Sage Journals: Discover world-class research

Abstract

BACKGROUND:

Long non-coding RNAs have drawn increasing research interest in cancer biology. This study aims to investigate the function roles and the underlying mechanism of HnRNPU-AS1 in Hepatocellular carcinoma (HCC).

METHODS:

qRT-PCR was performed to detect the expression levels of HnRNPU-AS1, miR-556-3p, miR-580-3p in HCC tissues and cell lines. Western blot was used to determine protein levels of LC3-II, LC3-I, Beclin-1, P62, and SOCS6. Functional assays including CCK8 assay, colony formation assay, wound healing assay, Transwell assay were performed to evaluate the role of HnRNPU-AS1 in regulating the malignant phenotype of HCC cells. Dual luciferase reporter assay and RNA pull-down experiment were used to examined the RNA-RNA interaction.

RESULTS:

HnRNPU-AS1 expression was decreased in HCC tissues and cell lines, which was associated with poor prognosis in HCC patients. Overexpression of HnRNPU-AS1 could inhibit the proliferation, migration, invasion but promote autophagy in HCC cells. Two miRNAs (miR-556-3p and miR-580-3p) were identified as potential targets of HnRNPU-AS1 in lncBASE database, which were significantly upregulated in HCC tissues and cell lines. Cell experiments demonstrated the effects of HnRNPU-AS1 overexpression could be attenuated by miR-556-3p or miR-580-3p overexpression. We further revealed that SOX6 was the downstream target of HnRNPU-AS1/miR-556-3p or miR-580-3p axis. Xenograft mouse model validated the tumor-suppressor role of HnRNPU-AS1 overexpression in vivo.

CONCLUSIONS:

This study demonstrated the tumor suppressor function of HnRNPU-AS1 in HCC and identified the downstream molecules underlying its tumor suppressor function. Our results suggest that HnRNPU-AS1 suppresses HCC by targeting miR-556-3p and miR-580-3p/SOXS6 axis.

Keywords

Hepatocellular carcinoma (HCC)HnRNPU-AS1 miR-556-3p miR-580-3p SOXS6 autophagy

1. Introduction

Primary liver cancer is the sixth most common malignancy in the world [1]. Hepatocellular carcinoma (HCC) is the most prevalent pathological type, which accounts for 75% $\sim$ 85% primary liver cancer and remains as one of the malignant tumors with high mortality [2]. A wide range of risk factors are associated with the incidence of HCC, such as hepatitis B virus infection [3], hepatitis C virus infection [4], liver cirrhosis [5], alcohol abuse [6], obesity [7], diabetes [8], aflatoxin [9]. The development and progression of HCC is a complicated process during which many genes become mutated or dysregulated [10]. Current treatments for HCC, including surgical resection, radiotherapy, chemotherapy and carotid artery embolization chemotherapy [11, 12], fail to eradicate cancer cells and two-thirds of HCC patients suffer from tumor recurrence [13]. Besides, the delayed diagnosis of HCC at advanced stage also compromises the efficacy of treatment [14]. Therefore, the identification of new biomarkers is crucial for early diagnosis and the development of more effective therapeutic strategies.

Long non-coding RNAs (lncRNAs) are a class of non-coding RNAs with a length of more than 200 nucleotides [15]. Although lncRNAs do not encode proteins, they are implicated in a myriad of cellular processes including cell proliferation, cell metabolism, apoptosis, and cell differentiation [16]. Recent studies have revealed that a variety of lncRNAs are dysregulated and implicated in the progression of HCC. For instance, Zhao et al. demonstrated that LINC00174 could promote the cell proliferation of HCC cell lines by regulating miR-320/S100A10 axis [17]. Additionally, lncRNA MCM3AP-AS1 acts as an oncogenic factor to facilitate HCC growth by sponging miR-194-5p and maintaining the high expression of FOXA1 [18]. HnRNPU-AS1 is reported to be down-regulated in cervical cancer and it regulates cell proliferation and apoptosis [19]. Its potential functional role of HnRNPU-AS1 in HCC remains to be elucidated.

Suppressor of cytokine signaling 6 (SOCS6) has been reported as a tumor-suppressor in different cancers. For example, SOCS6 promotes the radio-sensitivity and decreases cancer cell stemness in esophageal squamous cell [20], and it can induce apoptosis and inhibit angiogenesis in prostate cancer [21]. Interestingly, SOCS6-CUL5 protein complex can regulate mTORC2 activity, and the knockout of SOCS6 gene in human pancreatic carcinoma cell lines PANC1 and BXPC3 impairs chaperon-mediated autophagy [22]. Since the functional role of SOCS6 in the progression of HCC is unclear, we attempted to investigate whether SOCS6 could modulate autophagy in HCC.

In our study, we first demonstrated the downregulation of HnRNPU-AS1 in HCC tissues and cell lines, which was associated with poor prognosis in HCC patients. HnRNPU-AS1 overexpression could suppress the malignant phenotype of HCC cells. Two miRNAs (miR-556-3p and miR-580-3p) were identified as downstream interactors of HnRNPU-AS1, which were upregulated in HCC tissues and cell lines. miR-556-3p and miR-580-3p overexpression attenuated the effects of HnRNPU-AS1 overexpression by targeting SOX6. We also found that the downregulation of HnRNPU-AS1 and SOCS6 in HCC impairs autophagy induction. Collectively, our results suggest that HnRNPU-AS1 suppresses HCC by targeting miR-556-3p/miR-580-3p/SOXS6 axis.

2. Materials and methods

2.1 Human samples

Tumor and para-tumor tissues were collected from 86 HCC patients at the Second Affiliated Hospital of Xi ’An Jiaotong University. All tissues were snap-frozen immediately in liquid nitrogen and stored at $-$ 80 ${{}^{\circ}}$ C. The study using human samples was approved by the ethics committee of the Second Affiliated Hospital of Xi’an Jiaotong University. All patients enrolled in the study signed the informed consent.

2.2 Cell culture

Four Human HCC cell lines (Huh7, HepG2, HCCLM3 and Hep3B) and one normal liver cell line (L02) were obtained from the Chinese Academy of Sciences (Beijing, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) with 10% fetal bovine serum (FBS; Gibco, USA), 100 U/ml penicillin (Gibco, USA) and 100 $\mu$ g/ml streptomycin (Gibco, USA). Cells were cultured in a humidified incubator with 5% CO ${}_{2}$ at 37 ${}^{\circ}$ C.

