Mammalian SIRT4 is a tumor suppressor of clear cell renal cell carcinoma by inhibiting cancer proliferation,migration and invasion

Abstract

OBJECTIVE:

Sirtuins family are defined as class III histone deacetylases (HDACs). Recently, mammalian silent information regulator two 4 (SIRT4) has been reported to be a tumor suppressor gene in multiple cancers. The objective of the present study was to explore the potential role of SIRT4 in clear cell renal cell carcinoma (ccRCC).

METHODS:

We estimated SIRT4 expression levels in ccRCC and its adjacent non-neoplastic tissue by Western blotting (WB), quantitative real-time polymerase chain reaction (qRT-PCR) and bioinformatics data, the clinical and survival data were also collected and analyzed. In vitro study, ccRCC cell lines were transfected with SIRT4-siRNA or lentivirus to downregulate or overexpress the expression level of SIRT4. Then, the proliferation capacity of tumor cell was assessed by 5-Ethynyl-2’-deoxyuridine (EDU) assay, cell migration and invasion capacity were assessed by Transwell assays.

RESULTS:

Our results indicated that the expression level of SIRT4 in ccRCC was significantly lower than the corresponding normal tissues ( $P<$ 0.001). Meanwhile, bioinformatics data and the result of WB showed that low SIRT4 expression level was obviously involved with poor overall survival and advanced tumor stage in ccRCC patients. Biological experiments demonstrated that overexpression of SIRT4 significantly reduced the proliferation, migration and invasion ability of ccRCC cells. Conversely, downregulation of SIRT4 enhanced the proliferation, migration and invasion ability of ccRCC cells.

CONCLUSIONS:

These findings support that SIRT4 acts as a tumor suppressor in ccRCC and might be a novel biomarker and new therapeutic target for ccRCC.

1. Introduction

Clear cell renal cell carcinoma (ccRCC) is the most common malignant tumor of the kidney, which account for 2–3% of all adult cancers worldwide. It arises from the proximal tubular epithelium and usually aggressive and lethal for the patients due to no obvious clinical symptoms in the early stages [1, 2]. Studies have found that the pathogenesis of ccRCC is tightly related to metabolic reprogramming, particularly in glucose and fatty acid metabolism. In this regard, consecutive activation of hypoxia inducible factor (HIF) signaling caused by von Hippel-Lindau (VHL) mutations and abundant intracellular lipid droplets are two pivotal hallmarks of ccRCC [3]. In addition, metabolism of tryptophan, arginine and glutamine are also reprogrammed in ccRCC, renal cancer actually can be considered as a metabolic disease to some extent [4]. Although these results have significantly accelerated the development of molecular targeted therapy for ccRCC, the therapeutic effect is still not ideal for patients with advanced tumor stage [5]. Thus, it has great significance to investigate novel biomarkers and effective therapeutic targets for ccRCC.

Mammalian silent information regulator two (SIRT) is a highly conserved family and acts as a group of nicotinamide adenine dinucleotide (NAD ${}^{+}$ )-dependent histone deacetylase. Although the seven members (SIRT1-7) share a conserved catalytic core domain, they have different enzyme activities and biological functions [6]. Among them, mitochondrial SIRT4 is widely expressed in human organs and tissues, it has the catalytic activities of ADP-ribosyltransferase, NAD ${}^{+}$ -dependent deacetylase, lipoamidase, and long chain-deacylase, which regulate the function of substrate proteins via diversified post-translational modifications. SIRT4 has been shown to play a crucial role in insulin secretion, fatty acid oxidation, amino acid metabolism, ATP homeostasis and cellular apoptosis [7, 8]. In addition, recent studies indicated that SIRT4 has tumor suppressor function by regulating cellular glutamine metabolism [9]. However, the function of mammalian SIRT4 in human cancer is still incompletely clear and no studies have investigated its role in ccRCC before.

