Abstract
Preimplantation genetic diagnosis (PGD) is usually performed on blastomeres. In Germany, the only possibility to perform PGD is by analysis of polar bodies. We performed PGD using polar bodies in a woman who is a carrier of hemophilia A. Multiplex PCR followed by nested fluorescent PCR for five linked polymorphic markers was established. From 11 analyzed polar bodies, only 1 showed alleles linked to the mutation. The corresponding oocyte was transferred and no pregnancy was established. As seen in other investigations, the rate of heterozygous first polar bodies is surprisingly high.
P
Preimplantation genetic diagnosis using PBs is the only possibility for performing PGD in Germany due to the “Embryo Protecting Law” (Embryonenschutzgesetz) (Schwinger et al. 2003). This law allows only the creation of embryos with the aim of establishing a pregnancy. According to this law, an embryo exists at the moment the two pronuclei have fused. After fusion of the pronuclei, the embryo cannot be discarded or used for other purposes. Therefore, PGD on blastomeres is illegal in Germany.
Termination of pregnancy after prenatal diagnosis is accepted and practiced in Germany. However, some couples oppose pregnancy termination so that PB diagnosis is considered an alternative. In cases of hereditary diseases with a variable phenotype such as hemophilia A, PGD is more reasonable than pregnancy termination.
PGD was originally established to select female embryos in X-linked disorders. In polar bodies, only a part of the maternal genome can be analyzed without any information about the paternal contribution to the resulting offspring. Therefore, sexing is not possible. PGD was performed for several X-linked disorders (ESHRE PGD Consortium Steering Committee 2002). Gigarel et al. (2004) developed five different triplex PCR assays to detect X-linked genetic disorders such as hemophilia A, X-linked andrenoleukodystrophy, X-linked hydrocephalus, and incontinentia pigmenti. In the case of PGD for hemophilia A, a pregnancy has been reported.
Hemophilia A is an X-linked genetic disorder caused by a deficiency of factor VIII. Abnormal, prolonged bleeding after minor injuries, tooth extraction, or surgery is a common symptom of hemophilia A. In severe cases, spontaneous joint bleeding is frequent. Treatment and prophylaxis using intravenous infusion of factor VIII concentrate is available. In some cases, patients develop a resistance to factor VIII so that there is no response to substitution therapy.

Haplotypes of the family. The affected alleles are marked by red bars and the wild-type alleles by green bars. The white bar is the allele of the mother of our patient, which is not important for diagnosis.
In the present case, a woman requested polar body diagnosis because of hemophilia A in her family (pedigree: Figure 1). Her father suffered from hemophilia A. He became resistant to therapy with factor VIII resulting in severe illness and the need for intensive care after minor injuries. The daughter is a carrier for the same mutation as her father. To perform PGD in Germany for this indication, analysis of first PBs was developed in our institute using multiplex PCR followed by nested PCR. This technique has been used previously for polar body diagnosis in patients with mutations for cystic fibrosis (Tomi et al. 2003).
The couple (a 34-year-old woman and her 42-year-old partner) was not consanguineous. The wife was healthy, had never been pregnant, and was using oral contraception. Factor VIII was diminished to 52% (normal range between 70% and 140%) and the partial thromboplastin time was accordingly prolonged to 44 sec (normal range between 24 sec and 35 sec). Polar body diagnosis was established for PGD for hemophilia A. During genetic counseling the couple was informed about the possibilities and risks of this diagnosis in the experimental stage, and prenatal diagnosis was recommended in case of a pregnancy after PB diagnosis. A molecular genetic diagnosis was performed. A missense mutation in exon 23 (Arg [CGT] 2150 His [CAT]) was found in the patient and in her father. Polar body investigation was approved by the Research Ethics Committee of the Medical University of Lübeck. Close-linked polymorphic markers were selected from databases proven to be informative in this special case. A multiplex PCR followed by nested PCR was established on genomic DNA of the patient. Multiplex PCR assay was also tested on a single fibroblast of the patient.
