Sage Journals: Discover world-class research

Abstract

BACKGROUND:

Both Fms-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) and Additional Sex Comb-like 1 (ASXL1) mutations are frequent and early genetic alteration events in acute myeloid leukemia (AML) patients. These genetic alterations may be associated with an unfavorable prognosis.

OBJECTIVE:

Up to our knowledge, this is the first study performed to evaluate the clinical implication and prognostic significance of FLT3-ITD and ASXL1 mutations and their coexistence on the outcome of Egyptian AML patients.

METHODS:

Our study included 83 patients with AML who were subjected to immunophenotyping and detection of FLT3-ITD and ASXL1 gene mutation by polymerase chain reaction (PCR) and real-time PCR, respectively.

RESULTS:

FLT3-ITD and ASXL1 mutations were detected in 20.5% and 18.1% of AML patients respectively. Seven patients (8.4%) had co-expression of both genes’ mutations. FLT3-ITD mutation was significantly higher in younger age, higher WBCs count and poor cytogenetic risk patients ( $P=$ 0.01, $<$ 0.001 and 0.008 respectively). ASXL1 mutation was significantly higher in intermediate cytogenetic risk patients ( $P=$ 0.2). The mean period of survival and relapse-free survival (RFS) were significantly reduced in FLT3-ITD and ASXL1 mutations compared with their non-mutant types ( $P=$ 0.01 and 0.03 respectively). Both mutations were independent risk factors for overall survival (OS) and (RFS) in univariate and multivariate analysis in AML patients.

CONCLUSION:

FLT3-ITD and ASXL1 gene mutations or their coexistence can predict a poor prognosis in AML patients.

Keywords

Acute myeloid leukemia FLT3-ITD mutation ASXL1 mutation overall survival prognosis

Abbreviations

AML	acute myeloid leukemia
PCR	polymerase chain reaction
OS	overall survival

FLT3-ITD	Fms-like tyrosine kinase 3-internal
	tandem duplication
ASXL1	Additional Sex Comb-like 1
RTK	receptor tyrosine kinase
BM	bone marrow
K-EDTA	potassium ethylene diamine tetra-
	acetic acid (K-EDTA)
PR	partial response
CR	complete response to treatment
RR	refractory response
RFS	relapse-free survival
FAB	French-American-British
MDS	myelodysplastic syndromes
MPN	myeloproliferative neoplasms

1. Introduction

Acute myeloid leukemia (AML) is a complex disease, in which somatic mutations, coexisting competing clones and disease evolution over time are characteristics [1]. AML can be grouped into morphologically or genetically-defined subtypes. In the 1970s, the French-American-British (FAB) criteria divided AML into subtypes, M0 through M7 (Table 1), based on the origin of leukemic cells and maturity of the cells. It is based on the appearance of the leukemia cells under the microscope after routine staining, as well. Subtypes M0 through M5 all start in immature forms of white blood cells. M6 starts in very immature forms of red blood cells, while M7 starts in immature forms of cells that make platelets [2].

Acquired genetic aberrations play an important role in the development of AML. They are found in approximately 55% of adult AML and have high prognostic significance [3]. AML chromosomal aberrations include t(8:21)(q22;q22), inv(16)(p13q22), t(16;16)(p13;q22), or translocations generating PML-RARA fusion transcripts (APL) collectively referred to as core-binding factor (CBF) AML [4]. Molecular genetic markers include NPM1, FLT3, CEPBA and MLL. Epigenetic factors include DNMT34, TET2. Proteomic biomarkers include PTP, PTK and PIP [5].

Fms-like tyrosine kinase 3 (FLT3) is a proto-oncogene located on chromosome 13q12. It belongs to the receptor tyrosine kinase (RTK) family that plays a major role in hematopoietic cell survival, proliferation and differentiation [6]. The most common form of FLT3 mutation is an internal tandem duplication (ITD) of the juxtamembrane (JM) domain-coding sequence that promotes ligand independent auto-phosphorylation and constitutive activation of the receptor [7, 8]. The length of the ITD varies from 3 to $\geqslant$ 400 base pairs, but it always occurs in multiples of three. FLT3 gene mutation is so far the most frequent genetic alteration reported to be involved in AML. The second common type of FLT3 mutation is a missense point mutation in exon 20 (previously known as exon 17) known as FLT3-TKD [8].

Table 1
Characteristics of the different subtypes of AML according to FAB criteria (Bennett et al., 1985)

AML subtype	Characteristics
M0	Undifferentiated acute myeloblastic leukemia
M1	Acute myeloblastic leukemia with minimal
	maturation
M2	Acute myeloblastic leukemia with maturation
M3	Acute promyelocytic leukemia
M4	Acute myelomonocytic leukemia
M4 eosinophilia	Acute myelomonocytic leukemia with
	eosinophilia
M5	Acute monocytic leukemia
M6	Acute erythroid leukemia
M7	Acute megakaryoblastic leukemia

AML: acute myeloid leukemia; FAB: French-American-British.

Additional Sex Comb-like 1 (ASXL1) gene is located on chromosome 20q11. ASXL1 interacts with multiple epigenetic regulators. Thus regulates the transcription of several target genes, including Hox genes [9]. Non-mutant ASXL1 interacts with EZH2, EED and SUZ12, the main components of the polycomb repressive complex (PRC) 2 to help PRC2 functions [10]. ASXL1 interacts with OGT and HCFC1, as well [11]. In addition, ASXL1 functions as a coactivator or repressor of retinoic acid receptors in a cell-specific manner. Moreover, ASXL1 represses the expression of a subset of adipogenic genes, most of which are peroxisome proliferator-activated receptor (PPAR)-gamma targets. So, it is a PPAR-gamma corepressor [12].