In the current study, we explored the mRNA and protein expression level of SIRT4 in ccRCC specimens and analyzed the association between SIRT4 levels and some clinicopathological features. Meanwhile, cell functional experiments were conducted to investigate the effects of SIRT4 on ccRCC cell proliferation, migration, and invasion.

2. Materials and methods

2.1 Tissue specimens and clinical data collection

A total of 100 paired ccRCC tumor tissues and adjacent noncancerous tissues were collected from the Department of Urology, the First Hospital of China Medical University between February 2015 to April 2018. These fresh tissues were immediately frozen in liquid nitrogen and stored at $-$ 80 ${}^{\circ }$ C prior to use. All the patients received surgical resection and diagnosed as ccRCC histologically. None of the subjects accepted preoperative chemotherapy or radiotherapy. The written informed consent was signed by all patients and the experiments of this study were approved by the Ethics Committee on Human Research of the First Affiliated Hospital of Chinese Medical University. The clinical data of the 88 patients was obtained from medical records at the First Affiliated Hospital of Chinese Medical University.

2.2 Bioinformatics analysis

At first, we collected the data from the Gene Expression Omnibus (GEO) DataSets (https://www.ncbi.nlm. nih.gov/gds/). The accession number, GSE53757 and probe 220047_at were used. GEO2R (https://www.ncbi. nlm.nih.gov/geo/geo2r/) was performed to compare the tumor group with the normal group. Then, the expressive and survival information were obtained from another database, The Cancer Genome Atlas (TCGA), all the data and figures were processed by GEPIA2 (http://gepia2.cancer-pku.cn/#index).

2.3 Cell culture and transfection

The human ccRCC cell lines 786-O, ACHN, CAKI-1 were obtained from the Chinese Academy of Sciences, Type Culture Collection Cell Bank (Shanghai, China). 786-O cells were cultured in RPMI-1640 medium (HyClone; GE Healthcare, Logan, UT, USA); ACHN cells were cultured in MEM medium (HyClone, Logan, UT, USA) and CAKI-1 cells were cultured in McCoy’s 5A medium (HyClone, Logan, UT, USA); All media were supplemented with 10% fetal bovine serum. The cells were washed with 1 $\times$ PBS and 0.25% trypsin-EDTA (TBD, China) at 37 ${}^{\circ }$ C for several minutes for cell count and passage cultivation. All cancer cell lines were cultured in a humidified atmosphere with 5% CO2 at 37 ${}^{\circ }$ C.

The expression of SIRT4 in ccRCC cells were regulated by transfecting with siRNA or lentivirus. ACHN and CAKI-1 cell lines were transfected with two SIRT4 specific siRNA (JTS scientific, Wuhan, China) using GoldenTran-R reagent (Golden Transfer Science and Technology Co.Ltd. Changchun, China) according to the manufacturer’s guidelines. The medium was replaced after 8 h, the transfection efficiency and experiments were performed after 48 h. The sequences of SIRT4-siRNA as follows (5’-3’): SIRT4-siRNA-1, forward, GCACAAGCGUGUAAAAGAATT and reverse, UUCUUUUACACGCUUGUGCAC; SIRT4-siRNA-2, forward, GAAGCUCCCGAUUGCAAUATT and reverse, UAUUGCAAUCGGGAGCUUCTT. 786-O and CAKI-1 cell lines overexpressing SIRT4 were constructed by transfected with pRlenti-CMV-SIRT4-3FLAG-PGK-Puro lentivirus vector purchased from OBiO Technology Corp., Ltd. (Shanghai, China), The titer of the lentivirus and negative control were 7.3 $\times$ 10 ${}^8$ TU/ml and 1.98 $\times$ 10 ${}^9$ TU/ml respectively, the final transfection MOI value was 20. 1 ug/ml puromycin was used for selecting the stable expression cell lines for about 15 days. The whole processe was abided by the manufacturer’s instructions.

