte macrophage colony-stimulating factor (GM-CSF) were purchased from PeproTech Inc (Rocky Hill, NJ). Recombinant human (rh) IL-6, granulocyte colony-stimulating factor (G-CSF), and recombinant rat (rr) stem cell factor (SCF) were obtained from Amgen (Thousand Oaks, CA).

Cells were plated in methylcellulose (M4230, Stem-Cell Technologies) supplemented with 100 ng/ml rr SCF, 100 ng/ml rm IL-3, 100 ng/ml rh IL-6, 100 ng/ml rh G-CSF, and 100 ng/ml rm GM-CSF. Hematopoietic colonies (committed colony-forming cells granulocyte-macrophage, CFU-GM) were scored after 14 days of culture in 5% CO₂ at 37°C according to the established criteria (47). Colonies that reached greater than 0.5 mm in size after 14 days were scored as high-proliferative potential colony forming cells (HPP-CFC) (32).

Colony assays were also performed with 10³ freshly sorted GFP⁺Sca-1⁺c-Kit⁺ BM cells. CFU progenitor contents of all stromal cocultures were normalized to an original input of 10³ HSCs.

FACS Analysis

The phenotype of the stromal cell clones derived was determined by FACS analysis. Stroma cells were stained with a panel of antibodies and the corresponding isotype controls. The labeled cells were detected on a FACScalibur cytometer (Becton Dickinson) and analyzed using CellQuest software (BD). There were 100,000 events acquired for each analysis. The antibodies used were CD3-PE, CD11b-PE, CD14-PE, CD34-PE, CD34-FITC, CD45-PE, CD45RO/B220-PE, CD49d-PE, CD90.2-PE, Gr-1-PE, Sca-1-PE, CD117(c-Kit)-FITC, purified rat anti-mouse CD105 (Endoglin) followed by FITC polyclonal anti-rat Ig (all from BD).

Statistical Analysis

The differences in expansion fold among 10 stroma clones, two from each source plus two repeats of AFT024, were analyzed by ANOVA. Post hoc tests by LSD were performed to analyze the difference between two groups. A value of p < 0.05 was considered statistically significant. All statistical analysis was performed using SPSS software (v16.0) (SPSS Inc., Chicago, IL).

Total RNA Extraction and Quality/Quantity Control

RNA of PL1 was extracted from three independent cultures of passage (P) 5, P13, and P27, BM1 from P5, P9, and P11, and two cultures of AFT024. Total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer's instruction and additionally purified with RNeasy Mini Kit (Qiagen, Cat. #74106). The concentration of RNA was measured by its absorbance at 260 nm, and RNA purity was determined by the ratios of OD260 nm/280 nm using the NanoDrop spectrophotometry (NanoDrop ND-1000, Wilmington, DE). The integrity of the RNA was assessed by detecting RIN (RNA Integrity Number) using an Agilent Bioanalyzer 2100 (Agilent Technologies, Inc., Santa Clara, CA). RIN of all RNA samples used in the experiments was above 9.

Probe Preparation, Microarray Hybridization, and Data Analysis

The RNA was processed for use on GeneChip Mouse Genome 430_2.0 array (Affymetrix, Santa Clara, CA) according to the manufacturer's instructions at the Microarray and Gene Expression Core, University of Miami (Miami, FL, http://www.mihg.org/weblog/core_resources/2007/11/microarray-and-gene-expression.html). Briefly, 5 μg of total RNA was reverse transcribed to double-stranded cDNA. The double-stranded cDNA was used in an in vitro transcription reaction to generate biotinylated cRNA probes. The cRNA probes were purified, fragmented, and hybridized to the Affymetrix chip. Washing and staining was performed in an Affymetrix Gene Chip Fluidics station 450. The Affymetrix arrays were scanned using an Affymetrix Gene Chip Scanner 3000 7G. The hybridizations were performed in three biological replicates for placenta stroma and BM stroma and two replicates for AFT024 as stated above. Analyses were performed using GeneSpring GX 10.0 software (Agilent Technologies). Genes that were present in all PL1 stromal samples and significantly [False Discovery Rate (FDR) <0.05, different by twofold] either up- or downregulated compared to BM1 stromal cells are presented in the results. The genes were assigned to functional classes based on the GO database (http://www.geneontology.org/GO.annotation.html), and significantly overrepresented GO categories in the gene sets were analyzed using the Onto-Express (http://vortex.cs.wayne.edu/projects.htm) (14,28). We also manually, functionally annotated genes using PubMed searches.

Semiquantitative RT-PCR

To validate the results of the microarray analysis, some of the differentially expressed genes by PL1 and BM1 were further analyzed by RT-PCR as described previously (51). The primers were designed using primer design program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). The primer sequences are shown in Table 1. Total RNA (1 μg per reaction) was reverse transcribed using Oligo dT and the SuperScript II reverse transcriptase kit (Invitrogen). One twentieth of the cDNA mixture was used for all genes. Samples were amplified in iCycler (Bio-Rad, Richmond, CA) under the following conditions for 35 cycles: first a denaturing step at 95°C for 30 s, then an annealing step at 55–58°C for 30 s, and finally an amplification step at 72°C for 30 s. RT-PCR products were visualized (with ethidium bromide) on a 1.5% agarose gel. Relative gene expression was normalized to housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Table 1.

Oligonucleotide Primers Used for RT-PCR

Accession No.	Gene	Primer Sequence	Product Size (bp)
NM_016885	Emcn (endomucin)	5′: tggacagtgaagccactgag	418
		3′: tgttctgggaacctggtagc
NM_008816	Pecam1 (platelet/endothelial cell adhesion molecule 1)	5′: gaatgacacccaagcgtttt	483
		3′: gtctctgtggctctcgttcc
NM_027102	Esam (endothelial cell-specific adhesion molecule)	5′: gagctcaaagtgctggttcc	437
		3′: gcaatggcatcttccttgat
NM_008935	Prom1 (prominin 1)	5′: ggaaaagttgctctgcgaac	436
		3′: ttccagggtagaggcaaatg
NM_009236	Sox18 (SRY-box containing gene 18)	5′: tttcccaatcctctgtcacc	441
		3′: ccccagaaggaggtgtgtaa
NM_011446	Sox7 (SRY-box containing gene 7)	5′: gctcctgcttttggtgtagc	475
		3′: cacacgtgcatttggaagtc
NM_011587	Tie1 (tyrosine kinase with Immunoglobulin-like and EGF-like domain 1)	5′: atccgaagaagctgcctaca	417
		3′: gtttccatagggggcgtatt
NM_013690	Tek (endothelial-specific receptor tyrosine kinase)	5′: gagacagaccctgcttttgc	473
		3′: ttctccctccagcactgtct
NM_008008	Fgf7 (fibroblast growth factor 7)	5′: tgtgtacccagctgttccaa	433
		3′: ttcacactcgtagccgtttg
NM_146007	Col6a2 (collagen, type VI, alpha 2)	5′: cacctctccatcccatctgt	401
		3′: tgatatggggctctcaggtc
NM_007742	Col1a1 (collagen, type I, alpha 1)	5′: actggtacatcagcccgaac	476
		3′: ggtggagggagtttacacga
NM_011340	Serpinf1 [serine (or cysteine) peptidase inhibitor, clade F, member 1]	5′: cctcagcatccttctccttg	448
		3′: cacgggtttgccagtaatct
BC082592	GAPDH	5′: tcctgcaccaccaactgcttag	560
		3′: tcttactccttggaggccatgt

Results

Establishment of Stromal Cell Lines

Stromal cells are the principal components of the HSC microenvironment; thus, stromal cell lines are considered useful tools for analyzing the interaction of hematopoietic cells with its specific niche. We isolated a panel of stromal cell lines from fetal hematopoietic organs (AGM, midgestation PL, and FL) and adult BM, as these tissues/organs contribute to the generation, proliferation/expansion, and maintenance of hematopoietic cells.