Ovarian stimulation was performed with recombinant FSH and recombinant LH in the GnRH-antagonist multiple-dose protocol utilizing cetrorelix. Thirteen oocytes were retrieved by transvaginal ovarian puncture after 13 stimulation days. Intracytoplasmatic sperm injection (ICSI) was performed according to standard procedures in all 13 oocytes and first polar bodies were biopsied after laser-assisted dissection of the zona pellucida.
Polar bodies were transferred into 0.5 ml microcentrifugation tubes containing 5 μl of lysis solution (containing 20 mM TRIS-HCl, pH 9.0, 100 mM KCl, 3 mM MgCl2, 0.2% Triton X-100, 0.4 mg/ml gelatin, and 0.5 mg/ml Proteinase-K) overlaid with 50 μl mineral oil (PerkinElmer, Foster City, CA). PBs were incubated at 37C for 60 min followed by inactivation of Proteinase-K at 95C for 15 min. Multiplex PCR was performed using five linked polymorphic markers. Primer sequences were as follows: DXS1108 F: gtgaattcatcatatgtgatttcc, DXS1108 AR: actaggcgactaatacagtggtgc, DXS8087 AF: aggaggccgtgtgagagcctgg, DXS8087 AR: ggagtccctgaggcagggcg, KIIIR F: gcatattcaagagctgtgtg, KIIIR AR: gctccattgtttctacttgc, KIR3 AF: tgtggggatagaaatggtc, KIR3 R: cccattccacagatttcag, KIR4 AF: cacagttactgctggatct, KIR4 R: gggaagtgccatcattttc. After initial denaturation at 97C for 10 min, DNA was amplified for 25 cycles at 94C for 30 sec, 55C for 45 sec, and 72C for 30 sec, followed by a final extension of 10 min at 72C. PCR was performed using primer 0.04 pmol each, dNTPs 0.2 pmol, 0.5 U Taq polymerase, and incubation mix with MgCl2 (Qbiogene; Heidelberg, Germany). PCR products were diluted 1:10 with distilled water. Nested PCR for each polymorphic marker was performed using 1 μl of the diluted DNA. After an initial denaturation at 97C for 5 min, amplification was performed at 97C for 30 sec, 55C for 30 sec, and 72C for 30 sec 35 times followed by a final extension for 10 min at 72C. Primers were 0.1 pmol and dNTP 0.1 pmol concentrated. One of the primers in each nested PCR reaction was M13 tailed. IRD800-labeled M13 complementary oligonucleotide (0.05 pmol) was added to the reactions along with 0.5 U Taq DNA polymerase. The following primers were used: DXS1108 F + DXS1108 RM13: cacgacgttgtaaaacgacctcttctcactaatatatttctc, DXS8087 R + DXS8087 FM13: cacgacgttgtaaaacgactgcgccagtgaacaaggcaggc, KIIIR R + KIIIR FM13: cacgacgttgtaaaacgacaatctggatggcttcaagct, KIR3 R + KIR3 FM13: cacgacgttgtaaaacgacaagctagaccacagtgatg, KIR4 R + KIR4 FM13: cacgacgttgtaaaacgacggcagctactctttgaaca.
PCR products were resolved on 6% polyacrylamide gel electrophoresis (PAGE) on a Li-Cor automated sequencer (Li-Cor BioSciences GmbH; Bad Homburg, Germany).
From a total of 13 oocytes, 9 were fertilized as evidenced by the formation of two pronuclei, 18 hr after ICSI. Second PBs were retrieved from the other oocytes for scientific purposes using the same method as for the first PBs. The same multiplex PCR assay was applied.
A total of 11 polar bodies were obtained. Ten polar bodies showed a result for all five tested polymorphic markers. In polar body no. 11, no result could be achieved due to failed amplification in four of the five tested markers (Table 1). Seven PBs were heterozygous (nos. 1, 2, 3, 4, 5, 7, and 10). First PBs showed a high rate of heterozygosity (7 of 10) for hemophilia A. Strom et al. (1998) found ~50% of first PBs to be heterozygous for cystic fibrosis. Although only a comparatively small number of PBs was examined in our laboratory, a much higher rate of heterozygosity was found (Tomi et al. 2003).