ASXL1 is a frequently mutated gene in myeloid malignancies including myelodysplastic syndrome (MDS) and AML [13]. The vast majority of ASXL1 mutations are deletions, insertions, or substitutions resulting in stop codon mutations and truncation of the ASXL1 protein [14]. Knockdown or deletion of ASXL1 induces MDS-like symptoms, suggesting loss-of-function effects of ASXL1 mutations. The majority of ASXL1 mutations in myeloid malignancies are frameshift or nonsense mutations localized near the 5’ end at the last exon, exon 12. Thus, it escapes nonsense-mediated decay of messenger RNA and generates C-terminal truncated mutations. The mutant ASXL1 gains novel functions to form a hyperactive complex [15]. In addition, these mutations are always heterozygous, leaving one non-mutant allele intact.

Germline mutations of ASXL1 are identified in patients with Bohring-Opitz syndrome, which is characterized by severe developmental disorders [16]. Studies using ASXL1-depleted human hematopoietic cells and ASXL1 knockout mice have shown that deletion of ASXL1 protein leads to impaired hematopoiesis and accelerates myeloid malignancies via loss of interaction with PRC2 proteins [10, 17, 18].

There was a controversy in the results of the previous studies that evaluated the prognostic effect of ASXL1 mutation [19, 20]or FLT3-ITD [21, 8]. Moreover, a few studies evaluated the prognostic effect of the combination of both mutations [22, 23]. So, we tried to investigate the impact of either gene’s mutations and the coexistence of both mutations on the outcome of Egyptian AML patients for the first time.

2. Patients and methods

2.1 Experimental subjects

This prospective cohort study included 83 AML patients admitted to the Clinical Hematology Unit, Internal Medicine Department and Medical Oncology Department, Faculty of Medicine, Zagazig University Hospitals. The study was performed in collaboration with the Clinical Pathology and Medical Biochemistry and Molecular Biology Departments, Faculty of Medicine, Zagazig University during the period from August 2017 to December 2020. Patients were diagnosed according to the WHO 2016 criteria [24]. All patients with severe co-morbidities, M3 subtype and pregnant females were excluded from the study. Informed written consent was taken from each patient. All procedures were following the standards of the IRB of the Faculty of Medicine, Zagazig University.

Cytogenetic analysis was done on bone marrow (BM) cells collected from all AML patients at the time of diagnosis. BM specimens were collected on potassium ethylene diamine tetra-acetic acid (K-EDTA) (1.5 mg/mL) for morphologic, immunophenotypic, and molecular analysis.

2.2 Flow cytometric immunophenotyping for standard acute leukemia panel

Immunophenotyping for acute leukemia was performed using the standard panel of FITC/PE/PerCP-labeled monoclonal antibodies: (CD45, CD34, CD38, HLA-DR, MPO, terminal deoxynucleotidyl transferase [TdT], CD64, CD14, CD2, CD3, CD5, CD7, CD19, CD79a, CD20, CD22) (Becton Dickinson (BD), Cal, USA). Antigens were scored positive using a cut-off value of $\geqslant$ 20% leukemic blasts staining brighter than an isotype-matched negative control (antimouse IgG1, BD IgG1, Beckman Coulter). A cut-off value of 10% was used for CD34, MPO, and TdT [25].

2.3 Polymerase chain reaction (PCR) for FLT3-ITD

For qualitative analysis of FLT3-ITD mutations, genomic DNA was isolated using a QIAamp Mini Kit (Qiagen). A 360-bp fragment of the FLT3 gene was amplified using primers 11F (5’ CATTGTCGTTTTAACCCTGCTA 3’) and 12R (5’ ATATTCTCGTGGCTTCCCAG 3’). The PCR reaction was performed using a mixture containing 150 ng of DNA, 10 uL of master mix (Invitrogen) and 25 pmol of the forward and reverse primers. Initial denaturation at 95 ${}^{\circ}$ C for 10 minutes was performed followed by 35 cycles of amplification at 94 ${}^{\circ}$ C for 30 seconds for denaturation, at 58 ${}^{\circ}$ C for 1 minute for annealing, and at 72 ${}^{\circ}$ C for 1 minute for extension and a final extension step at 72 ${}^{\circ}$ C for 10 min (DNA iCycler; Bio-Rad, Hercules, CA). PCR products were resolved on 3% agarose gel stained with ethidium bromide and visualized under ultraviolet light [26].

2.4 Molecular detection of ASXL1 gene mutatuion

For detection of the AXSL1 mutation, genomic DNA was amplified with a 9 G primer forward (5’ ATCGGAGGGGGGGGGT 3’) and reverse (5’ AGCTCTGGACATGGCAGTTC 3’) synthesized by Sangon Biotech (Beijing, China) that contain a repeating guanine base on the expected site for mutation producing a mutant ASXL1 that so-called ASXL1 c.1934dupG according to the method previously described by Yannakou et al. In brief, PCR was performed on a total volume of 25 $\mu$ l that contains 10 ng of gDNA template, Taq buffer, 200 pmol of dNTPs, 20 pmol of each primer and one unit of Hot Star Taq (Qiagen, Hilden, Germany). The PCR reaction was designed to be; 95 ${}^{\circ}$ C for 3 min, followed by 95 ${}^{\circ}$ C for 45 seconds, 61 ${}^{\circ}$ C for 45 seconds, 72 ${}^{\circ}$ C for 1 minute for 35 cycles and 72 ${}^{\circ}$ C for 7 minutes. The PCR reaction was amplified with Rotor-Gene Q 2 Plex (Qiagen, Hilden, Germany) [27].

3. Results

Conventional cytogenetic analysis is mandatory in the evaluation of suspected AML. Favorable cytogenetic risk is detected in inversion (16) or translocation (16;16), translocation (8;21) or translocation (15;17). Intermediate cytogenetic risk is detected in trisomy 8, abnormal chromosome 5 or 7, inversion 16 with complex karyotype or 3 combined abnormalities. Poor cytogenetic risk is detected in complex ( $\geqslant$ 3 clonal chromosomal 7 abnormalities) including TP53 mutation, RUNX1 mutation, ASXL1 mutation, 11q23 – non translocation (9:11), NPM1-wildtype and FLT3-ITD mutated (high allelic ratio), inversion (3), translocations of (3;3), translocation (6;9) or (9;22) [28].

