Downregulated GBX2 gene suppresses proliferation,invasion and angiogenesis of breast cancer cells through inhibiting the Wnt/ β -catenin signaling pathway

Abstract

This article has been retracted, and the online PDF replaced with this retraction notice.

1. Introduction

Breast cancer is a common disease among women, leading to more than approximately 400,000 deaths annually worldwide with one out of every eight women suffering from this disease [1, 2]. Furthermore, it has been proven that patients diagnosed with breast cancer receiving treatment, particularly chemotherapy, have been known to commonly suffer from fatigue, depressive symptoms, and sleep disturbance [3, 4]. These psychosocial impacts have been demonstrated to mitigated by cognitive behavioral therapy [5]. However, when these patients are receiving breast cancer treatment, patients are reported to resist chemotherapy, posing as serious problem to their recovery [6]. Angiogenesis, critical process for both the tumor growth and metastasis, has always been involved in both the development and vascular remodeling [7]. Angiogenesis can serve as a new target in cancer treatment, due in part to its association with a poor prognosis in various cancers, including breast and prostate cancers [8]. Therefore, based on the aforementioned information, the present study is being conducted to explore the underlying mechanism of gastrulation brain homeobox 2 (GBX2) gene which was reported to be putative oncogene candidate [9] in proliferation, invasion, and angiogenesis in breast cancer cells.

The Wnt/ $\beta$ -catenin family consist of various proteins exerting many cellular functions including organ formation, stem cell renewal, and cell survival [10]. Additionally, this pathway is an essential signal transduction pathway involved in both tumor genesis and progression [11, 12]. The Wnt/ $\beta$ -catenin signaling pathway was once shown to be activated in triple negative breast cancer (TNBC), implying that the Wnt/ $\beta$ -catenin signaling pathway could be a novel therapeutic target in the treatment of TNBC [13]. GBX2, a homeodomain transcription factor, is primarily expressed in thalamic neuronal precursors; its expression exists in mature neurons of the thalamic nuclei in adult [14]. GBX2 also identifies as one of the novel differentially-expressed genes detected in cervical cancer [9]. In most mouse embryonic stem cells (mESCs), an overexpressison of GBX2, as a LIF/Stat3 downstream target, has permitted the long-term expansion of undifferentiated mESCs in the absence of the LIF/Stat3 signaling pathway [15]. Thereby, we will investigate the role of GBX2 gene has on the development and progression of breast cancer, along the hypothesis that downregulation of the GBX2 gene inhibits proliferation, invasion, and angiogenesis in breast cancer through the inactivation of the Wnt/ $\beta$ -catenin pathway.

2. Materials and methods

2.1 Ethics statement

This study was approved by the Institutional Review Board of Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, the Affiliated Cancer Hospital of Nanjing Medical University, and in conformity with the Helsinki Declaration. Written informed consent was obtained from all patients or their parents or their guardians. The animal experiment conducted on mice in our research was carried out in strict accordance with the recommendations provided by the Guide for the Care and Use of Laboratory Animal of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee of Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, the Affiliated Cancer Hospital of Nanjing Medical University.

2.2 Differential analysis and construction of thermal map

In the Gene Expression Omnibus (GEO) database available at https://www.ncbi.nlm.nih.gov/geo/, we retrieved GSE33447 sequencing chip containing 8 breast cancer samples as well as 8 normal samples, with the sequencing platform found to be GPL14550. With $|\log \text{FC}|>$ 2, $p$ value $<$ 0.05 as screening criteria, the “limma” package in R Programming Language was applied in order to calculate for the differential analysis of both the breast cancer samples and normal samples. The “pheatmap” package in R Programming Language was used in order to construct the expression thermal map of differential genes.

2.3 Gene retrieval

Kyoto Encyclopedia of Genes and Genomes (KEGG) DISEASE (http://www.kegg.jp/kegg/disease/) is a database including various disease entries just concentrating on the perturbants owing to unknown details of molecular networks are for most diseases. Genes related to breast cancer were retrieved in this database with “breast cancer” as the key word.

2.4 Gene expression retrieval

UALCAN (http://ualcan.path.uab.edu/index.html) is a database providing resources for the analysis of cancer transcriptome data, which could be used in order to retrieve gene expressions of different tumors involved with The Cancer Genome Atlas (TCGA) database. After choosing the Analysis option and entering GBX2 in UALCAN, one could select breast cancer in the TCGA database to obtain the expression of GBX2 in breast cancer.

2.5 Survival analysis

The PROGgeneV2 database available at http://watson.compbio.iupui.edu/chirayu/proggene/database/index.php was used with the intent of retrieving the relationship between GBX2 expression and survival rates of patients suffering from breast cancer.