2.4 RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)

The total RNA was extracted from clinical tissues and cultured cells using RNAiso Plus (Takara Biotechnology; Dalian, China) according to the manufacturer’s recommendations. Then, the PrimeScript ${}^{\text{TM}}$ RT Master Mix (Takara Biotechnology, Dalian) was used to synthesize the cDNA and qRT-PCR was performed using the SYBR Premix EX Taq ${}^{\text{TM}}$ (Takara Biotechnology, Dalian), $\beta$ -actin was set as the internal parameter. 2 ${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{CT}}$ method was applied to calculate the final results. The primer sequences (5’-3’) were as follows: $\beta$ -actin (forward, CATGTACGTTGCTATCCAGGC and reverse, CTCCTTAATGTCACGCACGAT); SIRT4 (forward, AGCCTCCATTGGGTTATTTGTG and reverse, TCTGGTATCCCCGATTCGGT).

2.5 Western blotting (WB)

All the proteins extracted from tissues and cells were lysed in radioimmunoprecipitation assay (RIPA) buffer. Protein concentrations were detected using a bicinchoninic acid assay kit. Equal amounts of proteins were separated by 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes. Then, the membranes were sealed with 5% non-fat milk at 37 ${}^{\circ }$ C for 1 hour followed by washing with Tris-buffered saline containing 0.1% Tween-20 (TBST) and incubating overnight with primary anti-SIRT4 (1:200, sc-135797, Santa Cruz Biotechnology), anti- $\beta$ -tubulin (1:1000, 2128S, CST) antibodies at 4 ${}^{\circ }$ C. The membranes were washed with TBST for 3 times (5 min per time) and incubated with the corresponding secondary antibodies at 37 ${}^{\circ }$ C for 1 hour. Subsequently, the membranes were washed with TBST once again and an EasySee Western Blot kit (Beijing Transgen Biotech, Beijing, China) was used for detection the results. Finally, quantitative analysis was performed by ImageJ software.

2.6 5-Ethynyl-2’-deoxyuridine (EDU) assay

ccRCC cells were transfected with SIRT4 siRNA (48 h) or lentivirus (stable cell lines) were seeded in 24-well plates. When the confluence of the adherent cells was about 80%, The diluted EDU solution (1:1000, BeyoClick ${}^{\text{TM}}$ , EDU-488, China) was added to cell medium. Then, the cells were cultivated at 37 ${}^{\circ }$ C for 2 hours and followed by the manufacturer’s operative instructions. The images were obtained using a fluorescence microscope (Olympus Corporation, Japan) and the results analysis were carried out by ImageJ software.

2.7 Transwell assay

Transwell chambers with 8- $\mu$ m pores matched with 24-well plates were used for cell migration and invasion assays. Transwell chambers coated with Matrigel (BD, San Diego, CA, USA) were used for cell invasion assays, but cell migration assays were measured by the chambers without Matrigel. 600 $\mu$ l of medium (10% FBS) was added to the plate bottom of the chamber. Then, a certain number of ccRCC cells (786-O and ACHN: 10000/chamber; CAKI-1: 20000/chamber) were re-suspended with 200 ul serum-free medium and added to the upper chamber. After incubation at 37 ${}^{\circ }$ C for 24 h (migration assays) or 36 h (invasion assays), total cells remained on the upper chamber were removed using cotton swabs, and those that had migrated to the lower side were fixed with 4% paraformaldehyde for 10 min, and stained with 1.0% crystal violet for 10 min at room temperature. After the chambers were washed by 1 $\times$ PBS, the images were captured by EVOS ${}^{\text{TM}}$ XL Core Imaging system (Invitrogen; Thermo Fisher Scientific, Inc.) and dealt with ImageJ software.

2.8 Statistical analysis

Statistical analysis in the present study was performed by GraphPad Prism version 7.0 software. Paired $t$ -test (two tailed) was used to compare the expression level of SIRT4 in tumor and non-tumor samples. The correlation between SIRT4 expression and clinicopathological parameters was assessed by chi-square test. All in vitro experiments were performed at least three times independently. The data was present as mean $\pm$ SD and paired Student’s $t$ -test was used for comparisons. Statistical significance was be considered when $P<$ 0.05. In the table and all figures, *, ** and *** represent $P<$ 0.05, $P<$ 0.01 and $P<$ 0.001.

