Abstracts of Free Communications Accepted for Presentation at the 13th International Symposium on Mucopolysaccharidoses and Related Diseases,Sauipe,Bahia,Brazil,August 13-17,2014

1. Animal Models

1017 - Reproductive Characteristics of Male Mucopolysaccharidosis Type I Murine Model Assed in 2 Different Ages

Cinthia Nascimento¹, Odair Aguiar¹, and Vânia D'Almeida¹

¹Universidade Federal de São Paulo, São Paulo, Brazil

Introduction: Mucopolysaccharidosis type I (MPS) is characterized by the deficiency of α-l-iduronidase (IDUA) and continuous deposition of heparan sulfate and dermatan sulfate in many tissues and organs. Due to the susceptibility of reproductive system to environmental and genetic factors, we considered relevant the biological characterization of this system in the murine model of MPS-I. Objective: To characterize some of the male reproductive parameters of MPS-I mice in 2 phases of life. Methods: C57BL/6J male mice were distributed in 4 groups according to age (3- or 6-month-old) or genotype (IDUA+/+ or IDUA−/−). Biometry, sperm production, sperm morphology, plasma testosterone, testicular histology, and histomorphometry were performed. Results: Relative weights of seminal vesicle were lower in 3- and 6-month-old IDUA−/− mice than that in the same age controls (P = .016 and P = .001, respectively), regardless of normal plasma testosterone concentration. Sperm morphology was not altered among normal and knockout mice; however, sperm production was lower in 6-month-old IDUA−/− mice as previously demonstrated by our group (P = .007), which indicates that the absence of IDUA alters sperm production in a quantitative but not necessarily in a qualitative way. Signs of testicular degeneration were present but not predominant in knockout mice; however, interstitial compartment was more intense stained with toluidine blue, in 6-month-old IDUA−/− mice (P < .0001), suggesting storage of extracellular matrix components. Besides that, the percentage of interstitial was higher in IDUA−/− mice than in the controls of both age-groups (P = .0002 and P = .048, respectively). Conclusion: Our results demonstrate that the disruption of IDUA in male mice interferes in some of their reproductive parameters such as the sperm production and the integrity of testicular interstitial compartment, possibly as a consequence of the glycosaminoglycan storage progression. On the other hand, sperm once produced do not appear abnormal. Financial Support: AFIP, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP).

1045 - Evidence of Caspase-Independent Cell Death in Murine Mucopolysaccharidosis Type I Macrophages

Karina Cunha e Rocha¹, Gustavo Monteiro Viana¹, Edgar Julian Paredes-Gamero¹, Ana Maria Martins¹, and Vânia D’Almeida¹

¹Universidade Federal de São Paulo, São Paulo, Brazil

Introduction: Mucopolysaccharidosis type I (MPS-I) is an autosomal recessive disease caused by the deficiency of α,-l-iduronidase (IDUA), responsible for degradation of glycosaminoglycans (GAGs). Besides intralysosomal GAG accumulation, secondary cellular pathways might be involved in the disease pathophysiology, like lysosomal membrane permeabilization, autophagy, and cell death. Objectives and Methods: To evaluate parameters of cellular homeostasis such as lysosomal pH (by acridine orange assay), release of lysosomal cathepsin D (using confocal microscopy), caspase activity (by fluorescent substrate cleavage assay), and relative expression of apoptotic proteins (Western blotting analysis) in 3-month-old murine MPS-I macrophages. Results: We found a significant decrease in lysosomal pH and an increase in cathepsin D release to cytoplasm (lysosomal membrane permeabilization), but no alteration in apoptotic markers in the IDUA −/− group compared to the control group. However, when stimulated with Staurosporine (an apoptotic inducer), cells from the IDUA −/− group showed a higher apoptotic rate. Conclusion: Together, these results indicate a possible mechanism of caspase-independent cell death present in macrophages from MPS-I mice and provide new insights for understanding cellular pathology in this disease.

1070 - Mouse Model of Mucopolysaccharidosis Type IIIC: Distribution and Characterization of the Storage Process in Brain and Peripheral Tissues. A Histopathological and Electron Microscopical Study

Helena Hůlková¹, Carla Martins², Larbi Dridi², Martin Hřebíček¹, and Alexey Pshezhetsky²

¹Institute of Inherited Metabolic Disorders, 1st Faculty of Medicine, Charles University in Prague, Prague, Czech Republic

²CHU Ste-Justine, University of Montreal, Montreal, Canada

Objectives: To characterize lysosomal storage pattern in brain and peripheral organs of mice deficient for heparan sulfate acetyl-CoA:α-glucosaminide N-acetyltransferase (Hgsnat).This analysis is a part of the complex characterization of the mouse model for mucopolysaccharidosis type IIIC (Pshezhetsky et al). Methods: Brain, liver, spleen, heart, lungs, kidney, and skin of mice homozygous for Hgsnat-Geo allele (Hgsnat-Geo mice) and of their control counterparts were examined by histology, histochemistry, immunohistochemistry, and electron microscopy. Results: The main organs affected at the optical and the ultrastructural levels were brain and liver. Lysosomal storage of material with characteristics of glycosaminoglycans (GAGs) was early detectable in hepatocytes and in splenic sinus endothelium, and later and to a lesser extent in liver Kupffer cells, in bronchial respiratory epithelium, renal glomeruli, renal tubular epithelium, fibroblasts, vascular endothelial cells, and pericytes. Microglia containing storage material of GAG type was early detectable in brains of Hgsnat-Geo mice, preceding structural changes in neurons. Morphological findings in neurons were dominated by progressing lysosomal storage of autofluorescent ceroid-like material and by ultrastructural mitochondrial abnormalities. At the most advanced stages of the disease, storage compartment contained closely packed fibrillary structures often resembling storage material of a rectilinear and/or fingerprint type in neuronal ceroid lipofuscinoses. Pathological changes in neurons were accompanied by increase in glial fibrilar acidic protein staining, pointing to neuronal loss. Conclusion: Hgsnat-Geo mice developed a widespread lysosomal storage consistent with accumulation of undegraded GAG in the epithelial and mesenchymal cells, similar to other mouse models of Sanfilippo, but with later onset and lesser intensity. The GAG storage in brain microglia preceded neuronal changes that were characterized by lysosomal and mitochondrial alteration followed by neuronal death. Grant support: The grant NT13122-3/2012 from the Ministry of Health of the Czech Republic and the operating grant (111068) from Canadian Institutes of Health Research and from JJB Foundation.

1072 - Iduronate-2-Sulfatase Deficiency Leads to Early Dysregulation of Bone Development in a Zebrafish Model of Mucopolysaccharidosis Type II

Stefania Bellesso¹, Marika Salvalaio¹, Roberto Costa², Ilaria Zancan², Rosella Tomanin¹, and Enrico Moro²

¹Department of Women’s and Children’s Health, University of Padova, Padova, Italy

²Department of Molecular Medicine, University of Padova, Padova, Italy

Lysosomes are usually considered as end organelles with the main role of degrading damaged molecules and waste substrates. However, it has become clear that they also functionally interact with other organelles, thus taking part in complex cellular regulatory systems. Mutations causing dysfunction of lysosomal enzymes involved in catabolism of glycosaminoglycans (GAGs) are responsible for different types of mucopolysaccharidosis (MPS). These metabolic disorders are generally considered caused by lysosomal accumulation of partially or totally undegraded GAGs, leading to organelle impairment and cytotoxicity. However, the idea that other early cellular and developmental defects may contribute to patients’clinical phenotypes is clearly emerging. Among the different MPS, mucopolysaccharidosis type II (MPS-II or Hunter syndrome; Online Mendelian Inheritance in Man +309900), caused by the deficit activity of the lysosomal enzyme iduronate 2-sulfatase (IDS), is a complex rare disorder, in which skeletal abnormalities represent one of the major disabling aspects. Enzyme replacement therapy is the currently available therapeutic option with, however, a limited efficacy. To better elucidate early alterations in bone development occurring in MPS-II, we took advantage of the zebrafish animal model, given its easy genetic manipulation and evolutionary conservation of mechanisms and signaling pathways regulating bone formation. In particular, we generated a zebrafish model for MPS-II, using a morpholino-based knockdown technology. The morphant fish displays some typical clinical manifestations of patients with Hunter syndrome, such as hepatomegaly, liver GAGs accumulation, and defects in chondrogenesis and osteogenesis. Using different approaches, including in situ hybridization and transgenesis, we demonstrate that IDS knock down affects the expression of key fibroblast growth factor (FGF) signaling markers at early stages, before a clear lysosomal impairment is detectable. Moreover, our results show an altered expression of bone-related markers and bone ossification. Therefore, we hypothesize that IDS deficiency may affect FGF signaling, thus leading to impaired expression of genes involved in bone development.