Under the culture conditions described above, stromal cells from E10.5–11.5 AGM region could be readily obtained with a population doubling (PD) time of 1–3 days. Of the 47 AGM stromal cell lines established, 25 had a fibroblast-like morphology (Fig. 1A). Nine were mainly composed of large, flat cells and the rest were heterogeneous in morphology.

Figure 1.

Representative phase microscopy of stroma cell lines established. (A) From E10.5 AGM. (B) PL1, from E11.5 placenta, showed mainly endothelial-cell like morphology. (C) From E14.5 fetal liver. (D) BM1, from adult BM, showed spontaneous differentiation to adipocytes. AGM: aorta-gonad-mesonephros; PL: placenta; FL: fetal liver; BM: bone marrow; P: passage.

Four stromal cell lines from E11.5–E13.5 PL, four from E13.5–E14.5 FL, and three from adult BM were also established. But their growth kinetics showed distinct characteristics from the AGM stroma cells. While most of the stromal cells showed a heterogeneous fibroblast-like morphology as expected, one line from placenta (PL1) showed mainly an endothelial cell-like morphology (Fig. 1B). One line from BM showed spontaneous differentiation to adipocytes (10–30%) starting from passage 3 (Fig. 1D). Therefore, the morphology of the stromal cells demonstrated significant heterogeneity.

Coculture of Mouse BM c-Kit⁺Sca-1⁺ Cells on Stromal Cells: “Cobblestone Area” (CA) Formation

To study the hematopoietic supportive ability of the stromal cell lines established, 10³ GFP⁺c-Kit⁺Sca-1⁺ mouse BM cells were sorted and plated on the stromal monolayers and cocultured for 2 weeks. CA colonies appeared beginning on day 3 of incubation with continued increase in colony size and number (Fig. 2).

Figure 2.

Cobblestone-like colonies generated in the coculture of mouse BM GFP⁺c-Kit⁺Sca-1⁺ hematopoietic cells with placenta stroma (PL1) on day 7. (A) Phase microscopy. (B) Fluorescent microscopy.

Out of the 57 stromal cell lines established in total, we identified 31 cell lines that could support cobblestone area formation: 22 (22/47) from AGM, three (3/4) from PL, three (3/4) from FL, and three (3/3) from BM. Primary CA colonies formed after 1 week varied markedly (ranging from 11 to 223 colonies per 10³ c-Kit⁺Sca-1⁺ input) and the size of the colonies was highly variable as well. Nonadherent hematopoietic cells continued to be released into the culture medium. After 2 weeks of culture, individual colonies became coalescent and were unable to be counted separately. Thus, the whole culture products were harvested and the fold expansion determined. Two stromal cell clones from each hematopoietic organ/tissue that gave comparable or better support for murine c-Kit⁺Sca-1⁺ cells than AFT024 (36) were included in our statistical analysis.

Total Nucleated Cell (TNC) Expansion

After 1 week, AGM stroma supported expansion of TNC of 284-fold (range: 76–512-fold) compared to the initial input cell number, PL 273-fold (103–440), FL 250-fold (127–412), BM 416-fold (110–612), and AFT024 304-fold (125–482) (ANOVA: p = 0.24) (Fig. 3). After 2 weeks, AGM stroma resulted in 875-fold (670–1100) expansion of TNC, PL 1057-fold (724–1680), FL 991-fold (650–1410), BM 1380-fold (824–2100), and AFT024 1123-fold (700–1512) (ANOVA: p = 0.06) (Fig. 3).

Figure 3.

Expansion of total nucleated cells on stroma cell lines. BM c-Kit⁺Sca-1⁺ cells were sorted and plated at 1,000 cells/well in six-well plates on stroma cells (irradiated at 20 Gy). Cocultures were maintained for 7 or 14 days at 37°C. From cocultures, both the nonadherent and adherent cell fractions (containing the stromal cells) were harvested and total nucleated cells were counted. The mean in expansion folds of triplicate samples of four experiments is indicated along with the standard deviation. For both 1- and 2-week culture, stroma cells from different sources showed similar effect on total nucleated cell expansion (ANOVA: 1 week, p = 0.24; 2 weeks, p = 0.06).

Progenitor Cell Expansion

Progenitor cell assays demonstrated expansion of early and committed progenitors in all eight stroma cell lines tested, two from each source. Results from CFU assays and two representative experiments are presented in Figures 4 and 5. As shown in Figure 4A, after 1 week, AGM stroma expanded CFU-GMs by 6.1-fold (5–7.4), PL 14.6-fold (10.5–18.9), FL 7.5-fold (5.4–10.2), BM 4.6-fold (2.2–6.1), and AFT024 6.1-fold (4.8–7.8) (ANOVA: p < 0.001). After 2 weeks, AGM resulted in 16.0-fold (10.6–23) expansion of CFU-GMs, 47.5-fold (37.9–61.5) in PL, 27.7-fold (17.8–37) in FL, 18.4-fold (11.1–26.1) in BM, and 22.5-fold (12.4–30.4) in AFT024 (ANOVA: p < 0.001). Therefore, PL stroma cells supported significantly more fold expansion of CFU-GMs after 1 or 2 weeks of coculture (post hoc tests by LSD: p < 0.001).

Figure 4.

In vitro colony formation assay. c-Kit⁺Sca-1⁺ cells (1 × 10³) from murine BM were cocultured with stroma cells (irradiated at 20 Gy) for 1 or 2 weeks. Harvested cells were applied to colony formation assay. The number of CFU-GM and HPP-CFC was determined at day 14. CFU-GM and HPP-CFC from freshly isolated murine BM 1 × 10³ c-Kit⁺Sca-1⁺ cells was used as the control of initial input. The number of colonies indicates the mean ± SD of triplicate cultures. The experiment was repeated four times with similar results (ANOVA: 1 week, p < 0.001 for both CFU-GM and HPP-CFC; 2 weeks, p < 0.001 for both CFU-GM and HPP-CFC). (A) CFU-GM: 1 week: ANOVA significance <0.001. Post hoc testing by LSD test: PL versus AGM, FL, BM, AFT024, p < 0.001. FL versus BM, p = 0.029. 2 weeks: ANOVA significance <0.001. Post hoc testing by LSD test: PL versus AGM, FL, BM, AFT024, p < 0.001. FL versus AGM, p = 0.015. FL versus BM, p = 0.047. (B) HPP-CFC: 1 week: ANOVA significance <0.001. Post hoc testing by LSD test: PL versus AGM, FL, BM, AFT024, p < 0.001. 2 weeks: ANOVA significance <0.001. Post hoc testing by LSD test: PL versus AGM, FL, BM, AFT024, p < 0.001.

Figure 5.

In vitro colony formation assay after 1 week of coculture. c-Kit⁺Sca-1⁺ cells (1 × 10³) from murine BM were cocultured with stroma cell clones PL1, BM1, or AFT024 for 1 week. Harvested cells (5 × 10⁴) were applied to CFU assay. The number of CFU colonies was determined at day 14. Two representative experiments of CFU-GMs produced from PL1, BM1, and AFT027 stroma coculture are shown. PL1 permitted more CFU-GM production and/or with larger colony size than BM1. The experiment was repeated four times with similar results. BM, bone marrow; PL, placenta; CFU-GM, colony-forming unit-granulocyte macrophage.