We investigated 83 newly diagnosed AML patients. They included 44 males (53%) and 39 females (47%) with a male to female ratio (1.1:1). The mean age was 58.1 $\pm$ 10.1 years (range 28–75 years). Among these patients, 70 patients had de novo and 13 patients had secondary AML, defined as AML patients with an antecedent hematologic disorder, such as MDS or MPNs, or history of chemotherapy and/or irradiation for solid neoplasm. We detected FLT3-ITD mutation in 17 patients (20.5%). ASXL1 gene mutation was detected in 15 patients (18.1%). We found that 7 patients (8.4%) had co-expression of both genes mutation. M1 FAB subtype was detected in 12%, M2 in 45.8%, M4 in 33.7%, M5 in 4.8% but the least was M0 which was found in 3.6%. Intermediate cytogenetic risk was detected in 44.6%, a favorable risk was detected in 31.3% and a poor risk was detected in 24.1%. A complete response to treatment (CR) was achieved in 56.6%, partial response (PR) in 15.7% and refractory response (RR) in 27.7%. The patient outcome revealed that relapse-free survival (RFS) was detected in 34.9%, relapse occurred in 34% and 43.4% of patients died (Table 2).

Table 2
Demographic and basic characteristics among the studied groups

		All cases $N=$ 83
		Mean $\pm$ SD	Median/range
Age (years)		58.1 $\pm$ 10.1	60 (28–75)
Platelets (10 ${}^{9}$ /L)		62.3 $\pm$ 10.9	65 (21–90)
WBCs (10 ${}^{9}$ /L)		42.8 $\pm$ 11.2	75 (18–71)
Hemoglobin (g/dL)		8.78 $\pm$ 0.91	9 (5.9–10.5)
BM blast %		56.7 $\pm$ 10.7	58 (25–76)
		$N$	%
Gender	Male	44	53
	Female	39	47
FAB	M0–M2	46	55.4
	M4–M5	37	44.6
Cytogenetic	Favorable	26	31.3
	Intermediate	37	44.6
	Poor	20	24.1
History	De novo	70	84.3
	Secondary	13	15.7
ASXL-1	Non-mutant	68	81.9
	Mutant	15	18.1
FLT3-ITD	Non-mutant	66	79.5
	Mutant	17	20.5
Co-expression of		7	8.4
FLT3-ITD and
ASXL1 mutations
Response	CR	47	56.6
	PR	13	15.7
	RR	23	27.7
Outcome	RFS	29	34.9
	Dead	36	43.4
	Relapse ${}^{*}$	16	34

CR: Complete response to treatment, PR: partial response, RR: refractory response, RFS: relapse-free survival. ${}^{*}$ relapse was calculated from those who achieved CR.

3.1 Comparison between patients with FLT3-ITD mutation and those with non-mutant type

Patients with FLT3-ITD mutation had significantly younger age, higher WBCs count, higher BM blasts and lower hemoglobin content ( $P=$ 0.01, $<$ 0.001, $<$ 0.001, and $<$ 0.001 respectively). They also were significantly more associated with poor cytogenetic risk ( $P=$ 0.008) compared to non-mutant type (Table 3).

Table 3
Relation between FLT3-ITD and basic characteristics of AML patients

		Non-mutant $N=$ 66		Mutant $N=$ 17		$P$ value
		Mean $\pm$ SD		Mean $\pm$ SD
Age (years)		59.9 $\pm$ 8.5		50.9 $\pm$ 12.4		0.01 ${}^{*}$
Platelets (10 ${}^{9}$ /L)		62.4 $\pm$ 11.1		62.2 $\pm$ 10.5		0.91
WBCs (10 ${}^{9}$ /L)		42.2 $\pm$ 10.5		53.8 $\pm$ 5.9		$<$ 0.001 ${}^{**}$
Hb (g/dL)		9.1 $\pm$ 0.67		7.6 $\pm$ 0.78		$<$ 0.001 ${}^{**}$
BM blast%		50.5 $\pm$ 9.64		59.8 $\pm$ 6.2		$<$ 0.001 ${}^{**}$
		$N$	%	$N$	%	$P$
Gender	Male	36	54.5	8	47.1	0.57
	Female	30	45.5	9	52.9
FAB	M0-M2	33	50	13	76.5	0.05
	M4-M5	33	50	4	23.5
Cytogenetic risk	Favorable	20	30.3	0	0	0.009 ${}^{*}$
	Intermediate	31	47	6	35.3	0.38
	Poor	15	22.7	11	64.7	0.008 ${}^{*}$
History	Do novo	58	87.9	12	70.6	0.08
	Secondary	8	12.1	5	29.4
Response to treatment	CR	34	51.5	1	5.9	0.006 ${}^{*}$
	PR	16	24.2	9	52.9	0.03 ${}^{*}$
	RR	16	24.2	7	41.2	0.16
Outcome	RFS	28	42.4	1	5.9	0.004 ${}^{*}$
	Dead	18	27.3	13	76.5	0.001 ${}^{*}$
	Relapse	20	30.3	3	17.6	0.3

${}^{*}P$ -value $<$ 0.05 is significant; ${}^{**}P$ -value $<$ 0.001 is highly significant.