Figure 1.

Expression level of SIRT4 was significantly downregulated in ccRCC tumor tissues compared to adjacent normal tissues and low SIRT4 expression level predicted poor prognosis of ccRCC patients. A. The mRNA expression level of SIRT4 obtained from GEO database. B. The mRNA expression level of SIRT4 from TCGA database. C. The mRNA expression level of SIRT4 in 63 pairs of clinical specimens. D. The tumor stage of ccRCC patients were inversely correlated with SIRT4 expression from TCGA database. Kaplan-Meier curve collected from TCGA database showed patients with high SIRT4 mRNA expression exhibited a significantly longer overall survival than patients with low SIRT4 mRNA expression in two different group cut-off programs (E. Median; F. Quartile). G and H. SIRT4 protein levels in 88 pairs of ccRCC and adjacent normal tissues detected by WB.

3. Results

3.1 SIRT4 mRNA expression level was significantly decreased in ccRCC tissues and lower expression level associated with advanced tumor stage and poor prognosis

For mRNA level, we firstly collected the information from GEO dataset (GSE53757), the data in the microarray indicated SIRT4 mRNA expression level was obviously lower in ccRCC tissues ( $P<$ 0.001, Fig. 1A). Data from The Cancer Genome Atlas (TCGA) database analyzed by GEPIA2 (http://gepia2.cancer-pku.cn/#index) exhibited almost the same result (Fig. 1B). Then, we applied qRT-PCR to detect the SIRT4 mRNA levels of 63 pairs of ccRCC tissues and neighboring normal tissues in our laboratory, as expected, SIRT4 mRNA level was decreased in ccRCC tissues ( $P<$ 0.001, Fig. 1C). Furthermore, stage plot analysis and survival analysis by two different group cutoff programs were performed by GEPIA2 matched TCGA database. The results revealed patients with low SIRT4 mRNA expression displayed advanced tumor stage ( $P<$ 0.01, Fig. 1D) and poor overall survival ( $P<$ 0.001, Fig. 1E and F).

Table 1

Correlation between SIRT4 expression and the clinicopathological features of ccRCC patients

Variables	Group	Number	SIRT4 expression		$P$ -value
			High ( $n=$ 44)	Low ( $n=$ 44)
Gender	Male	60	29	31	0.3236
	Female	28	15	13
Age	$⩾$ 60	42	22	20	0.3347
	$<$ 60	46	22	24
Tumor size (cm)	$⩽$ 4	35	20	15	0.1381
	$>$ 4	53	24	29
T stage	T1/T2	82	42	40	0.1988
	T3/T4	6	2	4
Fuhrman grade	I/II	60	34	26	0.0336 ${}^{\mathrm{*}}$
	III/IV	28	10	18
Distant metastasis	Positive	2	1	1	–
Lymphatic metastasis	Positive	0	0	0	–

Figure 2.

Detection result for establishment of human ccRCC cell lines with upregulated or downregulated expression of SIRT4 by qRT-PCR or WB. A. As displayed by qRT-PCR and WB, SIRT4 expression was decreased in ACHN cell line at 48 hours after transfection of two SIRT4 specific siRNA. B. SIRT4 expression was also decreased in CAKI-1 cell line similarly to ACHN cell line. C. As displayed by WB, SIRT4 expression was stably increased in 786-O cell line after being infected with lentivirus. D. SIRT4 expression was also increased in CAKI-1 cell line similarly to 786-O cell line.

Figure 3.

EDU assay suggested that SIRT4 inhibits ccRCC cell lines proliferation capacity. A. Downregulation of SIRT4 enhanced the proliferation ability of ACHN cell line and overexpression of SIRT4 significantly reduced the proliferation ability of 786-O cell line. B. relative count of EDU positive cells of ACHN and 786-O cell lines. C. Downregulation of SIRT4 could elevate the proliferation of CAKI-1 cell line, Conversely, overexpression of SIRT4 obviously repressed the proliferation of CAKI-1 cell line. D. relative count of EDU positive cells of CAKI-1 cell line.