2.3 qRT-PCR

TRIzol ${}^{\text{TM}}$ Plus RNA Purification Kit (Thermo Fisher Scientific, 12183555, Waltham, MA, USA) was used to extract RNA from tissues and cells according to the instructions. For nucleoplasm fraction experiment, the nuclear and cytoplasmic faction was extracted using NE-PER ${}^{\text{TM}}$ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, 78833). The extracted total RNA was dissolved in DEPC water and its concentration was measured with NanoDrop spectrophotometer. 1 $\mu$ g of total RNA was used for reverse-transcription into cDNA using PrimeScript ${}^{\text{TM}}$ RT Reagent Kit (Takara Biotechnology RR037B, Dalian, China) or TaqMan ${}^{\text{TM}}$ MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, 4366596). The cDNA was analyzed in a Bio-Rad CFX96 system (BioRad, Irvine, CA, USA) using SYBR premix EX TAQ II kit (Takara Biotechnology RR820A, Dalian, China). The following PCR cycling condition were used: 95 ${}^{\circ}$ C 5 mins, 40 cycles of 95 ${}^{\circ}$ C 30 sec, 60 ${}^{\circ}$ C 30 sec and 72 ${}^{\circ}$ C 60 sec. The 2 $-\Delta\Delta$ Ct method was used to analyze the relative gene expression level, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 were used as the internal reference gene. All primer sequences were synthesized and purchased from Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). The primer sequences were listed below:

GAPDH: F: GTCTCCTCTGACTTCAACAGCG; R: ACCACCCTGTTGCTGTAGCCAA. U6: F: CTCGCTTCGGCAGCACA; R: AACGCTTCACGAATTTGCGT. HNRNPU-AS1: F: GAGATTGCTGCCCGAAAGAAGC; R: TTCGCTGGAAGCCTGCAAACAG. hsa-miR-556-3p: F: GCGCAGATATTACCATTAGCTC; R: GGTCCAGTTTTTTTTTTTTTTTAAGATG. hsa-miR-580-3p: F: GCAGAAAAGTAATTGCGGTCT; R: GGTCCAGTTTTTTTTTTTTTTTACCA. Beclin-1: F: GGTGTCTCTCGCAGATTCATC; R: TCAGTCTTCGGCTGAGGTTCT. P62: F: GACTACGACTTGTGTAGCGTC; R: AGTGTCCGTGTTTCACCTTCC. SOCS6: F: ATCACGGAGCTATTGTCTGGA; R: CTGACTCTCATCCTCGGGGA.

2.4 Cell transfection

HnRNPU-AS1 overexpression vector, the empty pcDNA3.1, miR-566-3p mimic, miR-566-3p inhibitor, miR-580-3p mimic, miR-580-3p inhibitor, microRNA control (miR-NC), control for inhibitor (NC-inhibitor), control for siRNA (si-NC) and siRNA for SOCS6 (si-SOCS6) were purchased from GenePharma Co. Ltd. (Shanghai, China). Cell transfection was performed using Lipofectamine ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ 3000 reagent (Thermo Fisher Scientific, L3000001). In 6 well plate, 60% confluent cells were transfected with 200 nM of microRNA mimic/inhibitor, 100 nM of siRNA or 6 ug of plasmid according to manufacturer’s instruction. Transfected cells were subjected to subsequent analysis 48 hours post-transfection.

2.5 CCK-8 cell proliferation assay

Cells were transfected with indicated molecules for 48 hours. Transfected ells were seeded in to a 96-well plate at a density of 1500 cell/well and cultured in a humidified cell culture incubator for 0, 24, 48, 72 and 96 hours, respectively. Subsequently, 10 $\mu$ l CCK8 reaction solution (Solarbio, CA1210, Beijing, China) was added to the cell culture at indicated time point and incubated for 1 hour in a humidified cell culture incubator. The light absorption value (OD value) in each condition was captured at 450 nm wavelength on a Synergy H1 microplate reader (Winooski, Vermont, USA).

2.6 Colony formation assay

Cells with indicated treatment were trypsinized and resuspended in culture medium. Cells were seeded into a 6-well plate (2000 cells/well) and the culture medium was changed every 3 days. After 14 days, cells were fixed with 4% paraformaldehyde at room temperature for 10 mins and stained with 0.5% crystal violet (Beyotime, Shanghai, China) for 20 mins. Subsequently, the number of colonies was counted and the morphology of the colonies was photographed under Leica AM6000 microscope (Leica, Wetzlar, Germany).

2.7 Wound healing assay

Cells were seeded in 6 well plates to reach about 80% confluence. A scratch wound was created using a sterile 200 $\mu$ l pipette tip in the central region of each well. The cells were incubated at 37 $\circ$ C for 24 h. Cell images were captured using an inverted light microscope (Leica AM6000 microscope). The migration distance was analyzed is using ImageJ software. The migration rate is calculated as ratio of would distance at 24 h/would distance at 0 h.

2.8 Transwell invasion assay

The transwell invasion experiment was carried out using transwell upper chamber (Corning, NY, USA, # 3421, pore size 5.0 $\mu$ m) coated with Matrigel (BD Biosciences, Bedford, MA, USA, # 356234). 5 $\times$ 10 ${}^{5}$ cells were seeded into the transwell upper chamber in serum-free medium and 1000 $\mu$ L of 10% serum-containing medium was added to the lower chamber. After 24 hours, culture medium was discarded. The cells on the membrane were fixed with 4% paraformaldehyde at room temperature for 10 mins and stained with 0.5% crystal violet (Beyotime, Shanghai, China) for 20 mins. Invading cells were photographed under Leica AM6000 microscope at 20x magnification (Leica, Wetzlar, Germany), and cells in 5 random fields were count in each condition.