Table 4

Relation between ASXL-1 and basic characteristics of AML cases

		Non-mutant $N=$ 68		Mutant $N=$ 15		$P$ value
		Mean $\pm$ SD		Mean $\pm$ SD
Age (years)		56.8 $\pm$ 10.2		64.1 $\pm$ 6.5		0.02 ${}^{*}$
Platelets (10 ${}^{9}$ /L)		61.7 $\pm$ 10.7		65.2 $\pm$ 12.4		0.27
WBCs (10 ${}^{9}$ /L)		37.9 $\pm$ 4.33		47.7 $\pm$ 9.7		$<$ 0.001 ${}^{**}$
Hemoglobin (g/dL)		8.8 $\pm$ 0.81		8.5 $\pm$ 1.2		0.26
BM blast%		57.9 $\pm$ 11.4		51.5 $\pm$ 3		$<$ 0.001 ${}^{**}$
		$N$	%	$N$	%	$P$
Gender	Male	35	51.5	9	60	0.55
	Female	33	48.5	6	40
FAB	M0–M2	38	55.9	12	80	0.08
	M4–M5	30	44.1	3	20
Cytogenetic risk	Favorable	19	27.9	1	6.7	0.08
	Intermediate	26	38.2	11	73.3	0.02 ${}^{*}$
	Poor	23	33.8	3	20	0.29
History	Denovo	65	95.5	5	33.3	0.001 ${}^{*}$
	Secondary	3	4.5	10	66.7
FLT-3	Non-mutant	58	85.3	8	53.3	0.005 ${}^{*}$
	Mutant	10	14.7	7	46.7
Response	CR	43	63.2	4	26.7	0.009 ${}^{*}$
	PR	10	14.7	3	20	0.6
	RR	15	22.1	8	53.3	0.01 ${}^{*}$
Outcome	RFS	27	39.7	2	13.3	0.05
	Dead	25	36.7	11	73.4	0.009 ${}^{*}$
	Relapse	16	23.6	2	13.3	0.75

${}^{*}P$ -value $<$ 0.05 is significant; ${}^{**}P$ -value $<$ 0.001 is highly significant.

3.2 Comparison between patients with ASXL1 mutation and those with non-mutant gene

Patients with ASXL1 mutation had significantly older age, higher WBCs count and lower BM blasts ( $P=$ 0.02, $<$ 0.001 and $<$ 0.001 respectively). They also were significantly associated with intermediate cytogenetic risk ( $P=$ 0.02) compared to the non-mutant type. ASXL1 mutation was significantly higher in secondary AML ( $P=$ 0.001) (Table 4).

3.3 Comparison between patients with FLT3-ITD mutation and those with ASXL1mutation

Patients with FLT3-ITD had younger age, higher WBCs count, lower hemoglobin, higher BM blasts ( $P<$ 0.001, 0.04, 0.02, and $<$ 0.001) respectively compared to ASXL1 mutation patients. Moreover, there was a significant difference between the two mutations regarding poor cytogenetic risk ( $P=$ 0.008). There was no significant difference between FLT-3 ITD and ASXL1 mutation regarding response to treatment and outcome ( $P>$ 0.05) (Table 5).

Table 5
Relation between mutant ASXL-1 gene, mutant FLT-3 gene and co-expression of both among studied cases

		ASXL-1 $N=$ 8		FLT-3 $N=$ 10		Co-expression $N=$ 7		$P$ value
		Mean $\pm$ SD		Mean $\pm$ SD		Mean $\pm$ SD
Age (years)		66 $\pm$ 7.98 ${}^{\text{a}}$		43.3 $\pm$ 10.4		61.9 $\pm$ 3.5 ${}^{\text{b}}$		$<$ 0.001 ${}^{**}$
Platelets (10 ${}^{9}$ /L)		70.2 $\pm$ 8.2		63.9 $\pm$ 7.3		59.4 $\pm$ 14.2		0.13
WBCs (10 ${}^{9}$ /L)		34.99 $\pm$ 2.7 ${}^{\text{a}}$		52.2 $\pm$ 14.4		38.1 $\pm$ 8.1 ${}^{\text{b}}$		0.004 ${}^{*}$
Hb (g/dL)		9.28 $\pm$ 0.38 ${}^{\text{ac}}$		7.7 $\pm$ 0.41		7.6 $\pm$ 1.17		$<$ 0.001 ${}^{**}$
BM blast %		50 $\pm$ 2 ${}^{\text{ac}}$		64.3 $\pm$ 2.5		53.3 $\pm$ 3.1 ${}^{\text{b}}$		$<$ 0.001 ${}^{**}$
		$N$	%	$N$	%			$P$
Gender	Male	5	62.5	4	40	4	57.1	0.61
	Female	3	37.5	6	60	3	42.9
FAB	M0–M2	6	75	6	60	6	85.7	0.49
	M4–M5	2	25	4	40	1	14.3
Cytogenetic risk	Favorable	1	12.5	0	0	0	0	0.01 ${}^{*}$
	Intermediate	6	75	2	20	3	42.9	0.31
	Poor	1	12.5	8	80	4	57.1	0.153
History	De-novo	1	12.5	8	80	3	42.9	0.004 ${}^{*}$
	Secondary	7	87.5	2	20	4	57.1
Response to treatment	CR	4	50.0	3	30	0	0.0	0.43
	PR	2	25.0	6	60	1	14.3	0.007 ${}^{*}$
	Ref	2	25.0	1	10	6	85.7	0.04 ${}^{*}$
Outcome	RFS	2	25	1	10	0	0.0	0.66
	Dead	5	62.5	8	80	6	85.7	0.67
	Relapse	1	12.5	1	10	1	14.3	0.36

${}^{*}P$ -value $<$ 0.05 is significant; ${}^{**}P$ -value $<$ 0.001 is highly significant. a: significant difference between ASXL-1 gene and FLT-3 gene. b: significant difference between FLT-3 gene and co-expression. c: significant difference between ASXL-1 gene and co-expression.

Table 6

Survival analysis of AML cases according to FLT3-ITD and ASXL1 gene mutation

		Estimated mean of survival per month	Total patients	N of relapse		FS		$P$
FLT3-ITD	Non-mutant	21.01	44	16	(36.4%)	28	(63.6%)	0.01 ${}^{*}$
	Mutant	10.3	3	2	(66.7%)	1	(33.3%)
ASXL-1	Non-mutant	20.7	43	16	(37.3%)	27	(62.7%)	0.03 ${}^{*}$
	Mutant	11.1	4	2	(50%)	2	(50%)

${}^{*}P$ -value $<$ 0.05 is significant.