1078 - Morphological Analysis of Cartilage and Bone Tissue in Mucopolysaccharidosis Type I Animal Model

Nicole Yolanda Ferreira¹, Vanessa Gonçalves Pereira¹, Flávia de Oliveira¹, and Vânia D’Almeida¹

¹Universidade Federal de São Paulo, São Paulo, Brazil

Objectives: To evaluate the morphological characteristics of cartilage and bone tissue in a mucopolysaccharidosis type I murine model. Methods: Animals were maintained on a 12-hour light–dark cycle, with food and water available ad libitum. This study was approved by the Ethical Research Committee from Universidade Federal de São Paulo, Brazil. The morphological characteristics of cartilage and bone tissue were accessed by histological analysis, performed on the proximal epiphysis of femurs collected from 3-month-old male and female wild (α-l-iduronidase [IDUA] +/+; n = 3) and knockout animals (IDUA −/−; n = 4) after euthanasia. The samples were analyzed using hematoxylin and eosin and picrosirius staining, in order to evaluate general aspects of cartilage and bone tissue architecture as well as the collagen type I and III deposition. Images were obtained with an Axiocam camera attached to microscope (Axio Observer.D1 Zeiss, Germany). Results: α-l-Iduronidase −/− animals presented an irregular transition zone between articular cartilage and subchondral bone and lower quantity of trabecular bone tissue when compared to IDUA +/+ animals. Also, IDUA −/− animals presented an important disorganization of cartilage layers, increased cellularity, and predominance of collagen type I deposition on subchondral bone and articular cartilage. Conclusion: Articular cartilage from IDUA −/− animals presented alteration in cellular layers and cellularity, besides irregularity in transition to subchondral bone and abnormal trabecular bone reabsorption. In addition, articular cartilage from IDUA −/− animals is mostly constituted by collagen type I, which presents low flexibility and high resistance. Such alterations indicate that properties of compressibility and elasticity necessary to dissipate and cushion impact forces might be affected on IDUA −/− animal model. Support: CAPES, CNPq, FAPESP, and AFIP.

1119 - Neuroinflammation, Mitochondrial Defects, and Neurodegeneration in Mucopolysaccharidosis IIIC Mouse

Alexey V. Pshezhetsky¹, Carla Martins¹, Helena Hůlková², Larbi Dridi¹, Lubov Grigoryeya¹, Alexander Langford-Smith³, Fiona L. Wilkinson³, Kazuhiro Ohmi⁴, Jerôme Ausseil⁵, Eva Svobodová², Zuzana Hájková², Markéta Tesařová², Hana Hansíková², Brian W. Bigger³, Yoo Choi¹, and Martin Hrebícek²

¹CHU Ste-Justine, University of Montreal, Montréal, Canada

²Charles University, Prague, Czech Republic

³University of Manchester, Manchester, United Kingdom

⁴University of California, Los Angeles, CA, USA

⁵Université de Picardie-Jules Verne, Amiens, France

Introduction: Severe progressive neurological pediatric disease mucopolysaccharidosis IIIC (MPS-IIIC) is caused by the deficiency of acetyl-CoA:glucosaminide N-acetyltransferase (HGSNAT), involved in lysosomal catabolism of heparan sulfate (HS). To understand the pathophysiology of MPS-IIIC, we generated and studied a mouse model of the disease. Methods: A functional knockout of the Hgsnat locus in C57Bl/6 mice was generated using gene trap technology. A selectable marker β-geo, a functional fusion between the β-galactosidase and neomycin resistance genes, was inserted into the intron 7 of the HGSNAT gene leading to splicing of exon 7 into the β-geo cassette to generate a nonfunctional HGSNAT fusion transcript. To detect signs of neurodegeneration, we performed neurological assessment and studied behavior of mice by the open field test and Morris water maze test. Pathological examination of the organs and tissues was performed at the ages of 2, 4, 6, 10, and 11 to 12 months by histochemistry, immunohistochemistry, and electron microscopy and stored metabolites measured by mass spectroscopy. Expression of inflammation markers in the brain tissues was accessed by reverse transcriptase qualitative polymerase chain reaction. Results: At 6 to 8 months, mice showed hyperactivity and reduced anxiety. Cognitive memory decline was detected at 10 months, and at 12 to 13 months, mice showed signs of unbalanced hesitant walk and urinary retention. Lysosomal accumulation of HS was observed in hepatocytes, splenic sinus endothelium, cerebral microglia, liver Kupffer cells, fibroblasts, and pericytes. Starting from 5 months, brain neurons showed enlarged, structurally disorganized, and dysfunctional mitochondria, impaired mitochondrial energy metabolism, and storage of densely packed autofluorescent material, gangliosides, lysozyme, phosphorylated τ, and amyloid β. Conclusion: Altogether, our data for the first time demonstrate that HGSNAT deficiency results in lysosomal accumulation of HS in microglial cells followed by their activation and cytokine release, mitochondrial dysfunction in the neurons, and their death explaining why MPS-IIIC manifests primarily as a neurodegenerative disease.

1121 - Nociceptive Evaluation of Mucopolysaccharidosis Type I Animal Model

Matheus Trovão de Queiroz¹, Nicole Yolanda Ferreira¹, and Vânia D'Almeida¹

¹Universidade Federal de São Paulo, Brazil

Objectives: To evaluate the nociceptive response of mucopolysaccharidosis type I murine model. Methods: Animals were maintained on a 12-hour light–dark cycle, with food and water available ad libitum. This study was approved by the Ethical Research Committee from Universidade Federal de São Paulo, Brazil. The hot plate test evaluated the nociceptive response to temperature of 6-month-old male and female wild (α-l-iduronidase [IDUA] +/+; n = 3) and knockout animals (IDUA −/−; n = 5). Animals were placed individually on the hot plate apparatus (Ugo Basile, Biological Research Apparatus Company, Italy), which was heated up to 53°C. Once all paws of the animal were in contact with the apparatus surface, a timer was started and latency of the first response to the heat, such as shaking or licking any paws, was measured in seconds. The animals were quickly removed from the apparatus after presenting any of the signals described. A 60-second cutoff latency was settled for nonresponsive animals. Comparisons among groups were performed with Mann-Whitney U test. Values of P < .05 were considered statistically significant. Results: α-l-Iduronidase −/− animals presented a mean of 15.3 seconds (standard deviation [SD] = 4.1) to show any response to temperature, whereas IDUA +/+ animals presented a mean of 15.9 seconds (SD = 4.0) before responding. No significant difference in nociceptive response was found when both the groups were compared (P = .786). Conclusion: Our results suggest that 6-month-old IDUA −/− animals do not present a difference in nociceptive response when compared to IDUA +/+ animals. Since this is a preliminary work, it is necessary to perform the test with a higher number of animals in order to reach a conclusion. There are no other studies concerning nociception of mucopolysaccharidosis type I murine model, which makes further analysis even more important for a better understanding of clinical manifestations of the disease.

1213 - Analysis of Immunoglobulin G Repertoire and Macrophage Presence in Mucopolysaccharidosis Type I Mice

Talita G. de Carvalho¹, Valeska L. Lagranha¹, Fabiana Q. Mayer¹, Karina M. Monteiro², Guilherme Baldo¹, Roberto Giugliani¹, and Ursula Matte¹

¹Hospital de Clinicas de Porto Alegre, Porto Alegre, Brazil

²Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

Introduction: The clinical signs of mucopolysaccharidosis type I (MPS-I) are heterogeneous, and the mechanism of pathogenesis is largely unknown, but there is increasing evidence of the participation of immune system abnormalities on this process. Objective: To investigate immune-related aspects, such as self-immunoglobulin G (IgG) repertoire, T-cell activation, and inflammation, in mice with MPS-I. Methods: Protein extracts from liver of MPS-I or wild-type (WT) mice were subjected to polyacrylamide gel electrophoresis under reducing conditions. After being blotted onto polyvinyl difluoride membrane, the antigens were incubated with purified IgG extracted from MPS-I or WT mice serum. Antibody specificity pattern was compared with regard to MPS-I and WT protein extracts and IgG repertoire. T-cell activation was investigated by stimulation with concanavalin A for 48 hours, and cell proliferation was assessed by 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium assay. Furthermore, CD68 immunohistochemistry and macrophage inflammatory protein-1a quantitative polymerase chain reaction were performed in liver and lung of MPS-I and WT mice to analyze the presence of macrophage. Results: Western blot results showed no difference between the antigens recognized in liver protein extracts of MPS-I or WT animals. However, there is a difference in the banding pattern recognized by IgG from MPS-I when compared to WT mice, indicating a variation in the IgG repertoire in these animals. T-cell proliferation after stimulation was normal in both the groups. On the other hand, CD-68 immunostaining was higher in liver and lungs of MPS-I mice than that of WT mice as well as MIP-1a expression, indicating an increase in macrophages in affected animals. Conclusion: These results suggest that the MPS-I mice have a different IgG repertoire and increased presence of macrophages in liver and lung when compared with WT mice. The impact of these findings in disease manifestation deserves further analyses. Financial support: FIPE/HCPA, CAPES, CNPq.

1214 - Possible Mechanisms Involved in the Neuropathology of Mucopolysaccharidosis Type I

Guilherme Baldo¹, Barbara Z. Martinelli¹, Fabiana Q. Mayer¹, Marcia R. Wink², Marilda Fernandes², Roberto Giugliani³, and Ursula Matte³

¹Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

²Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, Brazil

³Hospital de Clinicas de Porto Alegre, Porto Alegre, Brazil

Objectives: Trying to gain insight into the neuropathophysiology of mucopolysaccharidosis type I (MPS-I), the aim of this study was to evaluate the expression of genes coding proteins that could be impaired by heparan sulfate (HS) accumulation due to α-l-iduronidase (IDUA) deficiency and the astrocyte response under this condition. Methods: Six-month-old IDUA knockout mice (MPS-I group, n = 4) and normal mice (normal group, n = 5) were killed, and the brain cortex and hippocampus were collected for further analyses. Gene expression of neural cell adhesion molecule (NCAM), growth-associated protein 43 (GAP-43), fibroblast growth factor 2 (FGF-2), and fibroblast growth factor receptor 1 (FGFR-1) was performed by quantitative polymerase chain reactions. Glial fibrilar acidic protein (GFAP) was detected by immunohistochemistry and tissues were evaluated by counting positive cells (GFAP+) in 5 random fields. Statistical analyses were performed using Student t test, and differences among groups were considered when P < .05. Results: Messenger RNA levels of NCAM were reduced in both cortex (0.6475-fold normal, P = .0271) and hippocampus (0.6-fold normal, P = .0053) of MPS-I group. There was an increase in GAP-43 mRNA levels in hippocampus (1.37-fold normal, P = .002), and no difference was observed in the cortex (P = .068). Fibroblast growth factor receptor 1 was increased in both cortex (1.19-fold normal, P = .042) and hippocampus (1.37-fold normal, P = .0002), and no difference in FGF-2 expression was detected. The number of GFAP+ cells was higher in the cortex (7.7-fold normal, P = .003) and hippocampus (1.4-fold normal, P = .01) of MPS-I mice, with darker staining and more profuse ramifications. Conclusion: Considering the altered NCAM, FGFR-1, GAP-43, and GFAP pattern of expression observed and the large number of signaling cascades and processes that are known to be activated downstream (eg, neurite outgrowth, synaptic plasticity, learning and memory), our study suggests possible pathways that are impaired and contribute to the neuropathology of MPS-I, although more precise molecular mechanisms need to be verified.