Figure 4.

Transwell assay indicated that SIRT4 inhibits ccRCC cell lines migration and invasion capacity. A. Downregulation of SIRT4 enhanced the migration and invasion ability of ACHN cell line. B. Overexpression of SIRT4 significantly reduced the migration and invasion ability of 786-O cell line. C. Downregulation of SIRT4 improved the migration and invasion of CAKI-1 cell line. D. Overexpression of SIRT4 obviously repressed the migration and invasion of CAKI-1 cell line.

3.2 SIRT4 protein expression level was significantly lower in ccRCC tissues and the expression was decreased in advanced Fuhrman staged

To further investigate the protein expression of SIRT4 in ccRCC tissues, we detected 88 paired specimens of ccRCC patients in our central using WB. Then, all the samples were divided into high and low expression group based on the median SIRT4 protein expression level, some clinicopathological parameters were compared in these two group. In the majority of ccRCC tissues, SIRT4 protein level was downregulated compared to the matched surrounding tissues ( $P<$ 0.01, Fig. 1G and H). With respect to the correlation between SIRT4 expression and clinicopathological features, SIRT4 protein expression level was progressively decreased with advanced Fuhrman staged ( $P<$ 0.05). But it had no statistical significance with gender, age, tumor size and TNM stage. The number of patients with distant and lymphatic metastasis was too small to be assessed (Table 1).

3.3 Establishment of ccRCC cell lines with upregulated and downregulated of SIRT4 expression

In vitro experiments, ACHN and CAKI-1 cell lines were used for downregulated evaluation by transfecting with siRNA. CAKI-1 and 786-O cell lines were used for overexpressing assessment by infection with lentivirus. In order to verify that the expression of SIRT4 has indeed changed, both qRT-PCR and WB were performed. The expression level of SIRT4 was truly downregulated in ACHN and CAKI-1 cell lines at 48 hours after transfection of two SIRT4 specific siRNA (Fig. 2A and B), and it was steadily overexpressed in 786-O and CAKI-1 cell lines after lentivirus processing (Fig. 2C and D).

3.4 Human SIRT4 represses proliferation, migration and invasion ability of ccRCC cells

EDU assay was used for estimating cell proliferation capacity. The results suggested downregulation of SIRT4 enhanced the proliferation ability of ACHN and CAKI-1 cell lines (Fig. 3A and C). Conversely, overexpression of SIRT4 significantly reduced the proliferation ability of 786-O and CAKI-1 cell lines (Fig. 3A and C). Then, the effect of SIRT4 expression in cell migration and invasion ability was appraised by Transwell assay. As expected, ACHN and CAKI-1 cell lines with low SIRT4 expression possessed stronger migration and invasion capacity (Fig. 4A and C). On the contrary, migration and invasion capacity were strikingly declined in 786-O and CAKI-1 cell lines with overexpressing SIRT4 (Fig. 4B and D). In a word, the above data confirmed a notion that mammalian SIRT4 is a tumor suppressor of ccRCC.

4. Discussion

Radical surgery is the preferred treatment for treating ccRCC. But for locally advanced patients, the postoperative recurrence rate is very high and the overall survival time is pretty short [10]. In addition, ccRCC is not sensitive to chemotherapy, radiotherapy and traditional immunotherapy, some reports have pointed out that the molecular targeted drugs such as sunitinib and sorafenib could prolong the survival time of these patients. However, the specific mechanism and long-term therapeutic effect are still unclear [11]. Thus, exploring novel biomarkers and therapeutic targets of ccRCC has profound significance.