2.6 Study subjects

Breast cancer tissues were selected from 63 patients pathologically confirming as having a non-specific invasive breast cancer who underwent surgical resection in Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, the Affiliated Cancer Hospital of Nanjing Medical University from April, 2014 to August, 2016. All patients were no treated with any chemotherapy or radiotherapy, nor did they receive any hormone drugs prior to their operation. Simultaneously, the adjacent normal tissues were selected surrounding the breast cancer tissues as the control sample. Among these patients, there were 45 patients aged $<$ 50 years and 18 patients $⩾$ 50 years. According to the Bloom-Richardson semi-quantitative classification modified by both Elston and Ellis [16], the tissues were classified as being either grade I $+$ II ( $n=$ 38) or grade III ( $n=$ 25). The tumors were also categorized according to the guidelines provided by the 7 ${}^{\text{th}}$ edition tumor node metastasis (TNM) staging formulated by American Joint Committee on Cancer (AJCC) [17]: grade I $+$ II, $n=$ 47; grade III $+$ IV, $n=$ 16. There was no lymph node metastasis in all the cases. All specimens were placed in 10% formaldehyde, dehydrated, embedded by paraffin conventionally, and subsequently cut into 4 $\mu$ m sections for the further experimentation.

2.7 Immunohistochemistry (IHC)

An IHC was conducted according to the instructions provided by the SP-9001 kit ((NobleRyder Technology Co., Ltd, Beijing, China). The aforementioned paraffin tissue blocks from the breast cancer tissues as well as adjacent normal tissues were sliced, conventionally deparaffinized into water, soaked in 3% H ${}_2$ O ${}_2$ at room temperature in order to inhibit the endogenous peroxidase activity, followed by antigen retrieval under microwave heat. Afterwards, the sections were coated with a 5% normal goat serum (C1771, Beijing PuliLai Gene Technology Co., Ltd., Beijing, China) with the removal of serum and incubated overnight at 4 ${}^{\circ }$ C with an addition of primary antibody of the goat anti-human GBX2 (ab109726, 1:2000, Abcam company, Cambridge, MA, USA) and the rabbit anti-human $\beta$ -catenin (ab16051, 1:1000, Abcam company, Cambridge, MA, USA). The sections washed by PBS and incubated when respectively added with the secondary antibody of corresponding biotinylated mouse anti-sheep immunoglobulin G (IgG) (sc-2355, 1:1000, Santa Cruz Biotechnology, CA, USA) and the goat anti-rabbit IgG (ab6721, 1:1000, Abcam company, Cambridge, UK) at 37 ${}^{\circ }$ C for 1 h. Next, the sections were washed, incubated with horseradish peroxidase (HRP) labeled streptavidin (0343-10000U, Yijie Biotechnology Co., Ltd, Beijing, China) at 37 ${}^{\circ }$ C for 1 h and washed by PBS. After being stained with diaminobenzidine (DAB) (ST033. Guangzhou Whiga Technology ltd. Guangzhou, China), the sections were counterstained using hematoxylin (Shanghai Fu Sheng Industrial Co., Ltd., Shanghai, China) and mounted with neutral balsam. PBS was substituted for the primary antibody in order to act as the blank control. Five high-power visual fields (200 $\times$ ) were selected randomly in each section with 100 cells in each field, which was scored according to the percentage of positive cells. The number of positive cells/the number of total cells $>$ 10% was regarded as the positive cells ( $+$ ), while the percentage of positive cells $⩽$ 10% was regarded as the negative cells ( $-$ ). Each experiment was repeated a total of three times.

2.8 Cell culture and cell selection

Human breast cancer cell lines MCF-7, MDA-MB-231, T47D, and BcapP37 were all purchased from the cell bank of the typical culture preservation Committee of the Chinese Academy of Sciences and were cultured along with Dulbecco’s Modified Eagle’s Medium (DMEM) culture medium containing 10% calf serum and finally incubated with an addition of 1:1 penicillin streptomycin solution to the final concentration of 100 U/mL in a humidified atmospheric condition of 5% CO ${}_2$ at 37 ${}^{\circ }$ C. The cells were then treated with a 0.25% trypsin and sub-cultured in an amount ratio of 1:3. The cells were seeded in a 6-well plate (3 $\times$ 10 ${}^5$ cells/well). When the cell confluence reached around 70%–80%, the detection of mRNA expression was carried out. The mRNA expression of GBX2 was detected using the reverse transcription quantitative polymerase chain reaction (RT-qPCR) and the two cell lines presenting with higher expression were selected for the further experimentation. Each experiment was also repeated for three times.