3.4 Comparison between patients with FLT3-ITD mutation, ASXL1 mutation and co mutations of both genes

In patients with FLT3-ITD mutation, age was significantly lower than patients with ASXL1 mutation and lower than patients with co expression of both mutations ( $P<$ 0.05). On the other hand, WBCs count was significantly higher than patients with ASXL1 mutation and patients with co expression of both mutations ( $P<$ 0.05). In patients with ASXL1 mutation, hemoglobin was significantly higher and BM blast was significantly lower compared to patients with FLT3-ITD mutation and patients with co expression of both mutations ( $p<$ 0.05) (Table 5).

3.5 Survival study of AML patients with FLT3-ITD and ASXL1 mutations

The mean time of survival of patients with FLT3-ITD and ASXL1 mutations were 10.3 and 11.1 months respectively compared to non-mutant types (21.01 and 20.7 months respectively). The percent of RFS of patients with FLT3-ITD and ASXL1 mutations were 33.3% and 50% respectively, compared to their non-mutant types (63.6% and 62.7% respectively) (Table 6 and Figs 1 and 2).

Figure 1.

Kaplan-Meier DF survival analysis of studied cases according to mutation in ASXL-1 gene.

Figure 2.

Kaplan-Meier DF survival analysis of studied cases according to FLT-3 gene mutation.

3.6 Multivariate analysis of significant predictors of FLT3-ITD and ASXL1 mutations among AML patients

Age, WBCs count, secondary AML and poor cytogenetic risk were significant predictors for FLT3-ITD mutation among AML patients ( $P<$ 0.001, 0.04, 0.02 and 0.04 respectively). Co-expression with FLT3-ITD mutation, intermediate cytogenetic risk and secondary AML were significant predictors for ASXL-1 mutation among AML patients ( $P=$ 0.01, 0.04 and 0.02 respectively) (Table 7).

Table 7
Multivariate analysis of significant predictors of FLT3-ITD and ASXL1 mutations

	FLT3-ITD			ASXL1
Variables	Multivariate analysis			Variables	Multivariate analysis
	B	95% CI	$P$ value		B	95% CI	$P$ value
Age	0.528	0.398–1.05	$<$ 0.001 ${}^{**}$	Age	$-$ 0.032	0.213–0.783	0.646
WBCs	0.002	0.52–1.321	0.04 ${}^{*}$	Coexpression with FLT3	$-$ 0.001	1.24–3.34	0.01 ${}^{*}$
Hb	$-$ 0.011	0.64–1.25	0.201	Intermediate cytogenetic risk	$-$ 0.0921	0.432–4.912	0.04 ${}^{*}$
BM blast	$-$ 0.021	0.213–1.12	0.104	BM blast	0.002	0.02–0.321	0.564
Secondary cause	$-$ 0.007	0.342–3.34	0.02 ${}^{*}$	Secondary cause	$-$ 0.004	1.12–5.23	0.02 ${}^{*}$
Poor cytogenetic risk	0.401	1.13–2.97	0.04 ${}^{*}$

CI: confidence interval. ${}^{**}$ Highly statistically significant ( $P<$ 0.001); ${}^{*}$ statistically significant ( $P<$ 0.05).

Table 8

Univariate and multivariate Cox-regression analyses for survival

Covariates	Overall survival				Relapse-free survival
	Univariate		Multivariate		Univariate		Multivariate
	HR (95% CI)	$P$	HR (95% CI)	$P$	HR (95% CI)	$P$	HR (95% CI)	$P$
Age	1.021 (0.989–1.054)	0.194			0.952 (0.918–0.986)	0.006 ${}^{*}$		NS
Sex	0.762 (0.391–1.484)	0.424			1.599 (0.715–3.577)	0.253
Platelets	0.978 (0.964–0.993)	0.203			0.977 (0.958–0.996)	0.112
Hb	1.227 (1.03–1.462)	0.022 ${}^{*}$		NS	0.919 (0.728–1.16)	0.477
WBCs	1.004 (0.995–1.014)	0.03 ${}^{*}$		NS	0.977 (0.958–0.996)	0.018	0.971 (0.946–0.997)	0.03 ${}^{*}$
BM Blast	1.05 (0.97–1.13)	0.001 ${}^{*}$		NS	1.02 (0.98–1.06)	0.189
ASXL-1	0.09 (0.04–0.201)	0.001 ${}^{*}$	0.104 (0.046–0.235)	0.002 ${}^{*}$	0.116 (0.025–0.532)	0.006 ${}^{*}$	0.007 (0.001–0.6)	0.03 ${}^{*}$
FLT-3	1.955 (1–3.823)	0.049 ${}^{*}$	2.325 (1.143–4.726)	0.02 ${}^{*}$	5.638 (2.454–12.955)	0.001 ${}^{*}$	18.425 (1.658–204.721)	0.02 ${}^{*}$
AML cause	4.15 (1.596–10.789)	0.004 ${}^{*}$	3.579 (1.26–10.161)	0.02 ${}^{*}$	1.786 (0.24–13.27)	0.571
Cytogenetic	0.82 (0.466–1.443)	0.491			1.362 (0.803–2.309)	0.251

HR: hazard ratio, 95% CI: 95% confidence interval.

3.7 Univariate and multivariate Cox-regression analyses for survival

FLT3-ITD and ASXL1 mutations were found to be independent risk factors for OS in AML patients in univariate and multivariate analyses ( $P=$ 0.049, $<$ 0.001, 0.02 and 0.002) respectively. They were independent risk factors for RFS in AML patients in univariate and multivariate analyses, as well ( $P=$ 0.001, 0.006, 0.02 and 0.03 respectively). Secondary AML was an indepedent risk factor for OS in AML patients in univariate and multivariate analyses ( $p=$ 0.004 and 0.02 respectively). WBCs count was a significant univariate risk factor for OS and RFS ( $P=$ 0.03 and 0.018 respectively). It was a significant risk factor for RFS in multivariate analysis, as well ( $P=$ 0.03). Age was significant RFS in univariate analysis ( $P=$ 0.006) (Table 8).