The stroma cell lines established also expanded HPP-CFCs, which are defined as colonies grown in semisolid medium whose diameter exceeds 0.5 mm (32). As shown in Figure 4B, after 1 week, AGM stroma expanded HPP-CFCs by 1.7-fold (0.7–2.5), PL 3.9-fold (2.9–4.7), FL 1.7-fold (1.1–2.3), BM 1.5-fold (0.7–2.1), and AFT024 1.9-fold (0.6–2.6) (ANOVA: p < 0.001). After 2 weeks, AGM resulted in 3.8-fold (2.2–5.0) expansion of HPP-CFCs, 8.4-fold (7.2–9.8) in PL, 4.8-fold (3.3–6.9) in FL, 4.0-fold (2.1–5.3) in BM, and 4.2-fold (2.7–5.1) in AFT024 (ANOVA: p < 0.001). Thus, stroma cells from PL also permitted more fold of HPP-CFC expansion than the other stroma cells tested (post hoc tests by LSD: p < 0.001).

When 5 × 10⁴ or 1 × 10⁵ harvested cells from coculture were used for CFU assay, PL consistently produced more colonies with significantly larger size (Fig. 5). Therefore, numbers of CFU-GM and HPP-CFC in the coculture with PL cells were approximately two to three times more than that with BM cells. These result indicated that PL is able to promote the proliferation of hematopoietic progenitors without any exogenous cytokines, more potent than BM or AFT024. PL1 from placenta was identified to be the most superior in supporting CFU-GMs and HPP-CFCs expansion.

To test this further, we also did a cytospin on freshly sorted BM c-Kit⁺Sca-1⁺ cells and harvested products of PL1 and BM1 cocultures. Freshly sorted BM c-Kit⁺Sca-1⁺ cells had a high nuclear to cytoplasmic ratio, dark blue cytoplasm, and represent BM primitive hematopoietic cells (data not shown). After coculture with BM1 stroma for 1 week, the harvested population mainly consisted of cells with an abundant light-blue cytoplasm and a relatively small nucleus, resembling more mature hematopoietic cells (Fig. 6, bottom panel). Cytospin of cells cultured on PL1 contained more primitive blast-like cells (>10 cells per high power) (Fig. 6, top panel) compared to BM1 (<5 cells per HP).

Figure 6.

Cytospin. c-Kit+Sca-1⁺ cells (1 × 10³) from murine BM were cocultured with stroma cell clones PL1 and BM1 for 1 week. The harvested cells were collected by cytospin centrifugation and stained with Wright-Giemsa stain and observed by microscopy. Top panels: cytospin of hematopoietic cells cultured on PL1 contained more primitive blast-like cells with scant dark blue cytoplasm (>10/high power, 19/42, 14/32, 16/29). Bottom panels: the harvested population from BM1 mainly consisted of cells with an abundant light-blue cytoplasm and a relatively small nucleus, resembling more mature hematopoietic cells with less blast-like cells (<5/high power; 4/33, 6/37, 2/26).

Flow cytometry studies indicated the persistence of immature c-Kit⁺ and/or Sca-1⁺ hematopoietic cells along with more mature CD45⁺ cells, mostly CD11b (Mac-1)⁺ granulocytes, also CD3⁺ T lymphocyte, CD45RO/B220⁺ B lymphocytes in both PL1 and BM1 (data not shown).

Results from the above biological studies indicated that PL1 could be an active component representing the midgestation placenta hematopoietic niche, which appeared to have distinct hematopoietic supportive property than adult BM niche. We thus further pursued these two representative stromal cell lines (PL1 and BM1) by analysis of their phenotype and gene expression profiles.

Surface Marker Expression

We analyzed the surface marker expression to ascribe a phenotype to the stroma cells PL1 and BM1. Not surprisingly, both PL1 and BM1 showed high level of CD105 expression and were negative for CD45. They also expressed Sca-1, which has been shown to be expressed in stroma cells from AGM previously (52). In contrast to AGM stromal cells (52) and BM1 in our present study, PL1 also expressed high levels of CD34 and CD49d (ITGA4, integrin α4) and low level of CD117 (Fig. 7). Phenotypic analysis also confirmed consistency between the three hematopoietic supportive placental stromal lines established with all three expressing Sca-1, CD105, and CD90 and all three negative for CD45 (data not shown).

Figure 7.

Flow cytometric analysis of surface markers of PL1 and BM1. Stroma cells were trypsinized and harvested for staining with a panel of antibodies and the corresponding isotype controls. The labeled cells were detected on a FACScalibur cytometer and analyzed using CellQuest software; 100,000 events were acquired for each analysis.

Gene Expression Profile of PL1 Stroma

To compare the set of genes differentially expressed between PL1 and BM1, we used GeneChip Mouse Genome 430_2.0 array consisting of 39,000 different transcripts. We identified 1,153 probe sets representing 982 genes that are differentially expressed, with 571 genes upregulated in PL1 and 411 downregulated. These gene products and their gene ontology (GO) annotations (3,14,28) are shown in Table 2.

Table 2.

Top GO Processes Differentially Expressed in Stroma Cell Line PL1 Versus BM1

GO Categories		No. of Hits	FDR
Biological process
GO:0006468	protein amino acid phosphorylation	37/511	0.031186847
GO:0007155	cell adhesion	40/399	1.40E-05
GO:0001525	angiogenesis	17/93	3.05E-05
GO:0009952	anterior/posterior pattern formation	14/89	0.001873583
GO:0007242	intracellular signaling cascade	28/301	0.003188136
GO:0016337	cell–cell adhesion	11/49	6.20E-04
GO:0007411	axon guidance	10/66	0.036521541
GO:0007275	multicellular organismal development	62/759	1.01E-05
Molecular function
GO:0003779	actin binding	23/252	0.013332822
GO:0016301	kinase activity	45/721	0.04012108
GO:0005096	GTPase activator activity	15/153	0.04012108
GO:0003700	transcription factor activity	49/735	0.013332822
GO:0008092	cytoskeletal protein binding	7/34	0.021177187
GO:0005085	guanyl-nucleotide exchange factor activity	14/118	0.017754385
GO:0004672	protein kinase activity	35/482	0.019333699
GO:0016829	lyase activity	13/115	0.026629243
GO:0004713	protein tyrosine kinase activity	15/145	0.026629243
GO:0043565	sequence-specific DNA binding	34/434	0.012933721
Cell component
GO:0030027	lamellipodium	8/49	0.018440731
GO:0016020	membrane	262/5020	3.57E-07
GO:0016023	cytoplasmic membrane-bounded vesicle	7/42	0.02565099
GO:0016021	integral to membrane	208/3981	2.18E-05
GO:0005743	mitochondrial inner membrane	1/217	0.048399209
GO:0005737	cytoplasm	159/3063	9.76E-04
GO:0001726	ruffle	6/34	0.039754468
GO:0005856	cytoskeleton	29/384	0.016168096
GO:0030424	axon	8/62	0.048399209
GO:0042995	cell projection	15/141	0.016168096
GO:0005886	plasma membrane	30/424	0.025144226

Processes were scored according to their False Discovery Rate (FDR), calculated using the Onto-Express (14,28). GO: gene ontology; PL: placenta; BM: bone marrow.

The molecular function of differentially expressed genes between PL1 and BM1 involved in actin binding and cytoskeletal protein binding, kinase activity, GTPase activator activity, transcription factor activity, guanyl-nucleotide exchange factor activity, and lyase activity in GO clustering (Table 3).

Table 3.