2.9 Cell grouping and lentivirus infection

The third-generation cells (MCF-7 and MDA-MB-231) were both taken, treated with trypsin, and plated into a 24-well plate for culture with the intent that the cells would grow in monolayer, followed by removal of the culture fluid. The cells were allocated into 4 groups: blank group (without transfection of any sequence), negative control (NC) group (infected by NC lentivirus plasmid), MCF-shGBX2 group (MCF-7 breast cancer cells infected with shGBX2 lentivirus plasmid), and MDA-shGBX2 group (MDA-MB-231 breast cancer cells infected with shGBX2 lentivirus plasmid). All lentivirus plasmids were purchased from Shanghai GenePharma Co., Ltd. The above MCF-7 and MDA-MB-231 breast cancer cells at the logarithmic growth phase were inoculated into a 6-well plate (2 $\times$ 10 ${}^5$ cells/well) overnight in a humidified atmosphere of 5% CO ${}_2$ at 37 ${}^{\circ }$ C. When the density of growth cells was about 40%–50%, strictly according to the handbook of Shanghai GenePharma Co., Ltd. on lentivirus infections, the lentivirus NC and shGBX2 lentivirus were both transfected to the MCF-7 and MDA-MB-231 breast cancer cells with a higher expression of GBX2 gene were selected. After the transfection for 24 h had completed, the complete medium was replaced with a normal subculture. Puromycin was then added at the density of 1 mg/L since the 4 ${}^{\text{th}}$ day. A fluorescence inverted microscope was used in order to observe the expression of a green fluorescence, indicating that the lentiviral vectors were successfully transfected into the other cells. The constructions of the cell lines in the NC group, the MCF-shGBX2 group, and the MDA-shGBX2 group were finished after two weeks via Puromycin selection.

2.10 Reverse transcription quantitative polymerase chain reaction

The transfected cells taken from each group and total RNA were extracted from cells according to the instructions of TRIZOL (15596-018, Beijing Solarbio company, USA). Total RNA were reversely transcribed into complementary DNA (cDNA) based on the instructions of reverse transcription kits (K1622, Beijing Reanta biotechnology Co., Ltd, Beijing, China) according to the following conditions: total RNA were initially reacted at 70 ${}^{\circ }$ C for 10 min, bathed on ice for 2 min, then reacted at 42 ${}^{\circ }$ C for 60 min, and eventually reacted at 70 ${}^{\circ }$ C for 10 min. The obtained cDNA was preserved at $-$ 80 ${}^{\circ }$ C. The reaction system for RT-qPCR was synthesized in accordance with the instructions of kits (Fermentas Inc., Hanover, MD, USA). Primers used were synthesized by Takara Biomedical Technology Co., Ltd., Dalian, China (Table 1). The condition of reverse transcription conditions were as follows: pre-denaturation at 95 ${}^{\circ }$ C for 4 min, a total of 30 cycles of denaturation at 95 ${}^{\circ }$ C for 30 s, annealing at 57 ${}^{\circ }$ C for 30 s, and extension at 72 ${}^{\circ }$ C for 30 s. The reaction was detected using real-time fluorescence quantitative PCR (iQ5, Bio-Rad Laboratories, Hercules, CA, USA). With $\beta$ -actin as the internal control, the relative expression of the target gene (GBX2, $\beta$ -catenin, vascular Endothelial Growth Factor (VEGF), matrix metallopeptidase (MMP)-2, and MMP-9) was calculated based on the 2 ${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{Ct}}$ method, in which this was the formula: $\mathrm{\Delta }\mathrm{\Delta }\text{Ct}=\mathrm{\Delta }{\text{Ct}}_{\text{(cancer group)}}-\mathrm{\Delta }{\text{Ct}}_{\text{(normal group)}}$ , $\mathrm{\Delta }\text{Ct}={\text{Ct}}_{\text{(target gene)}}-{\text{Ct}}_{\text{(internal control)}}$ . Each experiment was repeated for three times.

Table 1

The primer sequences for reverse transcription quantitative polymerase chain reaction

Gene	Sequence
GBX2	F: GGTAACTTCGACAAGGCGGA
	R: GACCGGAACCCCAGGTCA
$\beta$ -catenin	F: CTGCAGGGGTCCTCTGTG
	R: TGCATATGTCGCCACACC
VEGF	F: ACCATGGCAGAAGGAGGAG
	R: ACGCGGTCTGTGTTTTTGC
MMP-2	F: CTCAGCGGCTCATGGTCCGGCC
	R: CATGGTCCGGCCCCCGCCCCCA
MMP-9	F: ATTTCAGCCAAATAACTCACAT
	R: TTCTTTCCCCACTTTACAAATGAGAAAAGG
$\beta$ -actin	F: TGGTGGGTATGGGTCAGAAGGACTC
	R: CATGGCTGGGGTGTTGAAGGTCTCA

Notes: GBX2, gastrulation brain homeobox 2; VEGF, vascular endothelial growth factor; MMP, matrix metalloproteinase.