2. Epidemiology/Registries

1012 - Epidemiology of Mucopolysaccharidosis in Gaza Strip, Palestine

Shireen Noman Abed¹, Aisha Ayyad¹, and Nabil Baraqoni¹

¹Oran, Algeria

Introduction: Mucopolysaccharidosis(MPS) is a hereditary progressive disease caused by mutations of genes coding for lysosomal enzymes needed to degrade glycosaminoglycans (acid mucopolysaccharides). Mucopolysaccharidosis is an androgen receptor disorder except Hunter syndrome which is an X-linked disorder. In the United States, their overall frequency is between 3.5/100 000 and 4.5/100 000. In Gaza strip, no studies have been made to determine the overall incidence of MPS. Methods: A retrospective and prospective study shows the epidemiology of MPS. Eighteen cases were diagnosed as having MPS (6.25% of cases with inborn errors of metabolism [IEM]) . Ten cases with MPS (age range 15 months-10 years) were interviewed with their parents, reevaluated, and complications were recorded. Results: This retrospective and prospective study showed that among the cases with MPS, 17 of the 18 cases were products of consanguineous marriage (94.4%) with male predominance (male–female = 1.6:1).Most cases were from the Northern Gaza (61.1%), compared to Gaza (33.3%) and Southern Gaza (5.6%). Family history was positive in 50% of the cases. Diagnosis was made on clinical and radiological basis in 13 (72.2%) cases with 3 (16.7%) cases diagnosed by thin-layer chromatography and 3 (16.7%) cases by enzymatic study. Outcome of these cases was unknown for 3 (16.7%) cases. Three cases died (mortality 16.7%), and we still follow-up 13 (66.6%) cases. We studied the prevalence of clinical features and complications in 10 cases. Mental retardation is a universal finding(100%) followed by skeletal deformities(70%). Other features are illustrated in the table. Mean age for diagnosis is 2.2 years. Antenatal diagnosis was made for 1 family. None of our patients received enzymatic therapy. Conclusion: The high consanguinity rates in our country lead to higher incidence of IEM. We need to be backed up by a large multicenter study for actual incidence of the metabolic disorders in the Gaza strip. Follow-up of patients with MPS needs a multidisciplinary team so a suggested protocol was written.

1013 - Mucopolysaccharidosis I Registry Status Update

Shari Fallet¹, Cinde Clatterbuck¹, and Iva Ivanovska Holder¹

¹Genzyme, a Sanofi company, Cambridge, MA, USA

Objective: To provide an update on the status of the mucopolysaccharidosis type I (MPS-I) Registry. Method: The MPS-I Registry (clinicaltrials.gov NCT00144794) is an international, observational, voluntary database intended to track the natural history, treatment patterns, and clinical status of the patients with MPS-I. Data on the demographics and treatment status of 1066 patients enrolled in the Registry were analyzed for this report. Result: As of January 3, 2014, 1066 patients from 33 countries enrolled in the MPS-I Registry; the median age at enrollment is 5.2 years for patients with Hurler syndrome, 9.6 years for patients with Hurler-Scheie syndrome, and 19.3 years for patients with Scheie syndrome. The phenotype distribution of the Registry population is 59% Hurler, 22% Hurler-Scheie, and 12% Scheie (7% undetermined). There is considerable delay in diagnosis, especially among patients with attenuated MPS-I (Hurler-Scheie and Scheie syndromes). Median age at symptom onset for Registry patients with Hurler, Hurler-Scheie, and Scheie syndromes is 0.5, 1.8, and 5.3 years, respectively; median age at diagnosis is 1.0, 4.1, and 9.4 years, respectively. The Registry also captures treatment status; 52% of patients receive enzyme replacement therapy (ERT) with laronidase (Aldurazyme, Genzyme, a Sanofi company, Cambridge, Massachusetts and BioMarin Pharmaceutical Inc, San Rafael, California), 19% receive hematopoietic stem cells transplantation (HSCT), 17% are treated with both ERT and HSCT, and 11% of patients receive neither ERT nor HSCT. The median age at first treatment (ERT or HSCT) is 1.5 years for patients with Hurler syndrome, 8.0 years for patients with Hurler Scheie syndrome, and 16.9 years for patients with Scheie syndrome, reflecting a global delay between diagnosis and treatment initiation. Conclusion: The MPS-I Registry enables tracking of disease course and long-term clinical outcomes of patients with MPS-I worldwide, regardless of the treatment status. Data from the Registry provide an opportunity to better understand the disease and response to therapy. Conflicts: All 3 authors are employees of Genzyme, a Sanofi company.

1026 - The Need of Asia Pacific Mucopolysaccharidosis Network and Patient Registration System

Sung Yoon Cho¹, Young Bae Sohn², Dong-Kyu Jin³, and Ah-Ra Ko⁴

¹Samsung Medical Center, Seoul, Korea

²Department of Medical Genetics, Ajou University Hospital, Suwon, Korea

³Department of Pediatrics, Samsung Medical Center, Seoul, Korea

⁴Clinical Research Center, Samsung Biomedical Research Institute, Seoul, Korea

Mucopolysaccharidoses (MPS) are relatively frequent as a group, with an overall incidence of 1:22 000 to 52 000 live births although individually rare. Asia is the world’s most populous continent. The medical needs for caring patients with MPS are multidisciplinary and very challenging. The system to fulfill the tasks is based on the integration of professional, social, and governmental sectors. Scarce knowledge should be shared and resources should be combined as efficiently as possible, in order to tackle the care for individuals with MPS more effectively across Asia and extending to the Pacific Rim. There was no standard guideline for patients with MPS in the Asia Pacific region. We need to evaluate the appropriateness of how we treat patients and guarantee their safety, and need to share information and set up collaborative research and global clinical trial. The first meeting of Asia Pacific MPS Network (APMN) in Seoul in January, 2013 was a good start for organizing the network to meet the need. The first task was establishment of Asia Pacific MPS Registry as an electronic data remote system, and online site has opened recently. As mission, APMN will serve as a core infrastructure for treatment of patients, mutual exchange of opinion and information, international cooperative research on the disease, and global clinical trials. As vision, APMN will improve the quality of life for patients with MPS through active cooperation. In addition, APMN concerns the patients who cannot receive enzyme replacement therapy yet. There are 4 objectives of APMN: (1) organization of Asia Pacific research network of MPS (Registry, Standard Treatment Guideline); (2) to understand current situation and exchange of information; (3) support for the preclinical studies related to MPS and Asia Pacific patients/parents with MPS; and (4) invitation and international exchange of young doctors who are responsible for patients with MPS. This well-planned networking will grow more and more.

1062 - The Hunter Outcome Survey: Collecting Real-World Data on a Rare Disease

Tom A. W. Pulles¹, Maria Paabøl Larsen¹, Isabelle Morin¹, and Marcella Lynch¹

¹Shire, Eysins, Switzerland

Introduction: The Hunter Outcome Survey (HOS) is a global, multicenter, longitudinal, observational registry sponsored by Shire that collects real-world clinical information on the natural history of Hunter syndrome and the long-term effectiveness and safety of idursulfase (Elaprase, Shire, Eysins, Switzerland). Methods: Individuals with a confirmed diagnosis of Hunter syndrome are eligible for enrollment in HOS. Clinical data are collected during routine evaluations and may also be extracted from hospital records. Results: Since HOS was initiated in 2005, almost 1000 individuals with Hunter syndrome have been enrolled prospectively at 118 clinics in 26 countries across 4 continents. The HOS collects a broad range of disease- and treatment-related information and is proving to be a valuable tool in increasing understanding of Hunter syndrome and its treatment in a large population of patients with this rare disease over a long period of time. The proportion of patients enrolled before 6 years of age is greater now than when HOS was initiated, probably reflecting improvements in disease awareness and diagnosis. As of January 2014, the median age of patients alive at HOS entry was 8.6 years (N = 871) at enrollment, and their median age at diagnosis was 3.3 years (N = 765). The data generated from HOS have resulted in 14 peer-reviewed publications and more than 80 congress presentations. Most patients followed prospectively in HOS (80.2%, 655 of 817) have received at least 1 infusion with idursulfase (median age at treatment start, 7.6 years). Obtaining high-quality and complete data is challenging in all disease registries, and efforts are ongoing to achieve further improvement in the quality and completeness of HOS data. Conclusion: The HOS is a unique source of real-world data on the progression and management of Hunter syndrome. As it grows, HOS may make further contributions to our understanding of this rare, life-limiting disease and to improvements in patient care. Conflicts of interest: Maria Paabøl Larsen, Isabelle Morin, Marcella Lynch, and Tom Pulles are full-time employees of Shire.