4. Discussion

In this work, we tried to evaluate the role of FLT3-ITD and ASXL1 genes’ mutation in the prognosis of AML patients with trial to demonstrate the impact of coexistence of both genes’ mutation on the outcome of patients. We detected FLT3-ITD mutation in 17 patients (20.5%) and ASXL1 gene mutation in 15 patients (18.1%). These results were in accordance with each of Awad et al. and Wang et al. who detected FLT3-ITD mutation in 18.5% of their patients [29, 30], Kandel et al. who detected it in 21.4% [31], and Schnittger et al. who detected ASXL1 gene mutation in 17.2% of their patients [32]. However, Prats-Martín et al. found ASXL1 gene mutation in 31% of myelodysplasia-related changes AML patients [33].

In our study, patients with FLT3-ITD mutation were significantly younger than patients with ASXL1 gene mutation and were younger than patients with co-expression of both mutations. Besides, age was a significant predictor for FLT3-ITD mutation, and it was an independent univariate risk factor for RFS. Several studies supported our results [24, 27, 34]. Other previous studies supported that ASXL1 mutations in AML were more common in older patients [30, 31]. In our study, we detected no significant difference between patients with FLT3-ITD mutation or those with ASXL1 gene mutation as regard gender. On the other hand, Juliusson et al. detected that females more often had FLT3-ITD mutation [34] while Paschka et al. found that ASXL1 gene mutations were more associated with the male gender [35]. This difference may be attributed to the difference in ethnicity and the sample size.

In our study, WBCs count was significantly higher in patients with FLT3-ITD mutation compared with those with ASXL1 gene mutation or patients with co-expression of both mutations. This was supported by Paschka et al. [35]. On the other hand, Kakosaiou et al. found that ASXL1 gene mutation was associated with higher peripheral leukocytosis [36]. In our work, WBCs count was a significant predictor of FLT3-ITD mutation and was a significant univariate independent risk factor for OS in AML patients. Lagunas-Rangel and Chávez-Valencia found that FLT3-ITD has been strongly associated with a bad prognosis, leukocytosis, high blast counts, increased risk of relapse and shorter OS [8]. In addition, de Jonge et al. demonstrated that high WBC count and FLT3-ITD/FLT3 ratio were important prognostic factors in patients with AML [21].

We found that AXL1 mutation was more associated with secondary type AML. This is supported by Paschka et al., Kakosaioua et al. and Prats-Martín et al. who found that ASXL1 mutation was more associated with secondary AML [35, 36, 33]. Secondary AML was found to be a significant predictor for ASXL1 mutation, and it was found to be an independant risk factor for OS in univariate and multivariate analyses in our patients. Different from our results, Fathi and Chen found that FLT3-ITD mutation was present in a quarter of patients with de novo AML [37].

In our study, ASXL1 mutation was more associated with intermediate cytogenetic risk while FLT3-ITD mutation was associated with poor one. These results are following Awad et al. and Prats-Martín et al. [29, 33]. Prats-Martín et al. stated that ASXL1 mutations have been reported in up to 35% of AML patients with intermediate-risk [33]. This is different from the results of Lin et al. who found that the ASXL1 mutation was more frequent in normal karyotype CN-AML patients and Tao et al. who found that FLT3-ITD was common in AML patients with normal karyotype [20, 38]. This discrepancy may be due to the different cytogenetic types in different races.

In our study, the poor cytogenetic risk was a significant predictor of FLT3-ITD mutation but the cytogenetic risk was not an independent risk factor for OS or RFS. FLT3-ITD and ASXL1 mutations were more associated with partial response to treatment compared to the non-mutant FLT3 and ASXL1. Both mutations were more associated with poor outcomes compared to the non-mutant types but there was no significant difference between both mutations regarding the outcome of the patients.

Concerning the possible role of gene mutations on the prognosis of AML, our survival study after a follow-up period of 33 months found the mean survival period was shorter and the number of relapses was more frequent and RFS were less common in FLT3-ITD and ASXL1 mutations compared to non-mutant types. Boddu et al. found that patients with FLT3-ITD have a high risk of relapse and a low cure rate [39]. Hand by Hand with these results, Wang et al. stated that FLT3-ITD mutation can predict prognosis in AML and it is associated with shortened RFS and OS [30].

Prats-Martín et al. concluded that ASXL1 mutation could be the worst outcome marker in de novo AML and they demonstrated that ASXL1 mutations were associated with inferior response rates and survival [33]. Poor prognostic role of ASXL1 and FLT3-ITD in AML was supported by Yu et al. [40] who confirmed that ASXL1 mutation is associated with poor prognosis in older patients who had a higher incidence of mutation, and Lyu et al. who found that FLT3-ITD was related to worse CR and OS. They also stated that FLT3-ITD may serve as an independent prognostic factor for OS in non-M3 AML patients [41]. Niparuck et al. had shown that FLT3-ITD can predict the outcome in patients with adult AML and showed poor RFS and OS [1]. Because of this bad prognosis of AML patients with FLT3-ITD mutation, Helbig et al. advised that these patients should proceed to allogeneic stem cell transplantation as soon as possible in the disease course [42].

ASXL1 and FLT3-ITD were independent predictors of OS and RFS but Hb, WBCs count, BM blast were independent predictors of OS. Dohner et al. found that older age $\geqslant$ 65 years and higher WBCs were associated with worse OS [43]. Sasaki et al. found that older age, peripheral blood neutrophil percentage and adverse cytogenetic abnormalities were adverse prognostic factors in AML patients with ASXL1 mutation. They also found that age, secondary AML, WBCs count, adverse cytogenetic risk stratification, and other mutations are poor prognostic factors for OS [44].

5. Conclusion

ASXL1 mutation, FLT3-ITD or co-existence can predict poor OS and RFS in Egyptian AML patients. Age, WBCs count, secondary AML and poor cytogenetic risk are significant predictors of FLT3-ITD and ASXL1 mutations which are independent risk factors for OS in these patients.