Sirtuins are defined as class III Histone deacetylases (HDACs). All of them share a highly conserved NAD ${}^{+}$ -binding catalytic core composed of about 270 amino acids, the varied N- and C-terminal sequences are involved with special subcellular localization and biological function [6]. Among SIRT1-7, mitochondria SIRT4 is widely expressed in human organs and tissues, especially in the heart, liver, kidney, spleen, prostate, testis and ovaries [12]. Nevertheless, it is the least well-known one because it possessed the conserved deacetylase domain, but lacked detectable histone deacetylase activity in early reports [13]. Studies had proved SIRT4 plays a crucial role in cellular metabolism. For example, SIRT4 could inhibit insulin secretion in pancreatic $\beta$ cells by repressing the activity of glutamate dehydrogenase (GDH) [14]. Besides, the deacetylation of SIRT4 on the malonyl CoA decarboxylase (MCD) decreased intracellular fatty acid oxidation [15]. In addition, SIRT4 also participated in regulating leucine metabolism and ATP homeostasis [16, 17].

In recent years, studies indicated that SIRT4 could act as a tumor suppressor in malignancies. The expression level of SIRT4 was lower in squamous cell carcinoma, hepatocellular carcinoma, non-small cell lung cancer, endometrioid adenocarcinoma, neuroblastoma, gastric carcinoma, colorectal cancer, invasive breast cancer, thyroid cancer and pancreatic cancer compared to the adjacent normal tissues. And decreased SIRT4 expression in most of these cancers was closely associated with worse clinicopathological parameters and poor prognosis. In vitro studies, overexpression of SIRT4 could suppress the migration, invasion and proliferation of cancer cell lines [18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28]. Moreover, several studies confirmed knockdown of SIRT4 in mouse embryonic fibroblast cells cultivates larger tumors and SIRT4 knockout mice developed lung cancer, liver cancer and breast cancer spontaneously [9, 29]. But no research has investigated the relationship between SIRT4 expression and ccRCC as for today.

In the present study, our data indicated that the expression of SIRT4 in ccRCC was strikingly lower than the corresponding noncancerous tissues both at mRNA and protein levels. Meanwhile, low SIRT4 expression level was obviously involved with poor overall survival and advanced tumor stage in ccRCC patients. In vitro, experiments demonstrated that overexpression of SIRT4 significantly reduced the proliferation, migration and invasion ability of ccRCC cells. Oppositely, downregulation of SIRT4 enhanced the proliferation, migration and invasion ability of ccRCC cells.

The inhibitory effect of SIRT4 on cancer is multi-mechanism actually. The dominating mechanism is that SIRT4 could repress the metabolism of glutamine through ADP-ribosylation on GDH, which cut off the energy and materials supply of the rapidly proliferating tumor cells [9, 25, 27]. Secondly, stresses induced the expression of SIRT4 which inhibits glutamine metabolism, and further arrests the cell cycle. It provided sufficient time for DNA damage repair and protected the stability of the genome [30]. Thirdly, SIRT4 could enhance the expression of E-cadherin and inhibit the expression of N-cadherin and vimentin in cancer cells, thus inhibiting the process of epithelial-mesenchymal transition (EMT) and reducing the migration and invasion ability of cancer cells [24, 25]. At last, aerobic glycolysis leads to the accumulation of intracellular acidic metabolites such as pyruvate and lactic acid, ammonia produced by glutamine metabolism could alleviate this pH imbalance and maintain the homeostasis of the intracellular environment. SIRT4 could destroy the balance of metabolic reprogramming in cancer cell and inhibit cell proliferation [31, 32]. In fact, some signal pathways and substrate molecules also have been reported, but it still needs more research to verify.

In conclusion, our date first time confirmed the human SIRT4 is a tumor suppressor of ccRCC. The expression of SIRT4 is decreased in ccRCC tissues and tightly related to the prognosis of these patients, overexpressing or knockdown SIRT4 in ccRCC cell lines could significantly change the cellular functions. These results suggested that SIRT4 may serve as a promising biomarker for ccRCC, and it might be an effective therapeutic target for improving the prognosis of ccRCC patients.