2.9 Western blot

Western blotting was conducted as in a previous study [23]. Total protein was extracted from tissues and cells using RIPA lysis buffer containing protease inhibitor cocktail (Thermo Fisher Scientific 78429, Waltham, MA, USA). Cells suspended in RIPA buffer were lysed on ice for 10 mins and lysed cells were centrifuged at 14000 rpm for 10 mins. The supernatant containing total protein lysate was quantified by a BCA Protein assay kit (Beyotime Biotechnology P0009; Shanghai, China). 15 ug of protein was used for in SDS_PAGE gel and was then transferred onto the PVDF membrane. After blocking with 5% skimmed milk for 1 hour, the membrane was then incubated with primary antibodies: LC3-II/LC3-I (1: 1000; ab48394, Abcam), Beclin-1 (1: 1500, ab62557), p62 (1: 1000, ab155686), SOCS6 (1: 1000, ab197335) and GAPDH (1: 2000; Cell Signaling Technologies #2118) for overnight at 4 ${{}^{\circ}}$ C. The membrane was washed 3 times with TBST buffer and further incubated with HRP-linked secondary antibody (1: 2500; Cell signaling #7074, MA, USA) at room temperature for 1 hour. Then the membrane was washed 4 times with TBST and the protein bands were visualized using an enhanced chemiluminescence kit (Santa Cruz, TX, USA, sc-2048) and photographed on a gel imager system (Bio-Rad, Hercules, CA, United States). The densitometry analysis was performed with Image J software (Bethesda, MD, USA).

2.10 Dual luciferase reporter assay

To demonstrate the functional interaction between microRNAs and the interaction partners, the sequence containing the wild type binding site (WT) at HnRNPU-AS1 3’-UTR and SOCS6 3’-UTR or the sequence with mutated binding site (MUT) were cloned into the PmirGLO vector expressing firefly luciferase respectively (Promega, E1330). The reporter plasmid and Renilla luciferase (hRlucneo) control plasmid were co-transfected into cells in the presence of miR-556-3p/miR-580-3p mimic or miR-NC in a 12-well plate (1 $\times$ 10 ${}^{5}$ cells/well) using Lipofectamine 3000 reagent. 48 hours post transfection, the relative luciferase activities were measured using Dual-Luciferase Reporter Assay Kit (Promega, E1910) on a luminescence microplate reader (Infinite 200 PRO; Tecan). The relative firefly luciferase activity in the reporter plasmid was normalized to that of Renilla luciferase in control plasmid (hRlucneo).

2.11 RNA pull-down

Cells lysates were collected by IP lysis buffer (Beyotime, P0013) and were incubated with biotinylated HNRNPU-AS1-probe oligo and Control oligo. 10% of the lysates was saved as the input. The mixture was further incubated with M-280 streptavidin magnetic beads (Sigma-Aldrich, 11205D) at 4 ${{}^{\circ}}$ C shaking overnight. A magnetic bar was used to pull down the magnetic beads and associated nucleic acids, then the samples were washed 4 times with high salt wash buffer. Both the input and the elutes from the pull-down samples were purified with Trizol reagent (Invitrogen, 15596026) according to the manufacturer’s protocol. Reverse transcription and qRT-PCR analysis was performed (as described in qRT-PCR section) to determine the relative enrichment of miR-556-3p and miR-580-3p in the pull-down samples by normalizing to the input.

2.12 Xenograft tumorigenesis in nude mice

Animal experiments were approved by Animal Care and Experimental Committee of The Second Affiliated Hospital of Xi ’An Jiaotong University. 0.2 mL of HCC cells transfected with HnRNPU-AS1 overexpression vector or empty vector (1 $\times$ 10 ${}^{7}$ cells) was subcutaneously injected into the flank of 12 weeks old female nude mice ( $n=$ 6 in each group). All the mice were maintained in pathogen-free animal house with 12/12 light and darkness cycle at 22 ${}^{\circ}$ C. Tumor volume were monitored every week until day 49. The tumor volume was calculated using the formula: V (tumor) $=$ 0.5 $\times$ length $\times$ width ${}^{2}$ . Seven weeks after tumor cell inoculation, all the mice were euthanized by CO2 asphyxiation, followed by cervical dislocation. The tumors of terminally dead mice were resected for weight measurement and subsequent qRT-PCR and Western blot analysis.

Table 1
Association between clinical characteristics and HNRNPU-AS1 expression in 86 patients with hepatocellular carcinoma

Characteristic	High HNRNPU-AS1	Low HNRNPU-AS1	$P$ value
Age (years)			$>$ 0.05
$\leqslant$ 65	20	24
$>$ 65	23	19
Sex, $n$ (%)			$>$ 0.05
Male	25	22
Female	18	21
Gross tumor volume, cm ${}^{3}$	60.35 $\pm$ 5.23	58.56 $\pm$ 5.71	$>$ 0.05
HBV infection			$>$ 0.05
Positive	27	30
Negative	16	13
Pathological T stage			$<$ 0.01
T2	10	3
T3	20	21
T4	13	19
Pathological N stage			$<$ 0.01
N0	12	5
N1	19	22
N2	12	16
Pathological M stage			$<$ 0.01
M0	18	7
M1	25	36
Tumor differentiation			$>$ 0.05
High differentiation	10	11
Moderately differentiation	23	21
Low differentiation	10	11

2.13 Statistical analysis

Statistical analyses were performed with SPSS 20.0 software (IBM SPSS, Armonk, NY, USA). All the experiments were repeated three times. The association between HNRNPU-AS1 expression level and clinic pathological parameters was evaluated with Chi-square analysis. The statistical difference between two groups was compared using unpaired Student’s $t$ tests. Comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA) with Tukey’s post hoc test for pairwise comparison. Comparisons of data at multiple time points were examined using two-way ANOVA. Kaplan Meier Curve and log-rank test were used to compare the overall survival or progression-free survival in HCC patients. Spearman correlation analysis was performed to determine the correlation between gene expressions in HCC samples. Data were reported as the mean $\pm$ standard deviation (SD). $P<$ 0.05, $P<$ 0.01 or $P<$ 0.001 was considered as statistically significant.