Annotation of Genes That Are Differentially Expressed in Placenta Stroma Compared to Adult Bone Marrow Stroma: Molecular Function

Gene Ontology/GenBank Accession No.	Gene Name	Gene Description	U/D	Fold Change
Actin binding (GO:0003779)
BQ176992	Shroom2	shroom family member 2	U	67.23
BC013618	Arpc3	actin related protein 2/3 complex, subunit 3	U	2.01
NM_022024	Gmfg	glia maturation factor, gamma	U	11.34
BG066725	Myo1b	myosin IB	U	2.05
BQ174069	Spnb2	spectrin beta 2	U	3.08
BI646094	Sntb2	syntrophin, basic 2	U	2.71
NM_008879	Lcp1	lymphocyte cytosolic protein 1	U	5.28
BI648366	Tln1	talin 1	U	2.03
NM_010135	Enah	enabled homolog (Drosophila)	D	–8.74
AV114522	Lima1	LIM domain and actin binding 1	D	–3.74
NM_015756	\U\Shroom3	shroom family member 3	D	–20.76
BB758432	Dixdc1	DIX domain containing 1	D	–30.52
BC021808	Vill	villin-like	D	–10.02
BQ176159	Myh10	myosin, heavy polypeptide 10, nonmuscle	D	–86.81
BB476811	Stk38l	serine/threonine kinase 38 like	D	–3.98
NM_010354	Gsn	gelsolin	D	–14.67
AK003186	Tpm2	tropomyosin 2, beta	D	–44.24
NM_013813	Epb4.1l3	erythrocyte protein band 4.1-like 3	D	–6.95
NM_013510	Epb4.1l1	erythrocyte protein band 4.1-like 1	D	–6.56
Kinase activity [including protein kinase activity (GO:0004672); protein tyrosine kinase activity (GO:0004713)] (GO:0016301)
NM_008856	Prkch	protein kinase C, eta	U	140.95
AW557946	Prkd2	protein kinase D2	U	10.12
BC019379	Grk5	G protein-coupled receptor kinase 5	U	3.12
BG969012	Acvrl1	activin A receptor, type II-like 1	U	9.75
BC021640	Mapk12	mitogen-activated protein kinase 12	U	52.46
BC024514	Mapk9	mitogen-activated protein kinase 9	U	1.90
BE948629	Map3k3	mitogen-activated protein kinase kinase kinase 3	U	2.78
BC011474	Lck	lymphocyte protein tyrosine kinase	U	26.01
AF012104	Bmx	BMX nonreceptor tyrosine kinase	U	14.24
NM_010612	Kdr	kinase insert domain protein receptor	U	119.94
NM_011587	Tie1	tyrosine kinase receptor 1	U	160.08
NM_013690	Tek	endothelial-specific receptor tyrosine kinase	U	79.56
NM_008587	Mertk	c-mer proto-oncogene tyrosine kinase	U	44.73
D76446	Map3k7	mitogen-activated protein kinase kinase kinase 7	U	2.19
NM_007377	Aatk	apoptosis-associated tyrosine kinase	U	7.17
NM_010144	Ephb4	Eph receptor B4	U	9.17
NM_022563	Ddr2	discoidin domain receptor family, member 2	D	–177.86
BF225985	Ddr1	discoidin domain receptor family, member 1	D	–4.14
AV026976	Ptk2b	PTK2 protein tyrosine kinase 2 beta	D	–23.48
NM_010237	Frk	fyn-related kinase	D	–21.11
AV324603	Ror2	receptor tyrosine kinase-like orphan receptor 2	D	–13.46
NM_007463	Speg	SPEG complex locus	D	–63.49
AK003718	Hipk2	homeodomain interacting protein kinase 2	D	–7.70
BB476811	Stk38l	serine/threonine kinase 38 like	D	–3.98
BB823350	Prkg2	protein kinase, cGMP-dependent, type II	D	–10.18
GTPase activator activity (GO:0005096)
BB034265	Rgs2	regulator of G-protein signaling 2	U	40.11
U72881	Rgs16	regulator of G-protein signaling 16	U	19.25
NM_009707	Arhgap6	Rho GTPase activating protein 6	U	11.78
AI851258	Centd3	centaurin, delta 3	U	124.57
BC010306	3110043J09Rik	RIKEN cDNA 3110043J09 gene	U	13.66
AK006398	Chn2	chimerin (chimaerin) 2	U	8.11
BB623455	Arhgap20	Rho GTPase activating protein 20	U	2.94
BG065709	Arhgap29	Rho GTPase activating protein 29	U	10.81
NM_019492	Rgs3	regulator of G-protein signaling 3	U	44.27
AU043488	Arhgap9	Rho GTPase activating protein 9	U	4.26
AF481964	Srgap3	SLIT-ROBO Rho GTPase activating protein 3	D	–35.07
NM_019958	Rgs17	regulator of G-protein signaling 17	D	–17.12
BB182934	Centd1	centaurin, delta 1	D	–2.17
Transcription factor activity [including sequence-specific DNA binding (GO:0043565)] (GO:0003700)
AK014111	Hhex	hematopoietically expressed homeobox	U	113.92
BI696369	Nrarp	Notch-regulated ankyrin repeat protein	U	279.80
NM_010714	Lhx9	LIM homeobox protein 9	U	25.94
AF326960	Tbx1	T-box 1	U	41.11
NM_011446	Sox7	SRY-box containing gene 7	U	347.29
NM_009236	Sox18	SRY-box containing gene 18	U	747.13
NM_008090	Gata2	GATA binding protein 2	U	5.89
AI467599	Crem	cAMP responsive element modulator	U	17.18
NM_057173	Lmo1	LIM domain only 1	U	25.67
BB433247	Etv4	ets variant gene 4 (E1A enhancer binding protein, E1AF)	U	7.15
BB375209	Ppp1r16b	protein phosphatase 1, regulatory (inhibitor) subunit 16B	U	59.76
BC019150	Hoxd9	homeo box D9	U	174.67
AA265122	Hoxd8	homeo box D8	U	205.23
NM_010468	Hoxd3	homeo box D3	U	7.89
J03770	Hoxd4	homeo box D3homeo box D4	U	10.76
BC013463	Hoxd10	homeo box D10	U	113.23
AA386586	Hoxb9	homeo box B9	U	11.21
BC016893	Hoxb6	homeo box B6	U	25.18
NM_008268	Hoxb5	homeo box B5	U	9.46
AB073079	Erg	avian erythroblastosis virus E-26 (v-ets) oncogene related	U	162.32
BG069095	Irf8	interferon regulatory factor 8	U	54.51
AF306667	Tbx20	T-box 20	U	18.06
NM_008026	Fli1	Friend leukemia integration 1	U	115.82
NM_010791	Meox1	mesenchyme homeobox 1	U	62.70
AK009674	Pou6f1	POU domain, class 6, transcription factor 1	D	–6.21
BB125261	Ebf1	early B-cell factor 1	D	–31.74
AV290079	Vdr	vitamin D receptor	D	–72.88
NM_030887	Jundm2	Jun dimerization protein 2	D	–3.78
AF343349	Gtf2ird1	general transcription factor II I repeat domain-containing 1	D	–2.37
AK019971	Prrx2	paired related homeobox 2	D	–188.43
BC017689	Tef	thyrotroph embryonic factor	D	–4.08
NM_008272	Hoxc9	homeo box C9	D	–48.17
BB283726	Hoxc8	homeo box C8	D	–124.69
AF193796	Hoxc13	homeo box C13	D	–12.87
Cytoskeletal protein binding (GO:0008092)
BG067753	Frmd4b	FERM domain containing 4B	U	44.06
BC005679	Sdc4	syndecan 4	D	–4.53
BB528350	Sdc3	syndecan 3	D	–3.86
NM_030880	Pacsin3	protein kinase C and casein kinase substrate in neurons 3	D	–4.50
AU021035	Sdc2	syndecan 2	D	–28.42
NM_013813	Epb4.1l3	erythrocyte protein band 4.1-like 3	D	–6.95
NM_013510	Epb4.1l1	erythrocyte protein band 4.1-like 1	D	–6.56
Quanyl-nucleotide exchange factor activity (GO:0005085)
AW536472	Rapgef5	Rap guanine nucleotide exchange factor (GEF) 5	U	187.94
NM_009059	Rgl2	ral guanine nucleotide dissociation stimulator-like2	U	5.77
AB043953	Sh2d3c	SH2 domain containing 3C	U	33.26
AK018008	Rapgef2	Rap guanine nucleotide exchange factor (GEF) 2	U	2.40
NM_011182	Pscd3	pleckstrin homology, Sec7 and coiled-coil domains 3	U	2.88
BB042252	Rasgrp3	RAS, guanyl releasing protein 3	U	81.82
BM120195	Fgd5	FYVE, RhoGEF and PH domain containing 5	U	176.55
NM_017402	Arhgef7	Rho guanine nucleotide exchange factor (GEF7)	U	12.49
BB360125	C030045D06Rik	DEP domain containing 2	U	34.58
BB656539	Dock4	dedicator of cytokinesis 4	U	30.88
BG069493	Rgnef	Rho-guanine nucleotide exchange factor	U	17.31
AV271771	Plekhg4	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	D	–6.98
AV321315	Arhgef19	Rho guanine nucleotide exchange factor (GEF) 19	D	–11.92
Lyase activity (GO:0016829)
NM_080435	Adcy4	adenylate cyclase 4	U	105.11
BF471959	Hmgcll1	3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1	U	26.45
S64539	Odc1	ornithine decarboxylase, structural 1	U	10.86
AJ245857	Car9	carbonic anhydrase 9	U	9.57
AF071068	Ddc	dopa decarboxylase	U	2.55
NM_009163	Sgpl1	sphingosine phosphate lyase 1	D	–2.85
BF303057	Cry2	cryptochrome 2 (photolyase-like) similar to mKIAA0658 protein	D	–2.93
NM_009624	Adcy9	adenylate cyclase 9	D	–8.23
C77434	Lss	lanosterol synthase	D	–13.25
NM_013509	Eno2	enolase 2, gamma neuronal	D	–18.94