1124 - Screening of Mucopolysaccharidosis in the Associação de Pais e Amigos dos Excepcionais of Ceara State, Brazil

Maria Denise F. Carvalho¹, Ellaine D.F. Carvalho¹, Pedro O. Barbosa¹, and Krishnamurti de M. Carvalho¹

¹Unichristus/UECE/APAE-Fortaleza, Brazil

Introduction: The Associação de Pais e Amigos dos Excepcionais (APAEs) has proved to be increasingly more important for screening and diagnosis of patients with lysosomal diseases, among them, the mucopolysaccharidosis (MPS). Objectives: To perform clinical and laboratory screening in all patients suspected of MPS in many APAES in Ceará State. Methodology: (1) Perform educational presentations for health care professionals (audiologists, educators, psychologists, occupational therapists, nurses, and physicians) involved in the care and monitoring of children with motor and intellectual deficits; (2) clinical evaluation of suspected MPS referred by various professionals; (3) perform screening of urine and blood in filter paper in patients suspected of MPS; (4) perform specific enzyme dosage for the MPS subtype suspicion; and (5) genetic counseling with specific and multidisciplinary treatment. Results: After the establishment of this project, our screening in 3 months—January to March 2014—identified patients positive for MPS-III and MPS-IV which are in a confirmation process by enzymatic measurement of leukocytes. In patients in which the MPS screening was negative, we seek for other diagnoses through an appropriate clinical follow-up. Conclusion: Despite the recent onset of this project, there is a great diagnostic perspective in the APAEs with active medical genetics services. Conflict of interests: Educational presentations for health care professionals with Shire, Genzyme, and BioMarin.

1183 - Screening for Mucopolysaccharidosis VI in a High-Incidence Area in Northeast Brazil: Report of the First 1800 Newborns Tested

Fernanda Bender^1,2, Angelina Acosta³, Aline Bochernitsan², Tatiana Amorim³, Maira Burin², Antonio Purificação⁴, Kiyoko Abé-Sandes³, Sandra Leistner-Segal², and Roberto Giugliani²

¹Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

²Medical Genetics Service, HCPA, Porto Alegre, Brazil

³Escola Bahiana de Medicina e Saúde Pública, Salvador, Brazil

⁴APAE, Salvador, Brazil

Introduction: Mucopolysaccharidosis VI (MPS-VI) is caused by the deficiency of N-acetylgalactosamine 4-sulfatase resulting in storage of dermatan sulfate in lysosomes and leading to progressive and severe bone dysplasia and to problems in many organs and systems. Mucopolysaccharidosis VI is a very rare condition (1 of 340 000 worldwide) but has a relatively high incidence in the county of Monte Santo (53 000 inhabitants), in Northeast Brazil, where 13 (1 of 4000) cases with MPS-VI have been identified so far. Objective and Methods: A common mutation (H178L) was identified in all these cases, suggesting a founder effect. As MPS-VI could be treated with enzyme replacement therapy and there are indications that a better outcome may be expected in early treated cases, screening for this disease (with customized biochemical and molecular tests in dried blood spots) was added in this specific area to the newborn screening program already in place. Results: The project started in January 2011, and a total of 1800 samples were analyzed until March 2014, allowing the detection of 29 carriers (1 of 62 newborns). Conclusion: We conclude that the methodology developed for MPS-VI screening in the newborn was effective for the early detection of the disease in the studied region. The detection of carriers allows the identification of families at risk, which could be further screened. The program is in progress, as an increased sample size will allow us to estimate more precisely the frequency of the mutation and the expected number of heterozygotes and homozygotes in the region, which will be important for a population medical genetics approach to the community, including not only early treatment but also genetic counseling and prenatal diagnosis. This work was supported by MPS Brazil Network and INAGEMP and by an unrestricted grant from BioMarin.

1186 - The Mucopolysaccharidosis Brazil Network: A Decade Helping to Identify Patients With Mucopolysaccharidosis Around the World

Andressa Federhen¹, Maira Graeff Burin², Sandra Leistner Segal², Ursula da Silveira Matte², Karlla Cristina Tavares Jesuino², Célio Luiz Rafaelli², Maria Betânia Toralles³, Angelina Xavier Acosta³, Erlane Marques Ribeiro⁴, Eugênia Valadares⁵, Luiz Carlos Santana da Silva⁶, Chong Ae Kim⁷, Charles Marques Lourenço⁸, Dafne Horovitz⁹, Raquel Boy¹⁰, Carlos Steiner¹¹, Márcia Gonçalves Ribeiro¹², and Roberto Giugliani³

¹Post Graduation Program in Medicine: Child and Adolescent Health (UFRGS), Porto Alegre, Brazil

²Medical Genetics Service, Hospital de Clínicas de Porto Alegre (HCPA), Porto Alegre, Brazil

³Medical Genetics Service, HUPE, Salvador, Brazil

⁴Hospital Infantil Albert Sabin, Fortaleza, Brazil

⁵Universidade Federal de Minas Gerais, Belo Horizonte, Brazil

⁶Laboratory of Inborn Errors of Metabolism, HCPA, Porto Alegre, Brazil

⁷Institute of Child, São Paulo, Brazil

⁸Hospital das Clínicas de Ribeirão Preto (HCRP), Ribeirão Preto, Brazil

⁹Instituto Fernandes Figueira, FIOCRUZ, Rio de Janeiro, Brazil

¹⁰Hospital Universitário Pedro Ernesto, Rio de Janeiro, Brazil

¹¹Department of Medical Genetics, UNICAMP, Campinas, Brazil

¹²Instituto de Pediatria e Puericultura Martagão Gesteira, UFRJ, Rio de Janeiro, Brazil

Introduction: The Mucopolysaccharidosis (MPS) Brazil Network (MBN) was created 10 years ago to improve diagnosis and management of MPS diseases in Brazil. Since 2004, physicians from all Brazilian regions and from other countries have requested support of MBN for the investigation of mucopolysaccharidosis. Methods: The access to information and diagnosis in MPS has been provided through different tools. The contact with MBN has been performed through Web site (www.mps.ufrgs.br), e-mail ([e-mail]), or a toll-free helpline (0800-510-2030, Brazil only). Informative materials and instructions for sample collection and shipment can be downloaded in the Web site (English, Spanish, and Portuguese). Services from all Brazilian regions sent the biological samples to the MBN headquarters, located at the Medical Genetics Service of Hospital de Clınicas de Porto Alegre, where the laboratory investigation for MPS is performed free of charge. Furthermore, an increased number of samples from international patients has also been referred to MBN. Results: From April 2004 to December 2013, 2641 samples of Brazilian patients suspicious for MPS were referred to MBN for investigation. A total of 1065 patients with MPS were identified, 606 being new diagnoses (average 5.2/month). The most frequent type of MPS diagnosed was MPS-II, confirmed in 320 (30%) of 1065 patients with MPS, followed by MPS-VI (23.3%), MPS-I (19.4%), and MPS-IVA (11.5%). Most patients with MPS-I came from South or Southeast regions (49.6%), while most patients with MPS-VI came from Northeast region (49.5%). The MPS-IIIB and -IVA are also frequent in South with 42% and 31.5% of patients, respectively, coming from these regions. In all, 231 patients from outside Brazil were diagnosed with MPS, and MPS-II is also the most frequent type of MPS diagnosed among these patients. Conclusion: The multiple ways to enable easy access to information and diagnostic tests helped to identify many patients with MPS in Brazil and in other countries, transforming MBN into a template to develop similar initiatives for other rare diseases.

1203 - Morquio A Prevalence in the State of Paraíba, Northeast of Brazil: A Founder Effect?

Paula F. V. de Medeiros¹, Sandra Leistner-Segal², Francyne Kubaski², Cátia Eufrazino¹, Simone L. Santos³, Gabriella C. Napy¹, Ana C. Brusius-Facchin², Aline N. Bochernitsan², Mariana M. Gurjão¹, Helmer A. Melo¹, and Roberto Giugliani²

¹Universidade Federal de Campina Grande - Hospital Universitário Alcides Carneiro, Paraíba, Brazil

²Genetics Service, Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

³Universidade Estadual da Paraíba, Departamento de Biologia, Paraíba, Brazil

Objectives: To determine the prevalence of mucopolysaccharidosis (MPS) IVA in the state of Paraíba, Northeast of Brazil, and the distribution of patients in its mesoregions. Methods: The latest population data were collected from Brazilian Institute of Geography and Statistics (IBGE) in 2010 and patient’s records from the Hospital Universitário Alcides Carneiro, a reference center for MPS in Paraiba. Results: The state of Paraiba has 3.766.528 inhabitants and it is divided into 4 mesoregions. Currently, there are 22 patients with MPS-IVA (12 males and 10 females) in Paraíba, with a prevalence of 1 per 171.205 inhabitants. Ofthe 22 patients, 16 come from the Borborema mesoregion—the third mesoregion from the coast to hinterland with 44 municipalities, 298.263 inhabitants. The prevalence of MPS-IVA in this mesoregion is 1 per 18.641 inhabitants. For 10 of the 22 patients, there is consanguinity among parents. The existence of unusually high rates of inbreeding in Paraíba, with the frequency of consanguineous unions ranging from 6% to 41%, was detected in a previous study. In 10 of 15 patients genotyped for N-acetylgalatosamine-6-sulfate-sulfatase, we observed an allele frequency of 70% for a specific mutation (p.S341R). According to the history of Paraiba settlement, the Portuguese families with strong tradition of consanguineous unions were the most important settlers. The analysis of the surnames of patients shows that 6 of 22 unrelated patients have the same surname and that 5 of 6 of these patients come from the Borborema mesoregion. The first inhabitants with this surname come from Viana do Castelo—north of Portugal arriving in Paraiba in 1630. Paradoxically, Portugal has one of the lowest MPS-IVA frequencies in Europe. Conclusion: The high prevalence of MPS-IVA in Borborema mesoregion, the high frequency of the same mutation, and that of the parental consanguinity are strong evidences for the hypothesis of a founder effect. There is an ongoing genetic study to verify this hypothesis.