2.11 Western blot analysis

After the lentivirus was infected for 48 h, cells from each group were selected and split using a protein lysis buffer at 4 weeks for 30 min with oscillation occurring every 10 min. The cells were centrifuged at 25764 g for 20 min at 4 ${}^{\circ }$ C. The layer of fat was discarded along with the supernatant being taken as part of the tissue protein extraction. Bicinchoninic acid (BCA) kit (20201ES76, Shanghai Yeasen Biotech Company, Shanghai, China) was used in order to detect the protein concentration for each sample. According to the different concentration, quantification was conducted and the protein was transferred to the polyvinylidene fluoride (PVDF) membrane after the separation of proteins via polyacrylamide gel electrophoresis. The cells were then coated with 5% bovine serum albumin (BSA) for 1 h at room temperature. Following that, the samples were added along with the primary antibodies of rabbit anti-human GBX2 (ab49331, 1:2000), rabbit anti-human $\beta$ -catenin (ab6302, 1:4000), rabbit anti-human MMP-9 (ab73734, 1:2000) (all from Abcam company, Cambridge, MA, USA). The cells were shaken and incubated overnight at 4 ${}^{\circ }$ C. The membrane was washed with Tris-buffered saline with Tween 20 (TBST) for 5 min $\times$ 3 times, and diluted with an addition of rabbit anti-human IgG (ab6759, 1:1000, Abcam company, Cambridge, MA, USA) marked with HRP at room temperature for 1 h. The membrane was then washed with TBST for 5 min $\times$ 3 times and added along with developer in order to develop the images. An Image J 1.48 u software (National Institutes of Health, USA) was used for quantitative analysis of protein. The gray value of each protein as well as the internal control GAPDH was both used to conduct the quantitative analysis of the protein. Each experiment was repeated a total of three times.

2.12 3-(4,5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay

After the lentivirus cells were infected for 48 h, the cells were collected, counted in each group, and cultured in a 96-well plate with 3 $\times$ 10 ${}^3$ –6 $\times$ 10 ${}^3$ cells in each well. The volume of each well was measured to be 100 $\mu$ L, with each dilution being repeated in 6 wells, with the cells were incubated in the incubator soon after. Three time intervals were set up: 24 h, 48 h, and 72 h and the following experiment was conducted: each well was added with 20 $\mu$ L of 5 mg/mL prepared MTT solution and after 2 h of the incubation at 37 ${}^{\circ }$ C, the cultivation was ended. The supernatant in the well was discarded and each well was added along with 150 $\mu$ L dimethyl sulfoxide (DMSO). The value of the optical density (OD) was measured at 570 nm using an enzyme-linked immunosorbent assay (ELISA) (NYW-96M, Beijing Noah instruments and meters Co., Ltd, Beijing, China). Each experiment was again repeated three times, with the time interval serving as the abscissa and the value of OD as the ordinate, allowing the cell viability curve to be drawn.

2.13 Transwell assay

After the infection of lentivirus for 48 h, the cells were digested in serum-free medium for 24 h after serum starvation, washed by PBS for twice, and resuspended using serum-free medium Opti-MEMI (31985008, Nanjing SenBeiJia Biological Technology Co., Ltd, Nanjing, China) containing 10 g/L Bovine Serum Album (BSA) with the density of cells adjusted to 3 $\times$ 10 ${}^4$ cells/mL. This Transwell chamber was put into a 24-well culture plate and Matrigel (40111ES08, Shanghai Shen Yi Trading Co., Ltd., Shanghai, China) was used to coat the upper surface of the basement membrane of Transwell chamber with the diluent at the ratio of 1:8 (3413, Beijing Unique biotechnology Co., Ltd, Beijing, China), followed by air-drying at room temperature; 200 $\mu$ L cell suspension was added into the upper chamber of Transwell coated along with the Matrigel, and 600 $\mu$ L RPMI 1640 medium, containing 20% fetal bovine serum (FBS) was added into the bottom chamber of the Transwell; After the regular cultivation for 24 h had completed, the Transwell chamber was taken out and the cells appearing on the interior surface in the upper chamber of Transwell were wiped off using the cotton buds, allowed to be stand in the 4% paraformaldehyde for 15 min, stained using a crystal violet solution for 15 min (made of methanol), and washed by PBS for a total of three times. Five fields of vision were photographed using the inverted microscope (XDS-800D, Cai Kang Shanghai optical instrument factory, Shanghai, China) (100 $\times$ ). The transmembrane cells were then counted with each group having 3 wells. Each experiment was repeated three times to obtain the average value.

2.14 Matrigel angiogenesis assay

Matrigel (356234, Shanghai ShanRan Biotechnology Co, Ltd., Shanghai, China) was put into the refrigerator at 4 ${}^{\circ }$ C overnight until the Matrigel had melted into a yellow colloidal liquid; 70 $\mu$ L yellow colloidal liquid with the thickness of 0.5 mmol/L was then quickly added into the a 96-well plate which was cooled in advanced using the precooled micro injector tool. The tissue culture plate was placed in the incubator for about 30 min at 37 ${}^{\circ }$ C. Cells infected with the lentivirus or treated with the inhibitor in each group were collected and made into the cell suspension. The cell suspension with the density rate of 1 $\times$ 10 ${}^5$ cells/mL was inoculated into a culture well covered with gum and each well were added with the corresponding cell culture medium, and the tissue culture plate was put into the incubator for 18 h, photographed by the low-magnification microscope. Three fields of vision were taken from each well in order to count the number of blood vessel. Each experiment was repeated for a total of three times.