U: upregulated; D: downregulated.

The study of actin filament-associated cytoskeletal gene products reveals higher expression of Arpc3, Spnb2, and Sntb2 and lower level of expression of Tpm2, Myh10, Vill, Gsn, and Sdc2 in PL1 stroma. These genes function in remodeling and communication of stroma cells with neighboring hematopoietic cells.

The study of kinase activity molecules shows that molecules of MAPK signaling pathway including Mapk12, Mapk9, Map3k3, and Map3k7 were highly activated in PL1 stroma.

Highly represented protein kinases in PL1 also included Tie1 (tyrosine kinase receptor 1; 160-fold), Tek (endothelial-specific receptor tyrosine kinase; 80-fold), Kdr (kinase insert domain protein receptor; 120-fold), and Flt4 (FMS-like tyrosine kinase 4; 91-fold). Tie1 and Tek (Tie2) are the members of the Tie family, which are endothelial cell-specific receptor tyrosine kinases critical to vascularization (46). Angiopoietins (Ang1–4) are Tie receptor ligands (50). Kdr (also termed VEGFR-2, Flk-1) and Flt-4 (also termed VEGFR-3) are related transmembrane receptor tyrosine kinases specifically expressed in endothelial cells that mediate vascular endothelial growth factors (VEGF) signal transduction, which is crucial in angiogenesis and vasculogenesis (26,46).

The study of transcription factors reveals the upregulation of Sox7 (SRY-box containing gene 7; 347-fold) and Sox18 (SRY-box containing gene 18; 747-fold), Hhex (hematopoietically expressed homeobox; 114-fold), Meox1 (mesenchyme homeobox 1; 63-fold), homeo box D (D9, D8, D3, D4, and D10), and homeo box B (B9, B6 and B5) in PL1 stroma and downregulation of homeo box C (C9, C8, and C13).

Sox7, Sox17, and Sox18 constitute group F of the Sox family of HMG box transcription factor genes. They are cooperatively involved in mammalian arterio-venous specification. Knockdown of the orthologs of Sox7 and Sox18 together in zebrafish causes severe vascular defects (9). And Sox18 mutation causes human disease hypotrichosis-lymphedema-telangiectasia, characterized by chronic swelling of the extremities due to dysfunction of the lymphatic vessels (24).

Homeobox genes are transcription factors that encode a highly conserved 61 amino acid DNA binding domain termed the homeodomain (18). They are essential for the development of the blood and lymphatic vascular systems. Belotti et al. demonstrated that the expression of 8 out of 10 HoxB cluster genes in human umbilical vein endothelial cells (HUVECs), suggesting their involvement in the generation of new blood vessels (5). Hox D3 has been shown to be abundantly expressed in active proliferating endothelial cells forming tubes in vitro (6). Hhex expression starts soon after that of VEGFR2 in the blood islands and can be used as an early marker for endothelial precursor cells (48). Hhex is required for hemangioblast differentiation into both endothelial and hematopoietic cells (20).

Upregulation of Emcn (endomucin; 2121-fold), Pecam1 (platelet/endothelial cell adhesion molecule 1; 1005-fold), Icam2 (intercellular adhesion molecule 2; 901-fold), Cdh5 (cadherin 5, CD144; 694-fold), Esam1 (endothelial cell-specific adhesion molecule; 656-fold), Prom1 (prominin 1, CD133; 409-fold), Cd34 (CD34 antigen; 11-fold), and Sele (selectin, endothelial cell; 63fold) in stroma PL1 was also observed (Fig. 8).

Figure 8.

Hierarchical clustering of genes up- and downregulated in stroma cell clones PL1 and BM1. Each column corresponds to a stroma cell sample from PL1 P5, PL1 P13, PL1 P27, BM1 P5, BM1 P9, BM1 P11, and AFT024, respectively. Each row represents a gene. Color scale indicates the normalized intensity values. Gene clusters are shown at left side. BM: bone marrow; PL: placenta; P: passage.

Endomucin is an early endothelial-specific antigen. During in vitro differentiation of embryonic stem cells to endothelial cells, endomucin is expressed at day 6 after onset of differentiation, 1 day later than PECAM-1 (7). Platelet endothelial cell adhesion molecule-1 (PECAM-1 or CD31), Icam2, Cdh5, and Esam1 are endothelial cell junctional molecules (13). CD133 and CD34 are both progenitor/stem cells markers expressed in hematopoietic lineage and endothelial lineage (39).

On the other hand, BM1 preferentially expressed genes specific for mesenchymal cells, which includes Endosialin (TEM1, CD248; 28-fold), Serpinf1 (740fold), Fgf7 (649-fold), and Col1a1 (collagen, type I, alpha 1; 342-fold) (Fig. 8).

Endosialin (TEM1, CD248) is a marker of stromal fibroblasts (31), interacting with extracellular matrix proteins mediating cell adhesion and migration.

Sarojini et al. (43) have reported a mesenchymal stem cell line from adult mouse bone marrow could secrete pigment epithelium-derived factor (PEDF, Serpin-F1), a member of the serpin protease inhibitor family. Quan et al. (40) have shown PEDF was expressed by osteoblasts lining the bone spicules in the ossification zone of metaphyseal bone, as well as by osteoblasts lining cortical periosteum.

Col1a1 (collagen, type I, alpha 1) has been a well-known marker of osteoblastic differentiation (27).

Several previous studies have shown that osteoblasts play an important function in adult BM niche (8,59,61). In vitro study of human BM mesenchymal stem cells also showed that hematopoiesis-supportive clones are associated with high osteogenic potential (17).

Fibroblast growth factor-7 (FGF-7, keratinocyte growth factor, KGF) is a 163-amino acid glycoprotein synthesized and secreted by mesenchymal cells (e.g., fibroblasts/fibrocytes) in epithelial organs, functioning as a paracrine mediator of epithelial cell proliferation (16).

We searched KEGG and Biocarta databases and PubMed manually using GeneGo (GeneGo, Inc., St. Joseph, MI), and came up with a group of genes specifically or preferentially expressed in endothelial cells or mesenchymal cells. This supervised hierarchical clustering (Fig. 8) showed significant similarity in gene expression profiles between BM1 and AFT024. And the profiles are distinct from that of PL1.