5.1 Limitations and recommendations

The results of this study are limited by the relatively small number of participants from a single center. Besides, patients with severe co-morbidities, M3 subtype and pregnant females were excluded from the study. Moreover, ethnic variation must be put into consideration as this study was performed on Egyptians only. Our results need to be confirmed by further prospective randomized controlled studies with an increased number of participants, ethnic variations, and multi-centric cooperation. From our results, we recommend the combination of ASXL1 mutation and FLT3-ITD as prognostic markers in AML patients.

Author contributions

Conception: Huda F. Ebian

Interpretation or analysis of data: Samia Hussein, Ahmad Embaby Haitham Mohamed, Tarek Khamis and Norhan A. Sabbah

Preparation of the manuscript: Huda F. Ebian and Samia Hussein

Revision for important intellectual content: Reham Sameh and Samia Hussein

Supervision: Huda F. Ebian and Sherin Elshorbagy

Funding

None.

Footnotes

Acknowledgments

None.

Conflict of interest

None.

References

Niparuck

et al., Cytogenetics and FLT3-ITD mutation predict clinical outcomes in non transplant patients with acute myeloid leukemia, Experimental Hematology & Oncology 30(8) (2019), 3.

Bennett

J.M.

et al., Proposed revised criteria for the classification of acute myeloid leukemia, A report of the French-American-British Cooperative Group, Annals of Internal Medicine 103 (1985), 620–625.

Döhner

et al., Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel, Blood 129(4) (2017), 424–447.

Mrózek

and Bloomfield

C.D.

, Chromosome Aberrations, Gene Mutations and Expression Changes, and Prognosis in Adult Acute Myeloid Leukemia, Hematology, American Society of Hematology, Education Program (2006), 169–177.

Suguna

et al., Acute myeloid leukemia: Diagnosis and management based on current molecular genetics approach, Cardiovascular & Hematological Disorders Drug Targets 18(3) (2018), 199–207.

Kayser

and Levis

M.J.

, FLT3 tyrosine kinase inhibitors in acute myeloid leukemia: Clinical implications and limitations, Leukemia & Lymphoma 55(2) (2014), 243–255.

Kishtagari

and Levine

R.L.

, The role of somatic mutations in acute myeloid leukemia pathogenesis, Cold Spring Harbor Perspectives in Medicine 11(4) (2021), a034975.

Lagunas-Rangel

F.A.

and Chávez-Valencia

, FLT3-ITD and its current role in acute myeloid leukaemia, Medical oncology (Northwood, London, England) 34(6) (2017), 114.

Asada

et al., The role of ASXL1 in hematopoiesis and myeloid malignancies, Cellular and Molecular Life Sciences 76(13) (2019), 2511–2523.

10.

Abdel-Wahab

et al., ASXL1 mutations promote myeloid transformation through loss of PRC2-mediated gene repression, Cancer Cell 22(2) (2012), 180.

11.

Inoue

et al., A novel ASXL1-OGT axis plays roles in H3K4 methylation and tumor suppression in myeloid malignancies, Leukemia 32(6) (2018), 1327.

12.

Park

U.H.

et al., Additional sex comb-like (ASXL) proteins 1 and 2 play opposite roles in adipogenesis via reciprocal regulation of peroxisome proliferator-activated receptor gamma, The Journal of Biological Chemistry 286(2) (2011), 1354–1363.

13.

Bejar

et al., Clinical effect of point mutations in myelodysplastic syndromes, The New England Journal of Medicine 364(26) (2011), 2496–2506.

14.

D’Altri

et al., The ASXL1-G643W variant accelerates the development of CEBPA mutant acute myeloid leukemia, Haematologica 106(4) (2021), 1000–1007.

15.

Saika

et al., ASXL1 and SETBP1 mutations promote leukaemogenesis by repressing TGFβ pathway genes through histone deacetylation, Scientific Reports 8 (2018), 15873.

16.

Hoischen

et al., De novo nonsense mutations in ASXL1 cause bohring-opitz syndrome, Nature Genetics 43(8) (2011), 729.

17.

Abdel-Wahab

et al., Deletion of Asxl1 results in myelodysplasia and severe developmental defects in vivo , The Journal of Experimental Medicine 210(12) (2013), 2641–2659.

18.

Wang

et al., Loss of Asxl1 leads to myelodysplastic syndrome-like disease in mice, Blood 123(4) (2014), 541–553.

19.

Gelsi-Boyer

et al., Mutations in ASXL1 are associated with poor prognosis across the spectrum of malignant myeloid diseases, Journal of Hematology & Oncology 5 (2012), 12.

20.

Lin

et al., Clinical characteristics and prognostic study of adult acute myeloid leukemia patients with ASXL1 mutations, Hematology (Amsterdam, Netherlands) 25(1) (2020), 446–456.

21.

de Jonge et al.

H.J.

,Prognostic impact of white blood cell count in intermediate risk acute myeloid leukemia: Relevance of mutated NPM1 and FLT3-ITD,Haematologica,96(9)(2011),1310–1317.

22.

Rose

et al., Subtype-specific patterns of molecular mutations in acute myeloid leukemia, Leukemia 31(1) (2017), 11–17.

23.

Ibáñez

et al., Rapid screening of ASXL1, IDH1, IDH2, and c-CBL mutations in de novo acute myeloid leukemia by high-resolution melting, The Journal of Molecular Diagnostics 14 (6), 594–601. Erratum in The Journal of molecular diagnostics 15(2) 2013, 280.

24.

Arber

D.A.

et al., Acute myeloid leukaemia (AML) and related precursor neoplasms, in: WHO classification of tumours of haematopoietic and lymphoid tissues Swerdlow

S.H.

et al., eds., IARC Press Lyon, France, 2017, pp. 130–171.

25.

Bain

B.J.

et al., General haematology task force of the british committee for standards in haematology (BCSH), british society of haematology, Revised guideline on immunophenotyping in acute leukaemias and chronic lymphoproliferative disorders, Clinical and Laboratory Haematology 24(1) (2002), 1–13.