2.15 Construction of xenograft tumor model of breast cancer in nude mice

Twenty-four female BALB/c nude mice aged between 5–7 weeks old and weighing between 19–21 g were all purchased from Shanghai LingChang Company, Shanghai, China. Before the experiment, the nude mice were adaptively raised in the Experimental Animal Center of Xiangya School of Medical College (Certificate of laboratory animal qualification: No.159) in the comfortable environment of specific pathogen-free (SPF), and with a sterile feeding and drinking supply throughout a 12-h day/night cycle for 7 days.

After the cultivation of the infected lentivirus for 48 h, the cells in each group which were in logarithmic growth phase and in good growth state were made into 5 $\times$ 10 ${}^7$ cells/mL cell suspension. Approximately 0.20 mL cell suspension was extracted using a 1 mL syringe, and was inoculated into the left antecubital fossa of the BALB/cnu/nu nude mice (transfected cells in each group were inoculated into 8 nude mice). All the nude mice following inoculation were raised in the SPF grade experimental animal house for further observation. Data were recorded at the 7 ${}^{\text{th}}$ day, 14 ${}^{\text{th}}$ day, 21 ${}^{\text{st}}$ day and 28 ${}^{\text{th}}$ day after inoculation and the short diameter (a) as well as long diameter (b) of the tumor were recorded with a Vernier caliper. The tumor volume was calculated according to the following formula: $\pi (a^{2}b)/6$ . Tumor volume measurements were repeated for a total of 3 times.

2.16 Statistical analysis

All the statistical data were analyzed by the SPSS 21.0 statistical software (IBM Corp., Armonk, NY, USA). Measurement data were all expressed as mean $\pm$ standard deviation. The independent sample $t$ test was used in order to make a comparison between two groups and one-way analysis of variance (ANOVA) was used in order to compare multiple groups. Enumeration data were expressed by percentages, and a chi-square test was used for comparison between groups. A value of $p<$ 0.05 indicated that the difference was of statistical significance.

Figure 1.

GBX2 is found to influence the development of breast cancer via the Wnt/ $\beta$ -catenin signaling pathway. A, Thermal map of the differentially expressed GSE33447, in which the abscissa referred to sample number, the ordinate referred to genes, and the upper bar was sample type, in which blue represented normal control samples and red represented cancer samples. The left dendrogram was the results of gene clustering analysis. The right histogram referred to color gradation, in which red referred to highest expression, blue referred to lowest expression, and each block referred to the expression of each gene in each sample. B, Gene interaction network diagram, in which each circular bubble referred to a gene, and the bubble color represented the core degree of genes in the network diagram. Red referred to strongest core degree and blue referred to weakest one. The lines among bubbles meant that genes were interacted. C, GBX2 expression in TCGA database, in which the abscissa referred to sample type and the ordinate referred to GBX2 expression. The first box plot represented GBX2 expression in normal samples, and the second to the forth box plot indicated GBX2 expressions in four different periods. D, GBX2 expression and breast cancer survival, in which the abscissa referred to time point, the ordinate referred to survival rate, red referred to survival rate of patients with high GBX2 expression, and green referred to survival rate of patients with poor GBX2 expression; GBX2, gastrulation brain homeobox 2; TCGA, The Cancer Genome Atlas.

Table 2

Genes related with breast cancer in KEGG database

Gene	Number
FGFR1	[HSA: 2260]
PIK3CA	[HSA: 5290]
PTEN	[HSA: 5728]
p53	[HSA: 7157]
CCND1	[HSA: 595]
ERBB2	[HSA: 2064]
EGFR	[HSA: 1956]
KIT	[HSA: 3815]
Notch1	[HSA: 4851]
Notch4	[HSA: 4855]
FZD7	[HSA: 8324]
LRP6	[HSA: 4040]
BRCA1	[HSA: 672]
BRCA2	[HSA: 675]

Notes: KEGG, Kyoto Encyclopedia of Genes and Genomes.

3. Results

3.1 GBX2 exerts an influence on breast cancer development via the Wnt/ $\beta$ -catenin signaling pathway

Results of the differential analysis of GSE33447 chip data found that there were 1,951 differentially expressed genes in breast cancer, among which 809 were upregulated and 1142 were downregulated in breast cancer. An expression heatmap of the first 35 differential expressed genes was constructed (Fig. 1A). Additionally, we retrieved 14 genes related to breast cancer from the known genes found in the KEGG database (Table 2). We analyzed the interconnection between the first 10 genes in GSE33447 and the 14 genes related to breast cancer in KEGG (Fig. 1B), and the results indicated that, in exception to the 14 genes related to breast cancer in KEGG, GBX2 and other genes were in the core position, with GBX2 even being found to be interacted with ERBB2 and NOTCH genes. GBX2 expression in different phases and samples in breast cancer were also retrieved using the TCGA database (Fig. 1C) with the results showing that in each phase, GBX2 were always significantly overexpressed in comparison to the control group. Thus, the survival of breast cancer and GBX2 needed further investigation (Fig. 1D), whose results implied that the prognosis of breast cancer patients with upregulated GBX2 was obviously weaker than those with poor GBX2 expression. These findings indicated that GBX2 was closely related with the breast cancer development as well as survival of breast cancer patients. Further retrieval of GBX2 function found that GBX2 was directly associated with prostatic cancer, head and neck cancer, and breast cancer [18, 19, 20, 21]. However, the detailed mechanism of GBX2 in breast cancer still remained unclear. Signaling pathway retrieval showed that the Wnt signaling pathway was closely linked to breast cancer [22, 23, 24]. Moreover, it was reported that GBX2 could exert other functions through the Wnt signaling pathway [25], with an unfortunate obstacle presenting itself as the relationship between GBX2 and the Wnt signaling pathway in breast cancer still needed further investigation. The aforementioned results suggest that GBX2 was very likely to play a role in breast cancer through its association with the Wnt signaling pathway.