Validation of the microarray results was performed by semiquantitative RT-PCR on 12 selected genes. In accordance with microarray analysis, eight genes associated with endothelial differentiation (Sox18, Sox7, Esam, Pecam1, Prom1, Tek, Tie1, Emcn) showed higher expression in PL1 than BM1, whereas four genes (Fgf7, Col6a2, Col1a1, Serpinf1) were downregulated (Fig. 9). We also compared the three hematopoietic supportive stromal lines (PL1, PL2, and PL3), which were established from midgestation placenta by semiquantitative RT-PCR. We demonstrated the expression of genes associated with endothelial differentiation (Esam, Tie1, and Prom1) in all three placental lines. In addition, other genes that were expressed in PL1, including Fgf7 and Col6a2, were expressed in both PL2 and PL3 (data not shown).

Figure 9.

Confirmation of microarray analysis of selected genes by semiquantitative RT-PCR. Equal amount of first-strand cDNA product was used in each reaction. GAPDH gene was used as a housekeeping gene to show equal amplification in all stroma clones. The images showed the amplification products on a 1.5% agarose gel after 35 cycles.

Discussion

The self-renewal potential of HSCs is considered an intrinsic property that is controlled at least in part by the stromal niche. However, during normal homeostasis the main function of HSCs is the production of mature functional blood cells. In contrast, during embryogenesis and fetal development there is a need for expansion of HSC numbers. This led us to propose that the stromal cells derived from hematopoietic tissue at different developmental stages would differ in their ability to support proliferation and differentiation of HSCs. Stromal cells from adult tissue (e.g., the BM) would preferentially support the maintenance and differentiation of HSCs, while stromal cells from fetal tissue would preferentially support proliferation of HSCs. Previously, we have showed that mesenchymal stem cells (MSC) from human umbilical cord blood were capable of supporting ex vivo expansion of hematopoietic stem/progenitor cells (23). In this present study, we have isolated stromal cell lines from fetal hematopoietic organs, namely AGM, PL, FL, and adult BM, and studied their supportive property in ex vivo hematopoiesis.

Our data demonstrate higher levels of support of ex vivo expansion of hematopoietic progenitor cells by placental stromal cells than BM stromal cells or AFT024. BM c-Kit⁺Sca-1⁺ cells cultured on PL stroma resulted in higher levels of CFU-GM and HPP-CFC and cytospins demonstrated a significantly higher number of blast-like cells compared to culture on BM stroma. Phenotypically, the PL1 stromal cells were similar to BM1 stromal cells expressing CD105 but not CD45; however, the PL1 stromal cells also expressed CD34 and CD49d.

Genes associated with endothelial differentiation were expressed at high levels in PL1 stroma, suggesting that it is indeed mainly composed of endothelial cells, a phenotype distinct from that previously described stromal cell lines from other fetal origins, like AGM or FL (45,55,57). This is consistent with the role of the placenta, which permits the exchange of oxygen and nutrients between the developing embryo and the mother, and is a highly vascularized tissue (42). During mammalian development, hematopoietic and endothelial cells are derived from a common progenitor of mesodermal origin: the hemogenic endothelial cells or hemangioblasts (10). In the mouse embryo, emergence of HSCs is closely associated with vascular endothelial cells. This associated development of the vascular and hematopoietic systems is a well-recognized feature shared by embryonic hematopoietic sites, including the AGM, yolk sac, and FL. Recently, Runx1 (runt-related transcription factor 1/acute myeloid leukemia 1 [AML1])-positive hemangiogenic endothelial cells have been shown to give rise to HSCs in the placenta labyrinth (19,38). By tracking developing HSCs by the expression of Runx1-lacZ and CD41, Rhodes et al. (41) also found that HSCs emerge in the mouse placental vasculature, independent of blood flow. Studies of human placenta by Barcena et al. (4) showed that cells coexpressing CD34 and CD45 reside either near placenta blood vessels or within the mesenchymal compartment of the villous cores, in close contact with endothelial CD34⁺CD45^- cells or vimentin-positive mesenchymal cells. Because HSCs form clusters on endothelial cells during embryonic hematopoiesis, ligand–receptor signaling may occur between HSCs and endothelial cells (2).

Previously, endothelial cells from yolk sac (30,58) have been used for expansion of haematopoietic progenitors or stem cells. In addition, endothelial cells from human brain have been shown to expand the SCID-repopulating cells in human cord blood (11). There is no consensus as to what cell type represents the hematopoietic niche. The BM stromal cells have been identified as a heterogeneous population of cells of mesenchymal origin that include reticular endothelial cells, fibroblasts, chondrocytes, adipocytes, and osteogenic precursor cells, which provide growth factors, cell–cell interactions, and matrix proteins (53). Osteoblasts have been shown to play an important function in this niche, mainly keeping HSCs in a quiescent state (8,59,61).

Using the microarray technology, we also examine the gene expression profile of AFT024, a stroma cell line that has been extensively studied in its hematopoiesis-supportive property and its molecular profile. Our data were compared to the Stromal Cell Database (StroCDB; stromalcell.princeton.edu) (21) and showed very good agreement. Interestingly, we found the gene expression of AFT024 related more closely to BM1 than PL1 by hierarchical clustering. This confirmed that PL1 represent a unique component of the placenta microenvironment that provides favorable support for the most primitive HSCs.

In summary, our present study suggests that the stroma cell line PL1 from mouse midgestation placenta provides distinct support for ex vivo hematopoiesis compared to stroma from adult BM. PL1 provided superior support for the primitive population indicated by more CFU-GM and HPP-CFC colony formation. Genes associated with endothelial differentiation were expressed at high levels in PL1 stroma, suggesting that it is mainly composed of endothelial cells. These studies underscore our hypothesis that midgestation placenta provides a different microenvironment for hematopoiesis from adult BM, and vascular endothelial cells are major components of this supportive niche. Unlike the adult BM HSC niche, which may impose a restriction signal for HSC proliferation (2), the placenta niche seems to promote rapid expansion of the most primitive hematopoietic cells. Therefore, together with the AGM region, the midgestation placenta niche constitutes an important site for early fetal hematopoiesis (1,19). For practical purpose, midgestation placenta stroma could be used in the ex vivo strategy to expand HSCs, whereby the expansion would favor cell proliferation over cell differentiation (29).

References

Alvarez-Silva

; Belo-Diabangouaya

; Salaun

; Dieterlen-Lievre

Mouse placenta is a major hematopoietic organ.

Development 130(22): 5437–5444; 2003.

Arai

; Suda

Maintenance of quiescent hematopoietic stem cells in the osteoblastic niche.

Ann. NY Acad. Sci. 1106: 41–53; 2007.

Ashburner

; Ball

C. A.

; Blake

J. A.

; Botstein

; Butler

; Cherry

J. M.

; Davis

A. P.

; Dolinski

; Dwight

S. S.

; Eppig

J. T.

; Harris

M. A.

; Hill

D. P.

; Issel-Tarver

; Kasarskis

; Lewis

; Matese

J. C.

; Richardson

J. E.

; Ringwald

; Rubin

G. M.

; Sherlock

Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium.

Nat. Genet. 25(1): 25–29; 2000.

Barcena

; Muench

M. O.

; Kapidzic

; Fisher

S. J.

A new role for the human placenta as a hematopoietic site throughout gestation.

Reprod. Sci. 16(2): 178–187; 2009.

Belotti

; Clausse

; Flagiello

; Alami

; Daukandt

; Deroanne

; Malfoy

; Boncinelli

; Faiella

; Castronovo

Expression and modulation of homeobox genes from cluster B in endothelial cells.

Lab. Invest. 78(10): 1291–1299; 1998.

Boudreau

; Andrews

; Srebrow

; Ravanpay

; Cheresh

D. A.

Induction of the angiogenic phenotype by Hox D3.