3. Results

3.1 HnRNPU-AS1 is down-regulated in HCC tissues and HCC cells, and is linked with impaired autophagy

We first investigated the mRNA expressions of HnRNPU-AS1 in HCC tumor tissues and cell lines by qRT-PCR. Figure 1A and B showed that compared with adjacent normal tissues and normal liver cell line L02, HnRNPU-AS1 mRNA level was significantly decreased in tumor tissues and HCC cell lines (Huh7, HepG2, HCCLM3 and Hep3B). Next, 86 HCC patients were divided into HnRNPU-AS1 high expression ( $n=$ 43) and low expression ( $n=$ 43) groups according to the median expression level of HnRNPU-AS1, and the clinicopathological characteristics in each patient group were summarized in Table 1. Chi-square test revealed that HnRNPU-AS1 low expression level was associated with TNM stages, while there were no correlations with age, gender, tumor differentiation, HBV infection, or tumor size (Table 1). Furthermore, the Kaplan-Meier analysis demonstrated that HnRNPU-AS1 low expression was correlated with a poor prognosis in HCC patients (Fig. 1C and D). We further examined whether HnRNPU-AS1expresion level affects the status of autophagy in HCC tissues and cell line. The examination of autophagy markers by Western blot showed the impaired autophagy in HCC tissues and cell lines, as revealed by the reduced LC3-II/LC-3I ratio and Beclin-1 protein level, while P62 protein was increased (Fig. 1E and F). Therefore, the low expression level of HnRNPU-AS1 in HCC seems to be correlated with attenuated autophagy in HCC cells.

Figure 1.

HnRNPU-AS1 is down-regulated in HCC tissues and HCC cells. (A–B) The expression level of HnRNPU-AS1 in HCC tissues and cell lines (Huh7, HepG2, HCCLM3 and Hep3B) was compared with normal tissues or normal liver cell lines (L02). (C–D) Low HnRNPU-AS1 expression in HCC patients was associated with reduced overall survival and progression-free survival, as analyzed by Kaplan-Meier method. (E-F) The protein levels of autophagy-related proteins were compared between HCC tissues and adjacent normal tissues, and between HCC and normal cell lines by Western blot. ${}^{*}p<$ 0.05, ${}^{**}p<$ 0.01, ${}^{***}p<$ 0.001.

Figure 2.

Overexpression of HnRNPU-AS1 inhibits cell proliferation, migration and invasion, and induces autophagy. (A) HnRNPU-AS1 is upregulated in Huh7 and HepG2 cells after the transfection with HnRNPU-AS1-pcDNA3.1 overexpression plasmid. Empty vector was used as control. (B) CCK-8 cell proliferation assay, (C) colony formation assay, (D) would-healing migration assay, and (E) Transwell invasion assay were performed in cells transfected with HnRNPU-AS1 overexpression vector in the presence or absence of autophagy inhibitor 3-Methyladenine (3-MA, 10 $\mu$ M). (F) The protein levels of autophagy-related proteins were compared Western blot. ${}^{*}p<$ 0.05, ${}^{**}p<$ 0.01, ${}^{***}p<$ 0.001.

Figure 3.

HnRNPU-AS1 targets both miR-556-3p and miR-580-3p. (A) The localization of HnRNPU-AS1 in nucleus and cytoplasm detected by qRT-PCR after nucleo-cytoplasmic fraction in Huh7 and HepG2 cells. (B) The binding sites between HnRNPU-AS1 and miR-556-3p/miR-580-3p predicted by lncBASE online database. (C–D) The expression level of miR-556-3p and miR-580-3p detected by qRT-PCR after transfecting with miR-556-3p inhibitor and miR-580-3p inhibitor. (E) Dual luciferase reporter assay using wild type (WT) reporter containing binding site of miR-556-3p/miR-580-3p or mutated (MUT) reporter in the presence of microRNA inhibitor or inhibitor control. (F) RNA pull-down assay using biotin-conjugated HnRNPU-AS1 probe or control probe. The precipitated micro RNA was normalized to the input. (G) The expression level of miR-556-3p and miR-580-3p in HCC tissues was compared with that of normal tissues. (H) The relationship between HnRNPU-AS1 level and miR-556-3p/miR-580-3p level in HCC tissues were analyzed by Spearman correlation coefficient analysis. (I) The expression level of miR-556-3p and miR-580-3p in HCC cell lines was compared with normal cell line. ${}^{**}p<$ 0.01, ${}^{***}p<$ 0.001.

Figure 4.

HnRNPU-AS1 regulates the malignant phenotype of HCC cells by targeting miR-556-3p and miR-580-3p. Cells were transfected with empty vector, HNRNPU-AS1 expression vector, HNRNPU-AS1 $+$ miR-556-3p mimic or HNRNPU-AS1 $+$ miR-580-3p mimic. (A) CCK-8 cell proliferation assay, (B) colony formation assay, (C) would-healing migration assay, and (D) Transwell invasion assay were performed to investigate the effect of miR-556-3p and miR-580-3p mimic on HNRNPU-AS1 overexpression. (E) The protein levels of autophagy related proteins were determined in different groups by Western blot. (F) The densitometry of protein bands in (E) were determined, using GAPDH as the loading control. ${}^{*}p<$ 0.05, ${}^{**}p<$ 0.01, ${}^{***}p<$ 0.001.

Figure 5.

SOCS6 is a target gene of both miR-556-3p and miR-580-3p. (A) The bind sites between SOCS6 mRNA 3’UTR and miR-556-3p/miR-580-3p were predicted by StarBSAE online database, and their functional interaction was validated by dual-luciferase reporter assay in Huh7 cells. (B) The protein level of SOCS6 was analyzed by Western blot after transfecting with microRNA mimic or inhibitor. (C) The protein level of SOCS6 were determined by Western bot in different groups: Vector, HNRNPU-AS1, HNRNPU-AS1 $+$ miR-556-3p mimic and HNRNPU-AS1 $+$ miR-580-3p mimic. (D) The mRNA level of SOCS6 in HCC tissues was compared with that of normal tissues. (E) The relationship between SOCS6 mRNA level and miR-556-3p/miR-580-3p expression level in HCC tissues were analyzed by Spearman correlation coefficient analysis. (F) The protein level of SOCS6 was determined by Western blot in HCC cell lines and normal liver cells. ${}^{**}p<$ 0.01, ${}^{***}p<$ 0.001.

Figure 6.

Knocking down SOCS6 partially reverses the effect of hnRNPU-AS1 overexpression in HCC cells. (A) SOCS6 protein level was measured by Western blot in cells transfected with control siRNA (si-NC) and siRNA targeting SOCS6 (si-SOXS6). (B–E) CCK-proliferation assay, colony formation assay, would-healing migration, and Trasnwell invasion assay were performed different groups: Vector, HNRNPU-AS1, HNRNPU-AS1 $+$ si-SOCS6. (F) The protein level of autophagy related proteins was determined by Western blot in different groups: cell transfected with empty Vector, with HNRNPU-AS1 expression vector or HNRNPU-AS1 $+$ si-SOCS6. ${}^{*}p<$ 0.05, ${}^{**}p<$ 0.01, ${}^{***}p<$ 0.001.