3. Natural History

1003 - Anthropometrical and Dietary Assessment of Patients With Mucopolysaccharidosis VI in Colombia

Liliana Ladino¹, Erika Ochoa², and Natalia Sepúlveda³

¹Instituto de Investigación en Nutrición, Genética y Metabolismo, Universidad El Bosque, Bogotá, Colombia

²Instituto Tecnológico y de Estudios Superiores de Monterrey, Ciudad de México, Mexico City, México

³Departamento de Nutrición y Bioquímica. Facultad de Ciencias, Pontificia Universidad Javeriana, Bogo, Denmark

To describe anthropometrical and dietary assessment of patients with mucopolysaccharidosis VI (MPS-VI) in Colombia, a thorough nutritional assessment was conducted, including anthropometrical and dietary assessment. Growth indices were compared with the Growth Standards and Reference Charts of World Health Organization (WHO) as well as reference data of Frisancho for older children and adults, regarding body composition. Dietary assessment was used to evaluate energy and protein adequacy in comparison to Food and Agriculture Organization (FAO)/WHO requirements. A total of 23 patients with MPS-VI were recruited; 13(56.5%) of 23 patients were men. The average age was 12.2 ± 4.7 years, ranging from 2.9 to 20.4 years. Average height was 101.5 ± 7.9 cm, (range 83-121 cm). Every patient had growth retardation (height for age z-score −6.5 ± 2.1), thus the anthropometrical assessment was done using the age according to their height instead of chronological age. Only 2 (8.7%) of the 23 patients had adequate weight; 91.3% (21 of 23) had overweight or obesity. Body composition analysis demonstrated that overweight is due to higher fat-free mass; 65.2% (15 of 23) had arm muscle area z-score above +1 standard deviation (SD), while only 4.5% (2 of 23) had tricipital skinfold z-score above +1 SD. Dietary analysis showed a significantly lower energy intake than that of healthy controls (P = .0137); when compared to FAO/WHO energy requirements for chronological age and sex, patients with MPS-VI had a significantly lower intake (P = .0008) and when compared with requirements to age adjusted to height, their intake was significantly higher (P = .0101). However, energy was not associated with a specific nutritional status (P = .446). Intake of protein and lipid was lower than that of healthy controls, explaining the differences in energy intake. Patients with MPS-VI would benefit from nutritional interventions that enhance their life quality. Thus, our study suggests that longitudinal and multicenter studies should be promoted in order to evaluate the development of specific growth reference charts as well as the determination of energy requirements, adequate for their disease, its severity, and considering their peculiar body composition.

1004 - The Results of Vision Organ Follow-Up in Children With Mucopolysaccharidosis of Different Forms

Natella Sukhanova¹, Leila Namazova-Baranova¹, Anna Gevorkyan¹, and Nato Vashakmadze¹

¹Research Center for Children’s Health, Moscow 119991, Russia

Materials and Methods: We analyzed the results of 34 children (68 eyes) examined, at the age of 1.5 to 17 years (median age 8.0 ± 4.8 years). In all, 6 children had mucopolysaccharidosis (MPS) I, 18 had MPS-II, 4 had MPS-III, and 2 had MPS-VI. The ophthalmic investigation included viscometry, pachymetry, tonometry, and Schirmer test (electroretinogram [ERG] method). The follow-up period was 24 months.

Results and Discussion: The anomaly was bilateral in 34 children. On biomicroscopy in 18 children with megalocornea, the cornea diameter reached 13 mm and dilation of conjunctiva vessels and thickening of deep layers of cornea were detected. In 6 patients, marked corneal opacity bullous regeneration was seen. In 34 patients on pachymetry , cornea sensitivity decreased in 14 children with mild stage, in 10 children with moderate stage, and in 10 children the sensitivity was lacking. In 12 patients on exophthalmometry the eyebulb size increased to 2.5 mm. Minor changes in pigmentary epithelium and choroids were detected 8 patients with scleral defect walls and edges. In 22 children, the retina vessels had dilation, wall thickening, and normal pathway. In 16 cases on sciascopy, up to 1.5 diopter astigmatism was detected, and in 3 children, high-degree hypermetropia and high-degree amblyopia were observed. The ERG method indicates dysfunction of the retina with normal to severe changes. Conclusion: In MPS I macrocornea, conjunctiva vessels dilation, cornea deep layer thickening and opacity, choked disk of the optic nerve, 2,.0 to 2.5 mm enlargement of the eyebulb, and increase in intraocular pressure were detected. In the MPS-II megalocornea, cornea opacity localizing in the cornea deep layers and stroma thickening were observed. In the fundus, dilated blood vessels with the thickened wall and optic nerve choked discs were observed. Mucopolysaccharidosis III is characterized by hypertelorism and proptosis. In the MPS-IV, fundus changes in the form of optic disk edema and retina edema were seen.

1005 - Respiratory Disorders During Sleep in Children With Hunter Syndrome

Nato Vashakmadze¹, Leyla Namazova-Baranova¹, Anahit Gevorkyan¹, Ekaterina Chernavina¹, and Marina Babaykina¹

¹Scientific Center of Children’s Health, RAMS, Moscow, Russia

Introduction: Upper airway obstruction is a major cause of the mortality observed in mucopolysaccharidosis (MPS) type II. Objectives: To identify the existence and severity of obstructive sleep apnea (OSA) in children with MPS-II. Method: Nineteen children were with MPS-II, 2 to 16 years old (median age 6.5 years). According to the standard clinical criteria, there were 5 children with a mild form of MPS and 14 with severe form. All children had received enzyme replacement therapy on the extent from 10 to 27 months by the time of research. The polysomnographic system Embla N7000 (Iceland) was used. Nocturnal cardiorespiratory monitoring (CRM) with an estimation of OSA by a standard technique was carried out for all patients. The parameters of apnea–hypopnea index (AHI) and oxygen saturation nadir were analyzed. Results: A total of 14 (66,7%) children had different degrees of OSA: 6 had mild (by AHI = 1.5-5), 5 had moderate (AHI = 5-10), and 3 had severe (AHI > 10). Patients with OSA had the mean nadir arterial oxygen saturation (Sao ₂) of 93.2% ± 4.8%. The OSA was noted by episodes associated with irregular breathing. The CRM was repeated during 6 to 12 months after the first research in 3 children with severe form. According to the results, the degree of sleep apnea was increased in 2 children and without dynamics in 2 children. Conclusion: The prevalence of moderate to severe OSA was 42% (8 of 19) in children with MPS-II. The degree of expressiveness of OSA depended on severity of illness, that is, duration of the disease and the initiation of enzyme replacement therapy.

1008 - Natural History of Language and Motor Function in Mucopolysaccharidosis IIIA

Elsa Shapiro¹, Kathleen Delaney², Patrick Haslett¹, Igor Nestrasil¹, and Chester Whitley¹

¹University of Minnesota, Minneapolis, MN, USA

²Shire HGT, Cambridge, MA, USA

Our previous work from a prospective natural history study of mucopolysaccharidosis type IIIA (MPS-IIIA) established that neurologic progression can be sensitively measured using tests of neurocognitive function. Here, we report on motor and language development to determine their sensitivity to disease progression. Methods: Twenty-five patients were recruited to a single site for a longitudinal study of MPS-IIIA (ClinicalTrials.gov Identifier: NCT01047306) and assessed at baseline, 6, 12, and 24 months. Fine/gross motor skills and receptive/expressive language were evaluated from parent report and from direct assessment. The Four Point Scoring System (FPSS), a MPS-III disability assessment, was completed. Observational data were used to delineate qualitative aspects of motor behavior. Results: In all, 20 patients (baseline age range 1.1-8.8 years) had classic, rapidly progressive disease, and 5 patients (baseline age 6.7-18.3 years) showed slower progression. Among classic cases, a developmental ceiling at 41 months age equivalent was observed for fine motor skills. Subsequently, some patients showed regression. Individual trajectories were too variable to estimate an age after which decline occurred. Gross motor skills were impaired but relatively stable, not declining significantly until late in the disease. Parents reported better gross motor skills than were directly measured; this may be explained by the patient’s inability to imitate. Language decline more closely approximated the cognitive findings, with trends suggesting overall declines from approximately 40 months of age. Although the FPSS could identify children with early and late disease, it showed little sensitivity to gradations of severity in the intermediate stages. Conclusion: Variability in language and stability of motor scores over time preclude their use as accurate measures of disease progression or treatment response. However, these measures have clinical utility; the FPSS can determine disease stage, and language and motor assessment may assist parents and teachers to establish appropriate programming and interventions to maintain function in patients with MPS-IIIA.