Allele drop-out (ADO) is a well-known phenomenon in PCR on single cells. It depends on the cell type analyzed (Rechitsky et al. 1998), the genes tested (Dreesen et al. 1996), and the lysis conditions (Levinson et al. 1992; Gitlin et al. 1996), as well as the PCR conditions (Ray et al. 1996). Only PBs no. 1 and no. 5 showed heterozygosity for all tested polymorphic markers. The other PBs showed ADO in two of four of the tested markers. The reasons for ADO differences between PBs using the same conditions of lysis and PCR may be fragmentation or poor quality of the PBs. Trying to improve lysis and PCR conditions in our laboratory does not seem to improve ADO rates in single cells. Further improvement of lysis and PCR conditions on PBs was not possible due to the time frame specified by the embryo protection law. The possibility of ADO in PB is known. To avoid misdiagnosis by ADO, multiplex PCR was established using five instead of only two markers. In single cells, multiplex PCR showed a similar reliability and ADO rates as simplex PCR (Findlay et al. 1998). Multiplex PCR, followed by nested PCR, increases accuracy in PB investigation. DNA analysis of first and second PBs will, furthermore, increase accuracy of the diagnosis (Strom et al. 1998). In our case, a diagnosis of the second PBs was not possible due to the time limitation prescribed by the embryo protecting law.
Polar bodies no. 8 and no. 9 clearly showed hemizygosity of the wild-type allele. Therefore, the corresponding oocytes must bear the mutation allele so that a transfer of these oocytes was denied. Polar body no. 6 showed alleles linked to the mutation (Table 1). A lack of the mutation in the corresponding oocyte was concluded. This oocyte showed two pronuclei and was transferred, but no pregnancy was established.
Second polar bodies of the oocytes that were discarded prior to the fusion of the pronuclei (1, 2, 3, 4, 9, and 11) were biopsied for scientific investigations. They were amplified following the same conditions. Second polar bodies (nos. 1, 3, and 11) showed none of the amplified markers. Polar bodies nos. 2, 4, and 9 had alleles linked to the mutation (Table 2). It was concluded that oocytes no. 2 and no. 4 carried the wild-type allele because the first polar bodies were heterozygous and the second polar bodies showed alleles linked to the mutation. In oocyte no. 9, the first PB showed alleles linked to the wild-type allele and the second PB alleles linked to the mutation allele; this oocyte probably bears alleles linked to the mutation.
To avoid contamination, several steps were established: (a) using gowns and gloves, (b) working in different laboratories for pre- and post-PCR, (c) using the equipment for pre-PCR such as tubes, racks, and pipettes in the laboratory only for single cells and PBs, and (d) using blanks for every PCR step. Due to careful handling, no contamination was detected.
Results of first PBs
PB = polar body; 1, 2 = alleles of the father and the patient. Red alleles are linked to the mutation and green alleles are linked to the wild-type allele.
Results of second PBs
PB II = second polar body; 1, 2 = alleles of the father and the patient. Red alleles are linked to the mutation and green alleles are linked to the wild-type allele.
Due to the high rate of heterozygosity of first PBs (7/10), no statement about the status of the corresponding oocytes could be made. After scientific investigation on the second PBs, a higher rate of oocytes would have been transferable due to the combination of the results of the first and second PBs. Unfortunately, the analysis of the second PB is difficult because of the legal situation with the time limitation in Germany. Furthermore, for the biopsy of the second PB, a second manipulation of the oocyte is needed which may decrease the pregnancy rate.
In polar body diagnosis, only the maternal genome is analyzed. No information about the paternal genome is possible. In cases of autosomal recessive or X-linked diseases, PGD using PBs is, therefore, not an alternative to blastomere analysis in countries where PGD is allowed. For Germany, however, it is the only way to perform PGD in couples who have increased risks for genetic disorders. It is clear that only cases of maternal carriers can be investigated, and it is accepted that the techniques need further improvement.
Footnotes
Acknowledgements
This work was supported by the European Community as a part of the Copernicus II Project.
We thank the couple who participated in this study.