Figure 2.

The positive expression rates of GBX2 and $\beta$ -catenin are elevated. A: positive expression of GBX2 and $\beta$ -catenin in breast cancer and adjacent normal tissues by immunohistochemistry (200 $\times$ ); B: the positive expression of GBX2 and $\beta$ -catenin in breast cancer and adjacent normal tissues; *, $p<$ 0.05, compared with the control group; GBX2, gastrulation brain homeobox 2.

Figure 3.

MCF-7 and MDA-MB-231 cells present high GBX2 expression and the lentivirus plasmid is successfully transfected into MCF-7 and MDA-MB-231 cells. A, GBX2 expression in four breast cancer cell lines; B: fluorescence image of cells with plasmid transfection; *, $p<$ 0.05, compared with T47D and Bcap37 cells; GBX2, gastrulation brain homeobox 2; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

3.2 GBX2 and $\beta$ -catenin are upregulated in breast cancer tissues

IHC was conducted in order to measure the expressions of both GBX3 and $\beta$ -catenin. It was presented (Fig. 2) that the positive stained cells of GBX2, $\beta$ -catenin in the breast cancer displayed the yellow-brown particles. The positive expression rate of GBX2 in the adjacent normal tissues was 17.64%, while the positive expression rate of $\beta$ -catenin was 16.52%; the positive expression rate of GBX2 in breast cancer tissues was 32.49%, and the positive expression rate of $\beta$ -catenin was 79.17%. In comparison with the adjacent normal tissues, the positive expression rates of GBX2 and $\beta$ -catenin were detected as being significantly higher ( $p$ $<$ 0.05). These results suggest that GBX2 is upregulated in breast cancer.

3.3 MCF-7 and MDA-MB-231 cells presenting high GBX2 expression are successfully infected with lentivirus shGBX2 plasmid

The results of the selection by RT-qPCR, which was performed in order to screen out cell line with a high GBX2 expression (Fig. 3A) showed that when a comparison was made with the T47D and Bcap37 cells, the mRNA expression of GBX2 in the MCF-7 and MDA-MB-231 cells was significantly increased (both $P<$ 0.05). Therefore, due to the increased expression, both MCF-7 and MDA-MB-231 cells were selected for the following experiment. The results of the infected lentivirus (Fig. 3B) showed that after 4 days of transfection had completed, no green fluorescence was observed under the conventional microscope; no green fluorescence was observed in the blank group under the fluorescence microscope, while green fluorescence was visibly detectable in the NC group, the MCF-shGBX2 group, and the MDA-shGBX2 group. This detection helped to prove that the lentivirus plasmid is successfully infected into MCF-7 and MDA-MB-231 cells.

Figure 4.

GBX2 gene silencing represses the activation of the Wnt/ $\beta$ -catenin signaling pathway, and inhibits the mRNA and protein expressions of $\beta$ -catenin, VEGF, MMP-2, and MMP-9. A, the mRNA expressions of $\beta$ -catenin, VEGF, MMP-2, and MMP-9 of MCF-7 cells detected by RT-qPCR; B, the protein expressions of $\beta$ -catenin, VEGF, MMP-2, and MMP-9 of MCF-7 cells detected by western blot analysis; C, protein bands of the protein expressions of $\beta$ -catenin, VEGF, MMP-2, and MMP-9 of MCF-7 cells; D, the mRNA expressions of $\beta$ -catenin, VEGF, MMP-2, and MMP-9 of MDA-MB-231 cell detected by RT- qPCR; E, the protein expressions of $\beta$ -catenin, VEGF, MMP-2, and MMP-9 of MDA-MB-231 cell detected by western blot analysis; F, protein bands of the protein expressions of $\beta$ -catenin, VEGF, MMP-2, and MMP-9 of MDA-MB-231 cells *, $p<$ 0.05, compared with the blank and NC groups; GBX2, gastrulation brain homeobox 2; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control; VEGF, vascular endothelial growth factor; MMP, matrix metalloproteinase.