1027 - Mucopolysaccharidosis Type I: Clinical Manifestation in 19 Patients From the Czech Republic

Pavel Jesina¹

¹Institute of Inherited Metabolic Disorders, General University Hospital, Charles University, Praha, Czech Republic

Introduction: Mucopolysaccharidosis type I (MPS-I) is a severe metabolic storage disease caused by impaired function of α-l-iduronidase. The aim of this study is to describe clinical symptoms, natural course, and to evaluate the results of treatment in Czech patients with MPS-I. The study group consists of 19 patients from 18 families. In all children, diagnosis of MPS-I was confirmed with enzymatic analysis and in 18 children with molecular analysis. Results: The phenotypic distribution of our patients was Hurler/Hurler-Scheie/Scheie syndromes—13/4/2. The first symptoms of disease were hepatosplenomegaly (18 of 19), craniofacial dysmorphy (16 of 19), corneal clouding (15 of 17), and skeletal changes—dysostosis multiplex (17 of 19) and were observed in the most of the patients. Psychomotor delay (13 of 19) was present in all patients with Hurler type. Cardiomyopathy with valves’ impairment (13 of 17), hearing impairment (8 of 16), joint stiffness (16 of 18), carpal tunnel syndrome (5 of 19), and short stature (8 of 16) were present as later symptoms. All children had increased glycoaminoglycans excretion in the urine and decreased activity of α-l-iduronidase in isolated leukocytes. Two mutations in IDUA gene were most prevalent (p.W402X [n = 12] and p.Q70X [n = 8]). Hematopoietic stem cells transplantation (HSCT) with/without enzyme replacement therapy (ERT) was performed in 8 children, in 6 of them with good clinical results. In all, 4 patients with milder type were treated with a long-lasting ERT—3 of them with good therapeutic effect, but 1 patient died due to complications after neurosurgery intervention for cervical spinal cord compression. Conclusion: Diagnosis of MPS-I in early phases of the disease improves the prognosis because adequate therapy (HSCT and/or ERT) can be chosen. Prognosis for children with later diagnosis is very unfavorable. The diagnosis is very important also for prenatal diagnostic in affected families. This study was supported by Ministry of Health, Czech Republic, RVO-VFN64165.

1029 - Brain Magnetic Resonance Imaging Patterns of Disease Progression in Sanfilippo Syndrome Type A (Mucopolysaccharidosis Type IIIA)

Igor Nestrasil¹, Victor Kovac¹, Alia Ahmed¹, Kathleen Delaney¹, Brianna Yund¹, Kyle Rudser¹, Patrick Haslett², Chester Whitley¹, and Elsa Shapiro¹

¹University of Minnesota, Minneapolis, MN, USA

²Shire, Dublin, Ireland

Introduction: Mucopolysaccharidosis type IIIA (MPS-IIIA) is a progressive neurological disease. Quantitative magnetic resonance imaging (MRI) and neurocognitive function testing may provide understanding of disease progression of MPS-IIIA. From the natural history of MPS-IIIA (NCT01047306), we previously reported that baseline cognition is significantly associated with age and gray matter volumes. Here, we present longitudinal data regarding regional changes in MRI-measured brain volumes in patients with MPS-IIIA and estimates of the rate of decline in both cognition and brain volumes over 24 months. Methods: Longitudinal cognitive and quantitative MRI data were collected from 24 children with documented MPS-IIIA. Brain volumetric analysis and developmental quotient (DQ) were obtained by automated MRI segmentation and cognitive assessment, respectively. Results: For a subset of 19 patients with classic disease diagnosed prior to age 6, volume decreases were noted in cortex (−7.5%/year)*, amygdalae (−15%/year)*, hippocampi (−4.9%/year)*, and very slightly in white matter (−2.2%/year). Cortical thickness narrowed with a rate of 5.9% per year* (*, statistically significant). Subcortical gray matter and cortical cerebellar volumes remained stable. Ventricular volume increased (+23.5%/year)*, presumably reflecting the brain loss. A strong correlation was found between DQ and cortical volume and similarly between DQ and cortical thickness. Other specific data will be reported (eg, rate of decline for individual lobes of the brain). For patients diagnosed after age 6, patterns were variable. Conclusion: In this natural history study, loss of cortical and amygdala volumes with substantial ventricular enlargement was the primary MRI patterns linked to decline in cognitive function in patients with the classical form of MPS-IIIA. We have demonstrated that both DQ and cortical volume are markers of disease progression in MPS-IIIA and that they are closely associated. White matter, cerebellum, and subcortical gray matter remained stable or declined slightly. Mucopolysaccharidosis type IIIA appears to be mainly a disease of cerebral cortical gray matter. Conflicts of interest: The study was supported by Shire, Lexington, USA.

1030 - Clinical Profile, Respiratory Muscle Strength, Ability, and Level of Functional Independence in Patients With Mucopolysaccharidoses in a Center of Inborn Errors in the State of Pernambuco, Brazil

Bárbara Bernardo R. Silva¹, Maria do Carmo M. B. Duarte¹, Lívia B. Andrade¹, Marcelo S. Kerstenetzky¹, and Patrícia G. M. Bezerra¹

¹Instituto de Medicina Integral Prof Fernando Figueira, Recife, Brazil

Objectives: To evaluate the clinical profile, respiratory muscle strength, functional ability, and level of functional independence among patients with mucopolysaccharidosis (MPS). Methods: Cross-sectional study targeting 19 patients with MPS, ranging from 6 to 38 years. Children younger than 6 years who were unable to perform the tests were excluded. The instruments used were the Pediatric Evaluation of Disability Inventory (PEDI) and the Functional Independence Measure (FIM) questionnaires, which were chosen based on the age of the patient. Respiratory muscle strength and functional capacity were assessed by the manometer and 6-minute walk (6MWT) tests, respectively. Results: Of the patients, 73% were MPS type VI, 16.5% type IV, and 10.5% type II. Their average age was 15.7 years, and 63% of them were males. Their mean body mass index was 20.3 and 68% were sedentary. Three children who were assessed by the PEDI regarding self-care and social function scored an average of 39 and 53, respectively, showing normal development. Regarding mobility, the average score of 16.7 suggested a normative developmental delay or inferior performance than normal. Sixteen patients were assessed by the FIM, in which the mean total score was 103, suggesting modified functional dependency (requiring assistance of up to 25% of the tasks). Respiratory pressures were below the expected range for age, with an average maximum inspiratory pressure of 49.3 and maximum expiratory pressure of 65.2. The average distance measured by the 6MWT was 301 m without changes in oxygen saturation and respiratory and heart rates but with a high level of perceived exertion (Borg average 6.3). Conclusion: Most of the patients evaluated were sedentary, with a deficit in respiratory muscle strength, dyspneic while covering short distances and presented compromised functionality aspects. Research carrying a larger sample in this area is needed to appropriately choose treatments for this population.

1034 - Odontological Observations in Mucopolysaccharidosis Type I, Hurler-Scheie

Norberto B. Guelbert¹, Adriana B. Becerra¹, Adriana I. Cismondi², Ines Noher Halac³, Liliana Gomez⁴, Patricia Campij⁴, Hugo H. Robledo⁵, Sabastian Bulacios⁵, and Perla Krupnik Hidalgo⁴

¹Servicio Enfermedades Metabólicas Hospital de Niños de Cordoba, Córdoba, Spain

²Cátedra de Biología Celular, Universidad Nacional de Córdoba, Argentina

³CONICET Consejo Nacional de Investigaciones Científicas y Técnicas, Argentina

⁴Servicio de Atención Odontológica Integral a la Persona con Discapacidad. Facultad de Odontología, Universidad Central de Venezuela, Carcas, Venezuela

⁵Servicio de Radiología Hospital de Niños de Córdoba, Córdoba, Argentina

Introduction: Mucopolysaccharidosis type I (MPS-I) is a multisystemic lysosomal storage disease. The deficiency of the α-l-iduronidase enzyme results in accumulation of glycosaminoglycans (GAGs) in various tissues and organs. The mouths of these patients show characteristic signs and symptoms of importance in health and welfare and contribute to the diagnosis and possibly to the therapeutic monitoring. Objectives: To show odontologic involvement in MPS-I; to promote oral health in lysosomal storage diseases; and to evaluate the influence of enzyme replacement therapy (ERT) on dental manifestations. Materials and Methods: Five patients with MPS-I, Hurler-Scheie phenotype, a girl and 4 boys between 4 and 13 years of age and under ERT for more than 2 years, were studied with clinical dental examination, panoramic tomography, and lineal computed tomography (CT) with multiplanar 3-dimensional (3D) reconstruction of the temporomandibular joint. In 1 patient, optical and electron microscopy of gingival biopsy was performed. Results: In the oral cavity, it was evidenced the limited mouth opening, jaw hypoplasia, anterior open bite, dental crowding, delayed eruption of permanent elements, gingival hyperplasia, and macroglossia. The orthopantomography showed narrow lower jaw, bilateral condylar hypoplasia, confirmed by CT-3D. The gingival biopsy showed the intralysosomal accumulation of GAGs with disruption in the basal membrane when compared to other studies of patients without ERT. Conclusion: The oral manifestations were constant in our patients; 100% showed bilateral condylar hypoplasia and severe limitation in opening their mouth. Less involvement was noted in children who were started on ERT early.

1035 - Bone and Joint Disease in the Mucopolysaccharidoses Involves Inflammation and Improves Upon Treatment With Pentosan Polysulfate

Calogera M. Simonaro¹, Michael Frohbergh¹, Yi Ge¹, Fanli Meng¹, Xingxuan He¹, Victor A. DeAngelis¹, Nesrin Karabul², Alexander Sólyom³, and Edward H. Schuchman¹

¹Icahn School of Medicine at Mount Sinai, New York, NY, USA

²Villa Metabolica, Children’s Hospital, University of Mainz, Mainz, Germany

³Pediatrics, University of Pécs, Pécs, Hungary

Introduction: We have previously described the inflammatory mechanisms leading to joint and bone disease in the mucopolysaccharidoses (MPSs) and identified an Food and Drug Administration/European Medicines Agency-approved drug, pentosan polysulfate (SP-54, PPS), which resulted in reduction of inflammatory cytokines and marked improvements in motility, grooming behavior, and bone and cartilage disease in a rat model of MPS type VI. Objectives: To assess dose-related effects of PPS to further establish the basis for clinical trials. Methods: In our previous work, we reported the effects of daily, oral PPS treatment in MPS-VI rats, and here we compare these effects with weekly subcutaneous (subQ) injections. The MPS-VI rats were treated with weekly subQ PPS at human equivalent doses of 1, 2, and 4 mg/kg. Biochemical, pathological, and clinical assessments were made. Results: The most efficacious subQ PPS dose was 2 mg/kg. Improvements in subQ versus oral administration were observed. Treatment of all MPS-VI rats with weekly subQ PPS for up to 6 months was safely tolerated at all doses. Conclusion: We propose that weekly subQ injections of PPS will be efficacious and safe in patients with MPS, and a phase 1/2 clinical trial is planned. Further assessments of inflammation in MPS, along with exploration of the mechanism of PPS action in these disorders, are topics of ongoing research and will be discussed. Conflicts of interest: Drs Simonaro and Schuchman have a patent on the use of PPS in the MPSs.