3.2 Overexpression of HnRNPU-AS1 inhibits cell proliferation, migration and invasion, and induces autophagy

To confirm the expression level of HnRNPU-AS1 regulates phenotype and autophagy in HCC cells, we transfected HnRNPU-AS1 expression vector into two HCC cell lines (HUH7 and HepG2) with the lowest HnRNPU-AS1 expression. Transfection of HnRNPU-AS1 expression vector significantly increased the level of HnRNPU-AS1 in the two cell lines (Fig. 2A). We then performed CCK8 proliferation and colony formation assay and found HnRNPU-AS1 overexpression suppressed cell proliferation, which could be rescued by an autophagy inhibitor 3-Methyladenine (3-MA) (Fig. 2B and C). Similarly, wound healing assay and Transwell assay demonstrated that, cell migration and invasion ability was reduced after overexpressing HnRNPU-AS1 in both HUH7 and HepG2 cell lines, which was also rescued by 3-MA (Fig. 2D and E). The impact of HnRNPU-AS1 overexpression on autophagy was detect by Western blot, which revealed that HnRNPU-AS1 overexpression could promote autophagy by driving the conversion of LC3-I to LC3-II, increasing Beclin-1 protein level and suppressing P62 protein level (Fig. 2F). These effects were suppressed by autophagy inhibitor 3-MA. Collectively, these data suggest that high expression level of HnRNPU-AS1 regulates cell proliferation, migration and invasion, and induces autophagy.

3.3 HnRNPU-AS1 targets both miR-556-3p and miR-580-3p

We next attempted to fin potential downstream targets of HnRNPU-AS1. The subcellular localization of HnRNPU-AS1 in HUH7 and HepG2 cells was detected in cytoplasm and nucleus by qRT-PCR after nucleo-cytoplasmic fraction. Similar to GAPDH mRNA, HnRNPU-AS1 was mainly located in the cytoplasm of HUH7 and HepG2 cells (Fig. 3A). Using lncBASE online database, we identified potential binding sites between HnRNPU-AS1 and miR-556-3p or miR-580-3p (Fig. 3B). To validate these functional interactions, we performed luciferase reporter assay using synthetic inhibitors targeting these two miRNAs. The expression level of miR-556-3p and miR-580-3p were considerably suppressed by transfecting miR-556-3p inhibitor and miR-580-3p inhibitor (Fig. 3C and D). The luciferase activity assay showed that the knockdown of miR-556-3p or miR-580-3p could increase the luciferase activity of the WT reporter, while this effect was abolished when the biding sites at 3’UTR of HnRNPU-AS1 were mutated (Fig. 3E).

To investigate whether miR-556-3p and miR-580-3p interacts directly with HnRNPU-AS1, RNA pull-down assay was performed using biotinylated HnRNPU-AS1 probe or control probe. The results showed that compared with control, HnRNPU-AS1 probe significantly enriched both miR-556-3p or miR-580-3p (Fig. 3F). Moreover, the expression levels of miR-556-3p and miR-580-3p were significantly increased in HCC tumor tissues as compared with adjacent normal tissues (Fig. 3G). Spearman correlation coefficient analyses further revealed the negative correlations between hnRNPU-AS1 and miR-556-3p or miR-580-3p (Fig. 3H). Finally, we also showed that the expression levels of miR-556-3p and miR-580-3p were significantly higher in HCC cell lines (Huh7, HepG2, HCCLM3 and Hep3B) as compared to normal cell line L02 (Fig. 3I).

The above data indicate that HnRNPU-AS1 targets both miR-556-3p and miR-580-3p.

3.4 HnRNPU-AS1 regulates the malignant phenotype of HCC cells by targeting miR-556-3p and miR-580-3p

We next examined whether miR-556-3p and miR-580-3p mediates the functional role of HnRNPU-AS1. In HUH7 and HepG2 cells, we overexpressed HnRNPU-AS1 in the presence of miR-556-3p mimic or miR-580-3p mimic. The suppressive effects of HnRNPU-AS1 overexpression on cell proliferation, colony formation, migration and invasion were partially rescued by miR-556-3p mimic or miR-580-3p mimic (Fig. 4A–D). Besides, the effects on the conversion of LC3-I to LC3-II, Beclin-1 and P62 protein levels by HnRNPU-AS1 overexpression were also attenuated by miR-556-3p mimic and miR-580-3p mimic in HUH7 and HepG2 cells (Fig. 4E and F).

3.5 SOCS6 is a target gene of both miR-556-3p and miR-580-3p

To further search for the protein-coding mRNA target of miR-556-3p and miR-580-3p, we used StarBSAE online database and identified the putative binding sites between miR-556-3p or miR-580-3p and SOCS6 (Fig. 5A). Luciferase reporter assay was performed to determine the functional interaction between miR-556-3p or miR-580-3p and SOCS6 in HUH7 cells. The results showed that both miR-556-3p inhibitor and miR-580-3p inhibitor increased the luciferase activity of WT reporter, which was not observed in the MUT reporter containing mutated 3’-UTR sequence of SOCS6 mRNA (Fig. 5A). In addition, SOCS6 protein level was reduced upon the overexpression of miR-556-3p and miR-580-3p using microRNA mimics, while microRNA inhibitors enhanced their expression (Fig. 5B). We also examined whether HnRNPU-AS1/microRNA axis regulates SOCS6 protein level using the following experimental groups: Vector, HnRNPU-AS1 overexpression, HnRNPU-AS1 $+$ miR-556-3p mimic, HnRNPU-AS1 $+$ miR-580-3p mimic (Fig. 5C). Western blot results demonstrated that HnRNPU-AS1 overexpression increased the SOCS6 protein level, which was attenuated by the co-transfection of miR-556-3p or miR-580-3p mimics (Fig. 5C). We also analyzed the mRNA level of SOCS6 in tumor and normal tissues of HCC patients, and found a significantly decreased level in tumor tissues as compared with adjacent normal tissues (Fig. 5D). Spearman correlation coefficient analyses revealed significant negative correlation between SOCS6 level and miR-556-3p or miR-580-3p level, while there was a positive correlation between SOCS6 level and HnRNPU-AS1 level (Fig. 5E). In addition, we verified that the protein level of SOCS6 was significantly lower in HCC cell lines (Fig. 5F). These results suggest that HnRNPU-AS1/miR-556-3p and miR-580-3p axis regulates SOCS6 expression in HCC cells.