3.4 GBX2 gene silencing inhibits the activation of the Wnt/ $\beta$ -catenin signaling pathway in breast cancer

In order to determine both of the mRNA and protein expressions of GBX2, $\beta$ -catenin, VEGF, MMP-2, and MMP-9, RT-qPCR (Fig. 4A and D) and western blot analysis (Fig. 4B, C, E and F) were performed, whose results would go on to indicate that there was no statistical significance detected in the mRNA and protein expressions of GBX2, $\beta$ -catenin, VEGF, MMP-2, and MMP-9 between both the blank and the NC groups (all $p>$ 0.05). In comparison with both the blank group and the NC group, the mRNA and protein expressions of GBX2, $\beta$ -catenin, VEGF, MMP-2, and MMP-9 in MCF-7 and MDA-MB-231 cells had all significantly decreased in the shGBX2 group (all $p<$ 0.05). It is demonstrated that GBX2 gene silencing inhibited the Wnt/ $\beta$ -catenin signaling pathway activation, while simultaneously downregulating $\beta$ -catenin, VEGF, MMP-2, and MMP-9.

Figure 5.

GBX2 gene silencing represses cell proliferation in breast cancer. A, the viability of MCF-7 cells; B, the viability of MDA-MB-231 cells; *, $P<$ 0.05, compared with the blank and the NC groups; GBX2, gastrulation brain homeobox 2; NC, negative control.

Figure 6.

GBX2 gene silencing repressed the effect of invasion ability detected by Transwell assay. A $\sim$ B, the invasion ability of MCF-7 cells; C $\sim$ D, the invasion ability of MDA-MB-231 cells; *, $p<$ 0.05, compared with the blank and NC groups; GBX2, gastrulation brain homeobox 2; NC, negative control.

3.5 GBX2 gene silencing represses cell proliferation in MCF-7 and MDA-MB-231 cells

Subsequently, we carried out MTT assay to detect cell proliferation after transfection. Results (Fig. 5) indicated that there was no significant difference detected in the OD value following transfection of 24 h in each group (all $p>$ 0.05). The OD value in both the MCF-7 and MDA-MB-231 cells in the blank group and the NC group post-transfection at the 48 h and 72 h marks showed no statistical significance (all $P>$ 0.05). In comparison with the blank and the NC groups, the OD values of the MCF-7 and MDA-MB-231 cells in the MCF-shGBX2 group and the MDA-shGBX2 group were significantly decreased after the cell transfection at both the 48 h and 72 h (all $p<$ 0.05) time intervals. These findings demonstrate that GBX2 gene silencing could in fact inhibit the proliferation of MCF-7 and MDA-MB-231 cells.

3.6 GBX2 gene silencing inhibits cell invasion in MCF-7 and MDA-MB-231 cells

The results of Transwell assay (Fig. 6), which was used in order to detect cell invasion of MCF-7 and MDA-MB-231 cells, showed that there was no statistical significance detected in invasion of the MCF-7 and MDA-M-231 cells after transfected for 48 h (all $p>$ 0.05). In comparison with the blank and NC groups, the invasion ability of the MCF-7 and MDA-MB-231 cells was decreased after 48 h of transfection ( $P<$ 0.05). These results demonstrate that GBX2 gene silencing could play a part in inhibiting the invasion of MCF-7 and MDA-MB-231 cells.

Figure 7.

GBX2 gene silencing inhibits angiogenesis of breast cancer cells. A $\sim$ B, the angiogenesis ability of MCF-7 cells; C $\sim$ D, the angiogenesis ability of MDA-MB-231 cells; *, $p<$ 0.05, compared with the blank group and the NC group; GBX2, gastrulation brain homeobox 2; NC, negative control.

Figure 8.

GBX2 gene silencing inhibits the tumorigenic ability of breast cancer cells. A $\sim$ B, the tumorigenic ability of MCF-7 cells; C $\sim$ D, the tumorigenic ability of MDA-MB-231 cells; *, $p<$ 0.05, compared with the blank group and the NC group; GBX2, gastrulation brain homeobox 2; NC, negative control.

3.7 GBX2 gene silencing inhibits angiogenesis of MCF-7 and MDA-MB-231 cells

The results (Fig. 7) of Matrigel angiogenesis assay was carried out for the detection of angiogenesis ability of MCF-7 and MDA-MB-231 cells. The results provided no statistical significance after transfection of MCF-7 and MDA-MB-231 cells had completed for 48 h between the blank and the NC groups (all $p>$ 0.05). in comparison with both the blank group and the NC group, the angiogenesis ability of MCF-7 and MDA-MB-231 cells was significantly increased after transfection for 48 h ( $P<$ 0.05). It was showed that GBX2 gene silencing could suppress the angiogenesis of MCF-7 and MDA-MB-231 cells.

Figure 9.

Mechanism map of GBX2 in breast cancer. GBX2 gene silencing suppresses cell proliferation, invasion and angiogenesis in breast cancer through repressing the activation of the Wnt/ $\beta$ -catenin signaling pathway; GBX2, gastrulation brain homeobox 2.