1036 - Mucopolysaccharidosis III Associated With Precocious Puberty: Case Report and Literature Review

Arianne Llamos Paneque¹, Carmen Margarita Pérez de la Hoz¹, Cecilia Pérez Gensen², Elsa Bertila Acosta¹, and Liens Garlobo³

¹Pediatric Hospitla Borras-Marfan, La Habana, Cuba

²National Institute of Endocrinology, La Habana, Cuba

³Laboratory of Metabolism Inborn at National Center of Medical Genetics, La Habana, Cuba

Introduction: Mucopolysaccharidoses (MPSs) are inherited metabolic disorders caused by deficiencies of the enzymes responsible for the intralysosomal catabolism of glycosaminoglycans. The MPSs are inherited as autosomial recessives, except Hunter disease that has an X-chromosomal-linked inheritance. The MPS type III, also called Sanfilippo disease, is the most frequent, and the impairment of central nervous system is considerable in this condition. Objectives: To describe clinical, metabolic, immunological, and hormonal characteristics in an 8-year-old boy with Sanfilippo disease associated with precocious puberty. Methods: The medical history of a patient was studied. Topics regarding main clinical dates, pre- and perinatal events, familial history as well as laboratory test results were analyzed. Review of the literature was done. Results: Perinatal adverse events, coarse facies, macrocephaly, slight hepatomegaly, psychomotor developmental retardation, and progressive neurological deterioration were the main reasons for suspicion of MPS in our case; nevertheless, the presence of enlarged testis and increased hair in facial and pubic area were not so clear for us. A positive result in cetyltrimethylammonium bromide and blue toloudina test with increased heparan sulfate in urine chromatography make our suspicion true. Serum values for follicle-stimulating hormone, luteinizing hormone, thyroid-stimulating hormone, T4, and testosterone reveal a central precocious puberty that had recently been described in a fewer number of cases with MPS-III, most of them during genistein therapy, a situation different from our case. Conclusion: Precocious puberty associated with MPS-III is a relatively new finding in some patients with MPS-III, but there is not enough evidence whether it is related to isoflavone preparation or not. Our case may help to clarify that because the patient was out of treatment.

1039 - A Mongolian Child Case of a Family With Mucopolysaccharidosis Type II, Hunter Syndrome

Zolzaya Doljoo¹, Pureydori Ichinkhorloo¹, Munkhtsetseg Bazarragchaa¹, Kherlen Polkhoo¹, Munktuya Tumurkhuu¹, and Sarantuya Jay¹

¹Department of Molecular Biology and Genetics, Health Sciences University of Mongolia, Ulaanbaatar, Mongolia

Introduction: Mucopolysaccharidosis type II (MPS-II, Hunter syndrome) is an X-linked recessive lysosomal storage disorder resulting from the defective activity of the enzyme iduronate 2-sulfatase. Hunter disease can vary from mild to severe, depending on the level of enzyme deficiency. Objective: To identify enzyme deficiency of glycosaminoglycans in a case with a familial history. Method: We diagnosed a patient with clinical symptoms of MPS. The patient was a 13-year-old boy. He typically had a coarse face, short stature, hepato–splenomegaly, dysostosis multiplex, and severe mental and growth retardation. He had persistent pneumonia. Although he was apparently MPS because of his phenotype, the subtype was not clear. His nephew and uncle had same symptoms, and both of them died at the age of 13. The grandmother and her 2 daughters are suspected as a carrier of X-linked recessive MPS II disorder, Hunter syndrome by genealogical study and we analyzed enzyme activities in serum. Results: Serum N-acetylglucosaminidase, α-l-iduronidase, iduronate-2 sulfatase, and β-galactosidase levels were checked and iduronate-2 sulfatase deficiency was found in this patient. N-acetyl-galactosamine-4-sulfatase (arylsulfatase B [ASB]), acid β-galactosidase (BGAL), BGAL–ASB activities were 16.41 µmol/L/h (normal control–patient control = 57.76:2.67), 20.05 µmol/L/h (normal control–patient control = 41.21:58.35), and 1.22 µmol/L/h (normal control–patient control = 1.01:15.46), respectively. Levels of α-l-iduronidase sulfatase and α-iduronidase were 0.07 µmol/L/h (normal control–patient control = 136.57: 0.30) and 17.26 µmol/L/h (normal control–patient control = 12.56:0.38), respectively. Conclusion: Prenatal biochemical screening test should be implying since we have diagnosed familial cases.

1050 - Noninvasive Pulmonary Function Test in Patients With Morquio A

Francyne Kubaski¹, Shunji Tomatsu¹, Pravin Patel¹, Tsotumu Shimada¹, Eriko Yasuda¹, Robert W. Mason¹, William G. Mackenzie¹, Helen M. Oldham¹, Tadao Orii¹, and Thomas H. Shaffer¹

¹Nemours/Alfred I. duPont Hospital for Children/UDEL/HCPA, Newark, NJ, USA

Introduction: Patients with Morquio A syndrome exhibit a characteristic systemic skeletal dysplasia from excessive storage of keratan sulfate and chrondroitin-6-sulfate in the lysosomes, mainly in chondrocytes. In clinical practice, chest wall and formal respiratory function tests are difficult to perform owing to the small size of the body and patient cooperation. Moreover, most patients are wheelchair bound and/or are postoperative, have severe muscle weakness (atrophy), and cannot perform physical endurance tests, forced pulmonary function tests, and 6-minute walk or 3-minute stair climb tests. Objectives: To establish novel and feasible clinical end points in patients with Morquio A, using noninvasive pulmonary function tests and comparing with spirometry tests. Methods: Twenty-two patients with Morquio (7 males and 15 females), ranged from 3 to 40 years of age, underwent noninvasive pulmonary function tests with vital signs. The pulmonary function tests analyzed were pneumotachography, impulse oscillometry system, and respiratory inductance plethysmography. The statistical analyses were performed using Spearman Rank correlation coefficients and Student t test (P < .05). Results: All patients had normal vital signs at rest including >95% oxygen saturation, end-tidal CO₂ (38-44 mm Hg), and heart rate. Initially, percentage of Total Forced Expiratory Volume (%FEVTOT) was normal until approximately 10 years of age; however, as the age increased the %FEVTOT fell showing a significant negative correlation between %FEVTOT and age (P = .025-.01). Furthermore, %FEVTOT was negatively correlated with patients’ weight, suggesting that the higher body mass indices exhibited in patients with Morquio A syndrome may have a detrimental impact on overall respiratory function (P = .025-.01). Finally, over all ages and gender, patients with Morquio A have normal FEV 1/FEVTOT compared to age- and gender-matched controls of average stature. Conclusion: These data indicate that patients with Morquio A have small but functionally normal lungs, most likely as a result of the effects of the skeletal dysplasia on the developing lung.

1053 - Severity and Clinical Manifestations of Mucopolysaccharidosis Type IVA (Morquio A Disease) in Korea

Ah-Ra Ko¹, Youghee Kwun², Rim Huh², Jieun Lee², SungYoon Lee², YoungBae Sohn³, Ok-Hwa Kim⁴, and Dong-Kyu Jin²

¹Clinical Research Center, Samsung Biomedical Research Institute, Sungkyunkwan University School of Medicine, Seoul, South Korea

²Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea

³Department of Medical Genetics, Ajou University Hospital, Suwon, South Korea

⁴Department of Medical Genetics, Ajou University Hospital, Suwon, South Korea

Introduction: Mucopolysaccharidosis IVA (MPS-IVA, Morquio A syndrome) is a rare, autosomal recessive disorder caused by the deficiency of the lysosomal enzyme N-acetylgalatosamine-6-sulfate-sulfatase (GALNS). Reduced GALNS activity results in impaired catabolism of glycosaminoglycans, keratin sulfate, and chondroitin-6-sulfate. It leads to multisystemic complications involving the musculoskeletal, respiratory, cardiovascular, and digestive systems; however, there is no central nervous system impairment. There is no definite therapy for MPS-IVA, and the current management options are palliative. Objectives: To evaluate the clinical and the molecular genetic characteristics of 13 Korean patients with MPS-IVA. Method: Thirteen patients were diagnosed as MPS-IVA via enzyme activity assay from January 1997 to December 2013 at Samsung medical center in Korea. The GALNS genes of all patients were analyzed. Patients’ charts were retrospectively reviewed for clinical manifestations. Result: In all, 10 patients had severe clinical phenotype and 2 had intermediate phenotype, on the basis of clinical phenotype criteria. One patient had a mild phenotype, and his final adult height was 168.5 cm. Radiologic findings indicated skeletal abnormalities in all patients, especially in the hips and extremities. Eight patients had an odontoid hypoplasia, 3 showed atlantoaxial instability, and 4 patients had no abnormalities except platyspondyly in cervical spine. In all, 6 patients had kyphoscoliosis in spine and 10 patients had genu valgum. Two pairs of siblings were included, so 11 different GALNS mutations were detected. c.451C>A accounted for 23.8% (5 of 21) and detected in both pairs of siblings. Eight patients were tested for pulmonary function and all were normal. Conclusion: Mucopolysaccharidosis IVA is a severe progressive systemic skeletal disorder that has the potential to cause disease in most bone-related system. An understanding of the manifestations of MPS-IVA may allow early diagnosis, and therapy in the early stage may improve the quality of life of patients.