26.

Nakao

et al., Internal tandem duplication of the flt3 gene found in acute myeloid leukemia, Leukemia 10(12) (1996), 1911–1918.

27.

Yannakou

C.K.

et al., ASXL1 c.1934 dup; p.Gly646Trpfs*12-a true somatic alteration requiring a new approach, Blood Cancer Journal 7(12) (2017), 656.

28.

Chen

Y.B.

et al., Busulfan dose intensity and outcomes in reduced-intensity allogeneic peripheral blood stem cell transplantation for myelodysplastic syndrome or acute myeloid leukemia, Biology of Blood and Marrow Transplantation: Journal of the American Society for Blood and Marrow Transplantation 19(6) (2013), 981–987.

29.

Adnan-Awad

et al., FLT3-ITD mutations in egyptian patients of acute myeloid leukemia: Correlation with cytogenetic, FAB subgroups and prognosis, Clinical Laboratory 63(5) (2017), 1027–1034.

30.

Wang

et al., FLT3-ITD and CEBPA mutations predict prognosis in acute myelogenous leukemia irrespective of hematopoietic stem cell transplantation, Biology of Blood and Marrow Transplantation: Journal of the American Society for Blood and Marrow Transplantation 25(5) (2019), 941–948.

31.

Kandeel

E.Z.

et al., Impact of FLT3 receptor (CD135) detection by flow cytometry on clinical outcome of adult acute myeloid leukemia patients, Clinical Lymphoma, Myeloma & Leukemia 18(8) (2018), 541–547.

32.

Schnittger

et al., ASXL1 exon 12 mutations are frequent in AML with intermediate risk karyotype and are independently associated with an adverse outcome, Leukemia 27 (2013), 82–91.

33.

Prats-Martín

, et al., ASXL1 mutation as a surrogate marker in acute myeloid leukemia with myelodysplasia-related changes and normal karyotype, Cancer Medicine 9(11) (2020), 3637–3646.

34.

Juliusson

et al., The prognostic impact of FLT3-ITD and NPM1 mutation in adult AML is age-dependent in the population-based setting, Blood Advances 4(6) (2020), 1094–1101.

35.

Paschka

et al., ASXL1 mutations in younger adult patients with acute myeloid leukemia: A study by the German-Austrian Acute Myeloid Leukemia Study Group, Haematologica 100(3) (2015), 324–330.

36.

Kakosaiou

et al., ASXL1 mutations in AML are associated with specific clinical and cytogenetic characteristics, Leukemia & Lymphoma 59(10) (2018), 2439–2446.

37.

Fathi

A.T.

and Chen

Y.B.

, Treatment of FLT3-ITD acute myeloid leukemia, American Journal of Blood Research 1(2) (2011), 175–189.

38.

Tao

et al., Prognosis and outcome of patients with acute myeloid leukemia based on FLT3-ITD mutation with or without additional abnormal cytogenetics, Oncology Letters 18(6) (2019), 6766–6774.

39.

Boddu

P.C.

et al., Validation of the 2017 European Leukemia Net classification for acute myeloid leukemia with NPM1 and FLT3-internal tandem duplication genotypes, Cancer 125(7) (2019), 1091–1100.

40.

et al., Clinical implications of recurrent gene mutations in acute myeloid leukemia, Experimental Hematology & Oncology 9 (2020), 4.

41.

Lyu

et al., The prognosis predictive value of FMS-like tyrosine kinase 3-internal tandem duplications mutant allelic ratio (FLT3-ITD MR) in patients with acute myeloid leukemia detected by GeneScan, Gene 726 (2020), 144195.

42.

Helbig

et al., Pre-transplant FLT3/ITD status predicts outcome in FLT3-mutated acute myeloid leukemia following allogeneic stem cell transplantation, Annals of Hematology 99(8) (2020), 1845–1853.

43.

Döhner

et al., Impact of NPM1/FLT3-ITD genotypes defined by the 2017 European Leukemia Net in patients with acute myeloid leukemia, Blood 135(5) (2020), 371–380.

44.

Sasakiet al.

, Impact of the variant allele frequency of ASXL1, DNMT3A, JAK2, TET2, TP53, and NPM1 on the outcomes of patients with newly diagnosed acute myeloid leukemia, Cancer 126(4) (2020), 765–774.

Clinical implication and prognostic significance of FLT3-ITD and ASXL1 mutations in Egyptian AML patients: A single-center study

Abstract

BACKGROUND:

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSION:

Keywords

Abbreviations

1. Introduction

Table 1 Characteristics of the different subtypes of AML according to FAB criteria (Bennett et al., 1985)

2.1 Experimental subjects

2.2 Flow cytometric immunophenotyping for standard acute leukemia panel

2.3 Polymerase chain reaction (PCR) for FLT3-ITD

2.4 Molecular detection of ASXL1 gene mutatuion

3. Results

Table 2 Demographic and basic characteristics among the studied groups

Table 3 Relation between FLT3-ITD and basic characteristics of AML patients

3.3 Comparison between patients with FLT3-ITD mutation and those with ASXL1mutation

Table 5 Relation between mutant ASXL-1 gene, mutant FLT-3 gene and co-expression of both among studied cases

3.5 Survival study of AML patients with FLT3-ITD and ASXL1 mutations

Table 7 Multivariate analysis of significant predictors of FLT3-ITD and ASXL1 mutations

4. Discussion

5. Conclusion

5.1 Limitations and recommendations

Author contributions

Funding

Footnotes

Acknowledgments

Conflict of interest

References

Table 1
Characteristics of the different subtypes of AML according to FAB criteria (Bennett et al., 1985)

Table 2
Demographic and basic characteristics among the studied groups

Table 3
Relation between FLT3-ITD and basic characteristics of AML patients

Table 5
Relation between mutant ASXL-1 gene, mutant FLT-3 gene and co-expression of both among studied cases

Table 7
Multivariate analysis of significant predictors of FLT3-ITD and ASXL1 mutations