3.6 Knocking down SOCS6 partially reverses the effect of hnRNPU-AS1 overexpression

We next investigated whether SOCS6 mediates the functional role of hnRNPU-AS1 overexpression, by knocking down SOCS6 using siRNA. Compared with si-NC group, si-SOCS6 efficiently reduced SOCS6 protein level in HUH7 and HepG2 cells (Fig. 6A). When co-transfected with si-SOCS6, the suppressive effects of HnRNPU-AS1 overexpression on cell proliferation, colony formation, migration and invasion were partially reversed (Fig. 6B–E). Besides, the effects on the conversion of LC3-I to LC3-II, Beclin-1 and P62 protein levels by HnRNPU-AS1 overexpression were also attenuated by knocking down SOCS6 in HUH7 and HepG2 cells (Fig. 6F). The above results suggest that SOCS6 is a downstream mediator of hnRNPU-AS1 in HCC cells.

Figure 7.

Overexpression of HnRNPU-AS1 inhibits tumor growth in vivo. (A) The tumor volume and (B) The tumor weight was measured in nude mice injected with Huh7 cells overexpressing HnRNPU-AS1 or control vector. (C) The expression levels of HnRNPU-AS1, miR-566-3p, and miR-580-3p were measured in tumor tissues of vector and HnRNPU-AS1 groups. (D) The protein level of SOCS6, LC3-II, LC3-I, Beclin-1, p62 were determined by Western blot in tumor tissues of vector and HNRNPU-AS1 groups. ${}^{***}p<$ 0.001.

Figure 8.

Schematics of molecular interplay among HnRNPUAS1, miR-566-3p, miR-580-3p and SOCS6 in HCC. In HCC, HnRNPU-AS1 is downregulated and its downregulation is correlated with the upregulation of miR-556-3p and miR-580-3p. miR-556-3p and miR-580-3p function as downstream mediators of HnRNPU-AS1 to suppress the expression of tumor suppressor SOCS6. The reduced SOCS6 expression contributes to the promotion of proliferation, migration and autophagy in HCC cells.

3.7 Overexpression of HnRNPU-AS1 inhibits tumor growth in vivo

To explore the tumor-suppressor effects of HnRNPU-AS1 in vivo, HUH7 cells with empty vector or overexpressing HnRNPU-AS1 were subcutaneously injected into nude mice. Tumor volume and tumor weight in HnRNPU-AS1 overexpression groups were significantly reduced as compared to the control group (Fig. 7A and B). Besides, in tumor tissue of HnRNPU-AS1 overexpression group, the mRNA level of HnRNPU-AS1 was higher but the expression level of miR-556-3p and miR-580-3p was reduced (Fig. 7C). Furthermore, Western blot showed that HnRNPU-AS1 overexpression increased the protein level of SOCS6, LC3-II/LC3-I, and Beclin-1, while P62 level was downregulated in HnRNPU-AS1 overexpression group (Fig. 7D). Together, these data demonstrated that HnRNPU-AS1 is a tumor suppressor in HCC tumor model.

4. Discussion

In the present study, the results show that the lncRNA HnRNPU-AS1 and SOCS6 are downregulated, while by the expression of miR-566-3p and miR-580-3p is upregulated in HCC, which is implicated in promoting cancer progression via suppressing autophagy. HnRNPU-AS1 seems to function as a tumor suppressor, and its overexpression impairs the malignant phenotype pf HCC cells (cell proliferation, invasion and migration) and induces autophagy. The miR-556-3p and miR-580-3p/SOXS6 axis mediates the tumor-suppressor effect of HnRNPU-AS1.

The tumor-suppressor function of HnRNPU-AS1 is evidenced by the observation that low HnRNPU-AS1 expression is associated with a poor prognosis in HCC patients. In previous studies, HnRNPU-AS1 was reported to be downregulated in acute myocardial infarction (AMI) [24] and in rheumatoid arthritis [25]. However, the expression pattern and functional role of HnRNPU-AS1 in cancer progression remains enigmatic. We provided evidence that HnRNPU-AS1 is downregulated in both HCC tissues and cell line, and its overexpression inhibits HCC progression in vitro and in vivo. Future studies are required to further explore the mechanism underlying the downregulation of HnRNPU-AS1 in HCC.

We further demonstrated the role of HnRNPU-AS1 as a sponge for miR-566-3p and miR-580-3p, and miR-566-3p and miR-580-3p. Many reported lncRNAs are located in the cytoplasm and act as ceRNAs to competitively bind to the miRNA target [26, 27, 28, 29]. HnRNPU-AS1 is also primarily localized in the cytoplasm, and its functional interaction with miR-556-3p and miR-580-3p were validated by dual luciferase reporter and DNA-pull down assay. These two miRNAs are up-regulated and their expression level show negative correlation with HnRNPU-AS1 in HCC tissues, indicating that their upregulation is implicated in HCC progression. Indeed, a previous study has shown that miR-556-3p could promote the progression and development of HCC, and downregulating miR-556-3p in HCC cells could suppress cell proliferation and induce apoptosis [30]. In non-small cell lung cancer, Pang et al. found that the miR-580-3p was upregulated to support cell proliferation, which could be sponged by circular RNA hsa_circ_0072309 [31]. We further demonstrated that the effect of overexpressing HnRNPU-AS1 in HCC cells could be attenuated by miR-556-3p or miR-580-3p overexpression. These results support the oncogenic roles of miR-556-3p and miR-580-3p, which could be sponged by tumor-suppressor HnRNPU-AS1. In line with this notion, miR-556-3p and miR-580-3p could act as target and be sponged by lncRNAs or cirRNAs in a various of tumors, such as melanoma [32] and lung cancer [33].

We also identified SOCS6 as a target negatively regulated by miR-556-3p and miR-580-3p, and SOCS6 expression level is negatively correlated with that of miR-556-3p or miR-580-3p. Consistently, SOCS6 was reported as suppressor in HCC development, which is negatively regulated regulated by miR-21 and miR-183 [34]. Moreover, SOCS6 low expression is associated with a poor prognosis in HCC patients [35]. Together, these findings highlighted SOCS6 as a tumor suppressor in HCC. Based on the positive correlation between HnRNPU-AS1 and SOCS6 and their downregulation in HCC, our study further validated that SOCS6 acts as a downstream factor mediating the tumor-suppressor effect of HnRNPU-AS1 by silencing SOCS6 in cells overexpressing HnRNPU-AS1.