J. Cell Biol. 139(1): 257–264; 1997.

Brachtendorf

; Kuhn

; Samulowitz

; Knorr

; Gustafsson

; Potocnik

A. J.

; Fassler

; Vestweber

Early expression of endomucin on endothelium of the mouse embryo and on putative hematopoietic clusters in the dorsal aorta.

Dev. Dyn. 222(3): 410–419; 2001.

Calvi

L. M.

; Adams

G. B.

; Weibrecht

K. W.

; Weber

J. M.

; Olson

D. P.

; Knight

M. C.

; Martin

R. P.

; Schipani

; Divieti

; Bringhurst

F. R.

; Milner

L. A.

; Kronenberg

H. M.

; Scadden

D. T.

Osteoblastic cells regulate the haematopoietic stem cell niche.

Nature 425(6960): 841–846; 2003.

Cermenati

; Moleri

; Cimbro

; Corti

; Del Giacco

; Amodeo

; Dejana

; Koopman

; Cotelli

; Beltrame

Sox18 and Sox7 play redundant roles in vascular development.

Blood 111(5): 2657–2666; 2008.

10.

Choi

; Kennedy

; Kazarov

; Papadimitriou

J. C.

; Keller

A common precursor for hematopoietic and endothelial cells.

Development 125(4): 725–732; 1998.

11.

Chute

J. P.

; Muramoto

; Fung

; Oxford

Quantitative analysis demonstrates expansion of SCID-repopulating cells and increased engraftment capacity in human cord blood following ex vivo culture with human brain endothelial cells.

Stem Cells 22(2): 202–215; 2004.

12.

Collins

L. S.

; Dorshkind

A stromal cell line from myeloid long-term bone marrow cultures can support myelopoiesis and B lymphopoiesis.

J. Immunol. 138(4): 1082–1087; 1987.

13.

Dejana

Endothelial cell–cell junctions: Happy together.

Nat. Rev. Mol. Cell Biol. 5(4): 261–270; 2004.

14.

Draghici

; Khatri

; Martins

R. P.

; Ostermeier

G. C.

; Krawetz

S. A.

Global functional profiling of gene expression.

Genomics 81(2): 98–104; 2003.

15.

Dzierzak

Ontogenic emergence of definitive hematopoietic stem cells.

Curr. Opin. Hematol. 10(3): 229–234; 2003.

16.

Finch

P. W.

; Cunha

G. R.

; Rubin

J. S.

; Wong

; Ron

Pattern of keratinocyte growth factor and keratinocyte growth factor receptor expression during mouse fetal development suggests a role in mediating morphogenetic mesenchymal–epithelial interactions.

Dev. Dyn. 203(2): 223–240; 1995.

17.

Fujita

; Toguchida

; Morita

; Iwata

Clonal analysis of hematopoiesis-supporting activity of human mesenchymal stem cells in association with Jagged1 expression and osteogenic potential.

Cell Transplant. 17(10-11): 1169–1179; 2008.

18.

Gehring

W. J.

; Qian

Y. Q.

; Billeter

; Furukubo-Tokunaga

; Schier

A. F.

; Resendez-Perez

; Affolter

; Otting

; Wuthrich

Homeodomain–DNA recognition.

Cell 78(2): 211–223; 1994.

19.

Gekas

; Dieterlen-Lievre

; Orkin

S. H.

; Mikkola

H. K.

The placenta is a niche for hematopoietic stem cells.

Dev. Cell 8(3): 365–375; 2005.

20.

Guo

; Chan

; Ramsey

; Li

; Xie

; Shelley

W. C.

; Martinez-Barbera

J. P.

; Bort

; Zaret

; Yoder

; Hromas

The homeoprotein Hex is required for hemangioblast differentiation.

Blood 102(7): 2428–2435; 2003.

21.

Hackney

J. A.

; Charbord

; Brunk

B. P.

; Stoeckert

C. J.

; Lemischka

I. R.

; Moore

K. A.

A molecular profile of a hematopoietic stem cell niche.

Proc. Natl. Acad. Sci. USA 99(20): 13061–13066; 2002.

22.

Heissig

; Ohki

; Sato

; Rafii

; Werb

; Hattori

A role for niches in hematopoietic cell development.

Hematology 10(3): 247–253; 2005.

23.

Huang

G. P.

; Pan

Z. J.

; Jia

B. B.

; Zheng

; Xie

C. G.

; Gu

J. H.

; McNiece

I. K.

; Wang

J. F.

Ex vivo expansion and transplantation of hematopoietic stem/progenitor cells supported by mesenchymal stem cells from human umbilical cord blood.

Cell Transplant. 16(6): 579–585; 2007.

24.

Irrthum

; Devriendt

; Chitayat

; Matthijs

; Glade

; Steijlen

P. M.

; Fryns

J. P.

; Van Steensel

M. A.

; Vikkula

Mutations in the transcription factor gene SOX18 underlie recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia.

Am. J. Hum. Genet. 72(6): 1470–1478; 2003.

25.

Johnson

G. R.

; Moore

M. A.

Role of stem cell migration in initiation of mouse foetal liver haemopoiesis.

Nature 258(5537): 726–728; 1975.

26.

Joukov

; Pajusola

; Kaipainen

; Chilov

; Lahtinen

; Kukk

; Saksela

; Kalkkinen

; Alitalo

A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases.

EMBO J. 15(2): 290–298; 1996.

27.

Kalajzic

; Staal

; Yang

W. P.

; Wu

; Johnson

S. E.

; Feyen

J. H.

; Krueger

; Maye

; Yu

; Zhao

; Kuo

; Gupta

R. R.

; Achenie

L. E.

; Wang

H. W.

; Shin

D. G.

; Rowe

D. W.

Expression profile of osteoblast lineage at defined stages of differentiation.

J. Biol. Chem. 280(26): 24618–24626; 2005.

28.

Khatri

; Draghici

; Ostermeier

G. C.

; Krawetz

S. A.

Profiling gene expression using onto-express.

Genomics 79(2): 266–270; 2002.

29.

Koestenbauer

; Zisch

; Dohr

; Zech

N. H.

Protocols for hematopoietic stem cell expansion from umbilical cord blood.

Cell Transplant. 18(10): 1059–1068; 2009.

30.

; Johnson

S. A.

; Shelley

W. C.

; Ferkowicz

; Morrison

; Li

; Yoder

M. C.

Primary endothelial cells isolated from the yolk sac and para-aortic splanchnopleura support the expansion of adult marrow stem cells in vitro.

Blood 102(13): 4345–4353; 2003.

31.

MacFadyen

J. R.

; Haworth

; Roberston

; Hardie

; Webster

M. T.

; Morris

H. R.

; Panico

; Sutton-Smith

; Dell

; van der Geer

; Wienke

; Buckley

C. D.

; Isacke

C. M.

Endosialin (TEM1, CD248) is a marker of stromal fibroblasts and is not selectively expressed on tumour endothelium.

FEBS Lett. 579(12): 2569–2575; 2005.

32.

McNiece

I. K.

; Robinson

B. E.

; Quesenberry

P. J.

Stimulation of murine colony-forming cells with high proliferative potential by the combination of GM-CSF and CSF-1.

Blood 72(1): 191–195; 1988.

33.

Medvinsky

; Dzierzak

Definitive hematopoiesis is autonomously initiated by the AGM region.

Cell 86(6): 897–906; 1996.

34.

Mikkola

H. K.

; Gekas

; Orkin

S. H.

; Dieterlen-Lievre

Placenta as a site for hematopoietic stem cell development.

Exp. Hematol. 33(9): 1048–1054; 2005.

35.

Mikkola

H. K.

; Orkin

S. H.

The journey of developing hematopoietic stem cells.

Development 133(19): 3733–3744; 2006.

36.