3.8 GBX2 gene silencing inhibits the tumorigenic ability of MCF-7 and MDA-MB-231 cells

The construction of xenograft tumor in nude mice was performed to measure tumorigenic ability after transfection, which indicated that (Fig. 8) there were no significant differences detected in the tumorigenic ability between both MCF-7 and MDA-MB-231 cells after transfected for 48 h between the blank and the NC groups, ( $P>$ 0.05). In comparison with the blank group and the NC group, the tumorigenic ability of MCF-7 and MDA-MB-231 cells was significantly increased after transfected for 48 h in the MCF-shGBX2 and MDA-shGBX2 ( $P<$ 0.05). These results represent that GBX2 gene silencing could inhibit the tumorigenic ability of MCF-7 and MDA-MB-231 cells.

4. Discussion

In spite of improvements in early-stage diagnosis and development of therapeutic targets, patients with breast cancer still suffer from poor survival rate owing to poor prognosis [26, 27]. Moreover, due to different treatment responses and outcomes, the courses of breast cancer treatment become more intricate and further studies on this topic are critical [28]. Therefore, with the expectation of providing a new insight for breast cancer treatment, we explored the effects of GBX2 on breast cancer cells. Our results indicated that GBX2 gene silencing could inhibit the activation of the Wnt/ $\beta$ -catenin signaling pathway, thus suppressing cell proliferation, invasion, angiogenesis and tumorigenic ability in breast cancer.

Initially, we found that GBX2 was overexpressed in breast cancer cells and the positive expression rates of GBX2 and $\beta$ -catenin in breast cancer tissues were significantly increased. GBX2 is a typical Moneo domain protein regulating downstream genes and is regarded as a comparatively complex transcription activator involved in cultured cells [29]. As a member of GBX group of transcription factor, GBX2 expression was found in zebrafish (Danio rerio) embryos followed with the late gastrula stage in the anterior hindbrain [30]. It was assumed that GBX2 could exert its functions in the specification and differentiation of thalamic nuclei [31]. Detecting the mouse embryonic stem cells, elevation in GBX2 was demonstrated to not only maintain the self-renewal-sustaining effect of activated LIF/Stat3 and to overcome the differentiation barrier when transforming epiblast stem cells to its naive pluripotency [15]. Overexpression of the GBX2 gene was also present in many cancer types, such as prostate cancer and cervical cancer [9, 32], consistent with the findings in our study. $\beta$ -catenin is a primary component of the Wnt signaling pathway [33]. The Wnt signaling pathway is known to have properties in regulating cell proliferation and differentiation and its constitutive activation has been reported as being associated with tumorigenesis of different cancer types including the subject at hand, human breast cancer [34, 35]. Both nuclear and cytosolic accumulation of $\beta$ -catenin, a key factor of the Wnt signaling pathway activation, indicate the positive association between the Wnt signaling pathway and the basal-like breast cancer development [35]. Moreover, increased $\beta$ -catenin expression in cancer which was linked to promotion of tumor progression was an independent indicator for the poor prognosis for these carcinomas [36]. Functionally, we found that GBX2 gene silencing inactivated Wnt/ $\beta$ -catenin signaling pathway.

Our findings from RT-qPCR and western blot assay provided evidence to the notion that GBX2 gene silencing suppressed the expressions of VEGF, MMP-2, and MMP-9, cell proliferation and invasion of MCF-7 and MDA-MB-231 cells. VEGF and MMPs, a group of homologous Zn-dependent endopeptidases, are deeply involved in the pathogenesis of cancer disease [37]. VEGF enhances breast cancer progression by inducing angiogenesis and lymph angiogenesis while both MMP-9 and MMP-2 have been suggested in playing a role in the depravation of the extracellular matrix in the development of breast cancer metastasis [37, 38, 39]. Both VEGF and MMP-9 expressions were investigated and found to be increased in breast cancer [40]. Expression of MMP-2, a metastasis risk or prognostic marker of cancer, was once elucidated in order to be linked to a decreased disease-free survival, recurrence-free survival or survival in breast cancer [41]. In breast cancer, cell proliferation and invasion were previously reported to be suppressed by miR-124 via downregulated Ets-1 [42]. However, Gil-Henn et al. indicated an opposite tendency of proliferation and invasion via the influence of Arg/Abl2 non-receptor tyrosine kinase based on experiment of breast cancer in vivo [43]. It was previously demonstrated that in the development of thalamus, silencing of GBX2 gene plays an irreplaceable role in the proliferation and neurogenic progression [14].

From the study, we concluded that GBX2 gene silencing displayed an inhibiting effect on the proliferation, invasion and angiogenesis of breast cancer through inhibition of the activation of the Wnt/ $\beta$ -catenin pathway (Fig. 9). Therefore, due to the aforementioned properties, GBX2 may be regarded as both a potential diagnostic and therapeutic marker for the treatment of breast cancer. However, due to limited time and funds, this study did not investigate the role of GBX2 overexpression in breast cancer cells, which is expected to be further elucidated in our future studies. Meanwhile, the precise alignment and potential mechanism between both GBX2 and breast cancer remains unestablished, prompting further and more thorough experimentation.