Interestingly, HnRNPU-AS1/SOCS6 axis seems to regulate HCC progression by mediating autophagy. A previous study showed that the knockout of SOCS6 gene in PANC1 and BXPC3 cells impairs chaperon-mediated autophagy [22]. In our data, we also observed the correlation of SOCS6 downregulation and impaired autophagy in HCC cells. In cancer cells, autophagy induction seems to be a double-edged sword, which can suppress tumorigenesis by inducing cell death, but it also facilitates tumor growth by promoting cancer cell survival under nutrient-restricted conditions [36, 37, 38]. It remains to be investigated how autophagy impairment caused by HnRNPU-AS1/SOCS6 downregulation specifically contributes to HCC progression. In addition, the mechanisms of autophagy regulation by HnRNPU-AS1/SOCS6 axis remains to be elucidated.

In conclusion, our study demonstrated the tumor suppressor function of HnRNPU-AS1 in HCC. HnRNPU-AS1 is downregulated in HCC tissues and cell lines, which is negatively correlated with the upregulation of miR-556-3p and miR-580-3p. miR-556-3p and miR-580-3p function as downstream mediators of HnRNPU-AS1 to suppress the expression of tumor suppressor SOCS6 (Fig. 8). These data suggest that HnRNPU-AS1 inhibits the progression of HCC by targeting miR-556-3p and miR-580-3p/SOCS6 axis.

Disclosure of competing interests

The authors declare that there are no competing interests associated with the manuscript.

Fund

This study was approved by the Shanxi Provincial Key Research and Development Program (2019SF-169).

Author contributions

Conception: Di Zhang.

Interpretation or analysis of data: Li Zhang, Yao Zhao, Hao Guan.

Preparation of the manuscript: Li Zhang.

Revision for important intellectual content: Li Zhang and Di Zhang.

Supervision: Di Zhang.

References

Sung

Ferlay

Siegel

R.L.

Laversanne

Soerjomataram

Jemal

and Bray

, Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA Cancer J Clin 71 (2021), 209–249.

Zhou

Wang

Zeng

Yin

Zhu

Chen

Wang

Liu

et al., Mortality, morbidity, and risk factors in China and its provinces, 1990–2017: A systematic analysis for the Global Burden of Disease Study 2017, Lancet 394 (2019), 1145–1158.

Bréchot

et al., Molecular bases for the development of hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC), Semin Cancer Biol 10 (2000), 211–231.

Kanwal

Hoang

Kramer

J.R.

Asch

S.M.

Goetz

M.B.

Zeringue

Richardson

and El-Serag

H.B.

, Increasing prevalence of HCC and cirrhosis in patients with chronic hepatitis C virus infection, Gastroenterology 140 (2011), 1182–1188.e1181.

Velázquez

RF.

et al., Prospective analysis of risk factors for hepatocellular carcinoma in patients with liver cirrhosis, Hepatology 37 (2003), 520–527.

Schütte

Bornschein

Kahl

Seidensticker

Arend

Ricke

and Malfertheiner

, Delayed Diagnosis of HCC with Chronic Alcoholic Liver Disease, Liver Cancer 1 (2012), 257–266.

Duan

X.F.

Tang

and Yu

Z.T.

, Obesity, adipokines and hepatocellular carcinoma, Int J Cancer 133 (2013), 1776–1783.

Dhar

Seki

and Karin

, NCOA5, IL-6, type 2 diabetes, and HCC: The deadly quartet, Cell Metab 19 (2014), 6–7.

Magnussen

and Parsi

M.A.

, Aflatoxins, hepatocellular carcinoma and public health, World J Gastroenterol 19 (2013), 1508–1512.

10.

Bruix

Boix

Sala

and Llovet

J.M.

, Focus on hepatocellular carcinoma, Cancer Cell 5 (2014), 215–219.

11.

Crocetti

Bargellini

and Cioni

, Loco-regional treatment of HCC: Current status, Clin Radiol 72 (2017), 626–635.

12.

Bruix

and Llovet

J.M.

, Prognostic prediction and treatment strategy in hepatocellular carcinoma, Hepatology 35 (2002), 519–524.

13.

Villanueva

and Llovet

J.M.

, Targeted therapies for hepatocellular carcinoma, Gastroenterology 140 (2011), 1410–1426.

14.

Stefaniuk

Cianciara

and Wiercinska-Drapalo

, Present and future possibilities for early diagnosis of hepatocellular carcinoma, World J Gastroenterol 16 (2010), 418–424.

15.

Jiang

M.C.

J.J.

Cui

W.Y.

Wang

B.Y.

and Zhuo

, Emerging roles of lncRNA in cancer and therapeutic opportunities, Am J Cancer Res 9 (2019), 1354–1366.

16.

Peng

W.X.

Koirala

and Mo

Y.Y.

, LncRNA-mediated regulation of cell signaling in cancer, Oncogene 36 (2017), 5661–5667.

17.

Zhao

J.T.

Chi

B.J.

Sun

Chi

N.N.

Zhang

X.M.

Sun

J.B.

Chen

and Xia

, LINC00174 is an oncogenic lncRNA of hepatocellular carcinoma and regulates miR-320/S100A10 axis, Cell Biochem Funct 38 (2020), 859–869.

18.

Wang

Yang

Chen

Liu

Guo

Zhu

Tong

Yang

Huang

et al., A novel lncRNA MCM3AP-AS1 promotes the growth of hepatocellular carcinoma by targeting miR-194-5p/FOXA1 axisj, Mol Cancer 18 (2019), 28.

19.

Niu

Wang

Liu

Yao

Wang

Lin

and Yuan

, HNRNPU-AS1 Regulates Cell Proliferation and Apoptosis via the MicroRNA 205-5p/AXIN2 Axis and Wnt/β-Catenin Signaling Pathway in Cervical Cancer, Mol Cell Biol 41 (2021), e0011521.

20.