Moore

K. A.

; Ema

; Lemischka

I. R.

In vitro maintenance of highly purified, transplantable hematopoietic stem cells.

Blood 89(12): 4337–4347; 1997.

37.

Moore

M. A.

; Metcalf

Ontogeny of the haemopoietic system: Yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo.

Br. J. Haematol. 18(3): 279–296; 1970.

38.

Ottersbach

; Dzierzak

The murine placenta contains hematopoietic stem cells within the vascular labyrinth region.

Dev. Cell 8(3): 377–387; 2005.

39.

Peichev

; Naiyer

A. J.

; Pereira

; Zhu

; Lane

W. J.

; Williams

; Oz

M. C.

; Hicklin

D. J.

; Witte

; Moore

M. A.

; Rafii

Expression of VEGFR-2 and AC133 by circulating human CD34(+) cells identifies a population of functional endothelial precursors.

Blood 95(3): 952–958; 2000.

40.

Quan

G. M.

; Ojaimi

; Li

; Kartsogiannis

; Zhou

; Choong

P. F.

Localization of pigment epithelium-derived factor in growing mouse bone.

Calcif. Tissue Int. 76(2): 146–153; 2005.

41.

Rhodes

K. E.

; Gekas

; Wang

; Lux

C. T.

; Francis

C. S.

; Chan

D. N.

; Conway

; Orkin

S. H.

; Yoder

M. C.

; Mikkola

H. K.

The emergence of hematopoietic stem cells is initiated in the placental vasculature in the absence of circulation.

Cell Stem Cell 2(3): 252–263; 2008.

42.

Rossant

; Cross

J. C.

Placental development: Lessons from mouse mutants.

Nat. Rev. Genet. 2(7): 538–548; 2001.

43.

Sarojini

; Estrada

; Lu

; Dekova

; Lee

M. J.

; Gray

R. D.

; Wang

PEDF from mouse mesenchymal stem cell secretome attracts fibroblasts.

J. Cell. Biochem. 104(5): 1793–1802; 2008.

44.

Suzuki

; Fujita

; Taniguchi

; Sugimoto

; Mori

K. J.

Characterization of murine hemopoietic-supportive (MS-1 and MS-5) and non-supportive (MS-K) cell lines.

Leukemia 6(5): 452–458; 1992.

45.

Takeuchi

; Sekiguchi

; Hara

; Kinoshita

; Miyajima

Cultivation of aorta-gonad-mesonephros-derived hematopoietic stem cells in the fetal liver microenvironment amplifies long-term repopulating activity and enhances engraftment to the bone marrow.

Blood 99(4): 1190–1196; 2002.

46.

Tallquist

M. D.

; Soriano

; Klinghoffer

R. A.

Growth factor signaling pathways in vascular development.

Oncogene 18(55): 7917–7932; 1999.

47.

Testa

N. G.

; Molineaux

Hemopoiesis: A practical approach. New York: Oxford University Press; 1993.

48.

Thomas

P. Q.

; Brown

; Beddington

R. S.

Hex: A homeobox gene revealing peri-implantation asymmetry in the mouse embryo and an early transient marker of endothelial cell precursors.

Development 125(1): 85–94; 1998.

49.

Tsuji

; Ogasawara

; Aoki

; Tsurumaki

; Kodama

Characterization of murine stromal cell clones established from bone marrow and spleen.

Leukemia 10(5): 803–812; 1996.

50.

Valenzuela

D. M.

; Griffiths

J. A.

; Rojas

; Aldrich

T. H.

; Jones

P. F.

; Zhou

; McClain

; Copeland

N. G.

; Gilbert

D. J.

; Jenkins

N. A.

; Huang

; Papadopoulos

; Maisonpierre

P. C.

; Davis

; Yancopoulos

G. D.

Angiopoietins 3 and 4: Diverging gene counterparts in mice and humans.

Proc. Natl. Acad. Sci. USA 96(5): 1904–1909; 1999.

51.

Wang

; Huso

D. L.

; Harrington

; Kellner

; Jeong

D. K.

; Turney

; McNiece

I. K.

Outgrowth of a transformed cell population derived from normal human BM mesenchymal stem cell culture.

Cytotherapy 7(6): 509–519; 2005.

52.

Weisel

K. C.

; Gao

; Shieh

J. H.

; Moore

M. A.

Stromal cell lines from the aorta-gonado-mesonephros region are potent supporters of murine and human hematopoiesis.

Exp. Hematol. 34(11): 1505–1516; 2006.

53.

Weiss

The hematopoietic microenvironment of the bone marrow: An ultrastructural study of the stroma in rats.

Anat. Rec. 186(2): 161–184; 1976.

54.

Wilson

; Trumpp

Bone-marrow haematopoietic-stem-cell niches.

Nat. Rev. Immunol. 6(2): 93–106; 2006.

55.

Wineman

; Moore

; Lemischka

; Muller-Sieburg

Functional heterogeneity of the hematopoietic microenvironment: Rare stromal elements maintain long-term repopulating stem cells.

Blood 87(10): 4082–4090; 1996.

56.

Wolf

N. S.

The haemopoietic microenvironment.

Clin. Haematol. 8(2): 469–500; 1979.

57.

M. J.

; Tsuji

; Ueda

; Mukouyama

Y. S.

; Hara

; Yang

F. C.

; Ebihara

; Matsuoka

; Manabe

; Kikuchi

; Ito

; Miyajima

; Nakahata

Stimulation of mouse and human primitive hematopoiesis by murine embryonic aorta-gonad-mesonephros-derived stromal cell lines.

Blood 92(6): 2032–2040; 1998.

58.

Yoder

M. C.

; Papaioannou

V. E.

; Breitfeld

P. P.

; Williams

D. A.

Murine yolk sac endoderm- and mesoderm-derived cell lines support in vitro growth and differentiation of hematopoietic cells.

Blood 83(9): 2436–2443; 1994.

59.

Zhang

; Niu

; Ye

; Huang

; He

; Tong

W. G.

; Ross

; Haug

; Johnson

; Feng

J. Q.

; Harris

; Wiedemann

L. M.

; Mishina

; Li

Identification of the haematopoietic stem cell niche and control of the niche size.

Nature 425(6960): 836–841; 2003.

60.

Zhang

; Li

; Jiang

; Zhang

; Wu

; Liu

; Tang

; Mao

Human placenta-derived mesenchymal progenitor cells support culture expansion of long-term culture-initiating cells from cord blood CD34+ cells.

Exp. Hematol. 32(7): 657–664; 2004.

61.

Zhu

; Emerson

S. G.

A new bone to pick: Osteoblasts and the haematopoietic stem-cell niche.

Bioessays 26(6): 595–599; 2004.

Differential Hematopoietic Supportive Potential and Gene Expression of Stroma Cell Lines from Midgestation Mouse Placenta and Adult Bone Marrow

Abstract

Keywords

Introduction

Materials and Methods

Embryo Generation

Establishment of Murine Stromal Cell Lines and Culture Conditions

Hematopoietic Stem/Progenitor Cell Purification

Coculture of Hematopoietic Stem/Progenitor Cells with Stromal Cells

In Vitro Hematopoietic Progenitor Cell Assay

FACS Analysis

Statistical Analysis

Total RNA Extraction and Quality/Quantity Control

Probe Preparation, Microarray Hybridization, and Data Analysis

Semiquantitative RT-PCR

Results

Establishment of Stromal Cell Lines

Coculture of Mouse BM c-Kit+Sca-1+ Cells on Stromal Cells: “Cobblestone Area” (CA) Formation

Total Nucleated Cell (TNC) Expansion

Progenitor Cell Expansion

Surface Marker Expression

Gene Expression Profile of PL1 Stroma

Discussion

References

Coculture of Mouse BM c-Kit⁺Sca-1⁺ Cells on Stromal Cells: “Cobblestone Area” (CA) Formation