Sun

Zhao

Shi

Gong

Pan

Zheng

and Zhang

, SOCS6 promotes radiosensitivity and decreases cancer cell stemness in esophageal squamous cell carcinoma by regulating c-Kit ubiquitylation, Cancer Cell Int 21 (2021), 165.

21.

Yuan

Wang

Zhang

Luan

Rao

Cheng

Zhang

Xiao

Zhang

et al., SOCS6 Functions as a Tumor Suppressor by Inducing Apoptosis and Inhibiting Angiogenesis in Human Prostate Cancer, Curr Cancer Drug Targets 18 (2018), 894–904.

22.

Cui

Gong

Chen

Zhang

Yuan

Qin

and Gao

, CUL5-SOCS6 complex regulates mTORC2 function by targeting Sin1 for degradation, Cell Discov 5 (2019), 52.

23.

Liang

Chen

Zhang

Wang

Guan

Yang

and Bai

, LncRNA CASC9 promotes esophageal squamous cell carcinoma metastasis through upregulating LAMC2 expression by interacting with the CREB-binding protein, Cell Death Differ 25 (2018), 1980–1995.

24.

Shen

L.S.

X.F.

Chen

Shen

G.L.

and Cheng

, Integrated network analysis to explore the key mRNAs and lncRNAs in acute myocardial infarction, Math Biosci Eng 16 (2019), 6426–6437.

25.

Dolcino

Tinazzi

Puccetti

and Lunardi

, Long Non-Coding RNAs Target Pathogenetically Relevant Genes and Pathways in Rheumatoid Arthritis, Cells 8 (2019).

26.

Sui

Y.H.

Zhang

Y.Q.

C.Y.

Shen

Yao

W.Z.

Peng

Hong

W.W.

Yin

L.H.

Y.P.

et al., Integrated analysis of long non-coding RNAassociated ceRNA network reveals potential lncRNA biomarkers in human lung adenocarcinoma, Int J Oncol 49 (2016), 2023–2036.

27.

Zhao

Wang

Yan

Wang

Yang

and Shao

, Construction and investigation of lncRNA-associated ceRNA regulatory network in papillary thyroid cancer, Oncol Rep 39 (2018), 1197–1206.

28.

Zhang

Qian

Wang

Peng

et al., Analysis of lncRNA-Associated ceRNA Network Reveals Potential lncRNA Biomarkers in Human Colon Adenocarcinoma, Cell Physiol Biochem 49 (2018), 1778–1791.

29.

Zhou

Wang

Shi

Cheng

Wang

Zhao

Yang

and Sun

, Characterization of long non-coding RNA-associated ceRNA network to reveal potential prognostic lncRNA biomarkers in human ovarian cancer, Oncotarget 7 (2016), 12598–12611.

30.

Jin

Chen

Gao

Yang

Liu

and Wang

, Down-regulation of miR-556-3p inhibits hemangioma cell proliferation and promotes apoptosis by targeting VEGFC, Cell Mol Biol (Noisy-le-grand) 66 (2020), 204–207.

31.

Pang

Huang

Zhang

Huang

Pang

Cai

and Wang

, Circular RNA hsa_circ_0072309 inhibits non-small cell lung cancer progression by sponging miR-580-3p, Biosci Rep 40 (2020).

32.

Peng

Liu

Pei

Zhang

Chen

and Zhai

, A LHFPL3-AS1/miR-580-3p/STAT3 Feedback Loop Promotes the Malignancy in Melanoma via Activation of JAK2/STAT3 Signaling, Mol Cancer Res 18 (2020), 1724–1734.

33.

Gong

Zhu

and Li

, Knockdown of circ-ABCB10 promotes sensitivity of lung cancer cells to cisplatin via miR-556-3p/AK4 axis, BMC Pulm Med 20 (2020), 10.

34.

Z.B.

Z.Z.

Chu

H.T.

and Jia

, MiR-21 and miR-183 can simultaneously target SOCS6 and modulate growth and invasion of hepatocellular carcinoma (HCC) cells, Eur Rev Med Pharmacol Sci 19 (2015), 3208–3217.

35.

Qiu

Zheng

Guo

Gao

Liu

and Zhang

, Reduced expression of SOCS2 and SOCS6 in hepatocellular carcinoma correlates with aggressive tumor progression and poor prognosis, Mol Cell Biochem 378 (2013), 99–106.

36.

Lim

K.H.

and Staudt

L.M.

, Toll-like receptor signaling, Cold Spring Harb Perspect Biol 5 (2013), a011247.

37.

Yun

C.W.

and Lee

S.H.

, The roles of autophagy in cancer, Int J Mol Sci 19 (2018).

38.

Cirone

Gilardini Montani

M.S.

Granato

Garufi

Faggioni

and D’Orazi

, Autophagy manipulation as a strategy for efficient anticancer therapies: Possible consequences, J Exp Clin Cancer Res 38 (2019), 262.

HnRNPU-AS1 inhibits the proliferation,migration and invasion of HCC cells and induces autophagy through miR-556-3p/ miR-580-3p/SOCS6 axis

Abstract

BACKGROUND:

METHODS:

RESULTS:

CONCLUSIONS:

Keywords

1. Introduction

2. Materials and methods

2.1 Human samples

2.2 Cell culture

2.3 qRT-PCR

2.4 Cell transfection

2.5 CCK-8 cell proliferation assay

2.6 Colony formation assay

2.7 Wound healing assay

2.8 Transwell invasion assay

2.9 Western blot

2.10 Dual luciferase reporter assay

2.11 RNA pull-down

2.12 Xenograft tumorigenesis in nude mice

Table 1 Association between clinical characteristics and HNRNPU-AS1 expression in 86 patients with hepatocellular carcinoma

3. Results

3.1 HnRNPU-AS1 is down-regulated in HCC tissues and HCC cells, and is linked with impaired autophagy

3.3 HnRNPU-AS1 targets both miR-556-3p and miR-580-3p

3.4 HnRNPU-AS1 regulates the malignant phenotype of HCC cells by targeting miR-556-3p and miR-580-3p

3.5 SOCS6 is a target gene of both miR-556-3p and miR-580-3p

3.6 Knocking down SOCS6 partially reverses the effect of hnRNPU-AS1 overexpression

4. Discussion

Disclosure of competing interests

Fund

Author contributions

References

Table 1
Association between clinical characteristics and HNRNPU-AS1 expression in 86 patients with hepatocellular carcinoma