1055 - Longitudinal Analysis of Endurance and Pulmonary Function From a Natural History Study of Morquio A Syndrome

Paul R. Harmatz¹, Karl Eugen Mengel², Roberto Giugliani³, Vassili Valayannopoulos⁴, Shuan-Pei Lin⁵, Rossela Parini⁶, Nathalie Guffon⁷, Barbara K. Burton⁸, Christian Hendriksz⁹, John Mitchell¹⁰, Ana Martins¹¹, Simon A. Jones¹², Norberto Guelbert¹³, Ashok Vellodi¹⁴, Frits Wijburg¹⁵, Ke Yang¹⁶, Peter Slasor¹⁶, and Celeste Decker¹⁶

¹Children’s Hospital and Research Center Oakland, Oakland, CA, USA

²Villa Metabolica, MC University of Mainz, Mainz, Germany

³Hospital de Clínicas de Porto Alegre and Universidade Federal do Rio Grande do Sul, Brazil

⁴Hôpital Necker-Enfants Malades, Paris, France

⁵Mackay Memorial Hospital and Mackay Medical College, Taipei, Taiwan

⁶Az. Ospedaliera S. Gerardo, Monza, Italy

⁷Hôpital Femme Mère Enfant, Lyon, France

⁸Lurie Children’s Hospital and Northwestern University Feinberg School of Medicine, Chicago, IL, USA

⁹Birmingham Children’s Hospital NHS Foundation Trust, Birmingham, United Kingdom

¹⁰McGill University Health Centre, Montreal, Canada

¹¹Universidade Federal de São Paulo, São Paulo, Brazil

¹²Central Manchester University Hospital, University of Manchester, Manchester, United Kingdom

¹³Hospital de Niños de Cordoba, Cordoba, Argentina

¹⁴Great Ormond Street Hospital, London, United Kingdom

¹⁵Academic Medical Center, Amsterdam, the Netherlands

¹⁶BioMarin Pharmaceutical Inc, Novato, CA, USA

Introduction: The Morquio A Clinical Assessment Program (MorCAP) is a multicenter, multinational, longitudinal natural history study designed to describe the spectrum and progression of symptoms in Morquio A syndrome (mucopolysaccharidosis IVA [MPS-IVA]) without disease-modifying treatment. Baseline data revealed substantial impairment in multiple domains including endurance and respiratory function (Harmatz et al, Mol Genet Metab, 2013). Here, 1- and 2-year endurance and pulmonary function data are presented. Methods: Endurance was assessed using the 6-minute walk test (6MWT) and the 3-minute stair climb test (3MSCT). Pulmonary function was evaluated by measuring forced vital capacity (FVC) and maximum voluntary ventilation (MVV). Data were analyzed using repeated measures analysis of covariance models. Annualized estimates of change for 6MWT, 3MSCT, FVC, and MVV were determined using model estimates and interpolation. Results: In all, 353, 184, and 78 patients were assessed at year 0 (baseline), year 1, and year 2, respectively. The overall annualized estimate of change in 6MWT distance was −4.86 ± 3.25 m; a larger decline of −6.84 ± 5.38 m was observed in the subset of patients meeting the inclusion/exclusion criteria of the phase 3 clinical trial of elosulfase α (≥5 years old with baseline 6MWT distance ≥30 and ≤325 m). In contrast, little change (−0.14 ± 0.60 stairs/min) was observed in 3MSCT. Annualized changes in FVC and MVV were 2.44% ± 0.68% and 1.01% ± 2.38%, respectively. The FVC and MVV increased in patients aged ≥14 years but decreased in older patients. Conclusion: The natural history of Morquio A syndrome is characterized by progressive impairment of endurance as measured by the 6MWT. Growth likely influenced pulmonary function changes, as pulmonary parameters increased in younger but not in older patients. This study further supports the use of the 6MWT as a meaningful clinical outcome measure in ambulatory patients with Morquio A.

1056 - Clinical Polymorphism and Phenomenon of Syntropy in Mucopolysaccharidosis

Elena Ya. Grechanina¹, Yulia B. Grechanina¹, Elena V. Bugaeva¹, and Kamilla F. Nagieva¹

¹SSIEM, Kharkiv, Ukraine

Objective: To study the clinical polymorphism of mucopolysaccharidosis (MPS) in Eastern Europe, clarifying the possibility of phenotypic and genotypic syntropy phenomena for individual rehabilitation. Methods: Clinical genetics, high-performance liquid chromatography of amino acids, gas chromatography, mass spectrometry, tandem mass spectrometry, molecular genetics, and cytogenetics. Results: Among 52 077 primarily examined patients (2000-2013), we found 263 (0.5%) with clinical and biochemical signs of involvement in the pathological process of MPS. Only 6 (2.28%) of 263 had syndromic forms, including phenotypic syntropy phenomenon. Three patients had MPS-II (Hunter syndrome), with absence of iduronate sulfatase activity against the background of methylenetetrahydrofolate reductase (MTHFR) 677CT polymorphism (“risk allele”). One patient had MPS-IVB (Morquio syndrome B) with an abrupt reduction in β-galactosidase enzyme activity (5 nmol/mg/h [reference values 8-240 nmol/mg/h]; Dr BJHM Poorthuis) against the background of methionine synthase reductase (MTRR) 66GG polymorphism (“risk allele” of cobalamin deficiency), hypertaurinemia, and hypohomocysteinemia. We found that 1 patient had the combination of MPS-like phenotype with Ehlers-Danlos syndrome: coarse facial features, a disproportionate body, keeled chest deformity, kyphoscoliotic spinal deformity, wing-like scapulas, a high skin extensibility, its softness, velvet, hypotonia, hypermobility of joints, varicose veins, and swelling of the lower extremities. Echographical examination revealed hepatosplenomegaly, metabolic, dysplastic renal changes, mitral valve prolapse, and an additional chord of the left ventricle. Oxyproline 155.4 mg/d increased urinary glycosaminoglycans up to 148 CPC U/g creatinine, hyperprolinemia, hyperglycinemia, hyperpolinuria, hyperhomocysteinemia—26.6 µmol/L. Probands mother M—disproportionate body, coarse facial features, kyphoscoliotic spinal deformity, a soft, doughy, hyperelastic skin, hypermobility of joints, varicose veins, and lymphatic edema of the lower extremities. In 1 patient, the combination of MPS-like phenotype with 45,X/46,XX genotype, mtDNA polymorphism (8697GA, 8860G, tRNA-lysine), with MTHFR 677T T “risk alleles”, increase in chondroitin-4-sulfate, chondroitin-6-sulfate levels. Conclusion: Revealing clinical polymorphism of MPS allowed individualizing treatment and rehabilitation of patients.

1058 - Body Fat Assessment by Bioelectrical Impedance in Patients With Mucopolysaccharidoses

Luciana Giugliani¹, Carolina FM Souza², and Roberto Giugliani³

¹PhD in Program in Child and Adolescent Health, UFRGS, Porto Alegre, Brazil

²Medical Genetics Service, HCPA, Porto Alegre, Brazil

³Department of Genetics, UFRGS, Porto Alegre, Brazil

Objective: To evaluate the nutritional status of patients with mucopolysaccharidosis (MPS) seen in a specialized outpatient clinic, by means of body composition assessment by bioelectrical impedance (BIA). Methods: A cross-sectional study with a convenience sampling. Inclusion criteria were confirmed diagnosis of MPS, patient with ≥10 years of age, and the presence of conditions appropriate for the performance of the examinations. Patients were evaluated by means of anthropometrics, and body composition parameters were provided by BIA. Results: A total of 13 patients enrolled, 7 (53.8%) females and 6 (46.2%) males, with a median age of 22 (12-28) and 15 (10-19) years, respectively. Regarding nutritional status, 5 (38.4%) were eutrophic, 4 (30.8%) were overweight, and 4 (30.8%) were obese. There was no statistical difference in the percentage of fat-free-mass and fat mass (FM) when compared to different types of MPS. However, it was noted that patients with MPS-IVA presented with a greater tendency in %FM in relation to the other MPS types studied. Enzymatic replacement therapy (ERT) patients showed statistically lower %FM than that of the group without ERT, suggesting a possible treatment effect on body fat accumulation. Conclusion: We believe it is very relevant to nutritional monitoring management of patients with MPS, aiming to adapt the nutritional parameters. Additional studies with larger samples should be conducted in an attempt to confirm this hypothesis.

1061 - Gastrointestinal Manifestations in Patients With Mucopolysaccharidoses

Luciana Giugliani¹, Carolina FM Souza², Sandra MV Vieira³, Guilherme Baldo⁴, Ursula Matte⁴, Rafael L. Maurer⁴, Lucia M. Kliemann⁵, and Roberto Giugliani⁶

¹PhD in Program in Child and Adolescent Health, UFRGS, Porto Alegre, Brazil

²Serviço de Genética Médica, HCPA, Porto Alegre, Brazil

³Laboratório Experimental de Gastroenterologia e Hepatologia, HCPA, Porto Alegre, Brazil

⁴Centro de Terapia Gênica, HCPA, Porto Alegre, Brazil

⁵Departamento de Patologia, FAMED, UFRGS, Porto Alegre, Brazil

⁶Departamento de Genética, IB, UFRGS, Porto Alegre, Brazil

Objective: To assess gastrointestinal manifestations in patients with mucopolysaccharidosis (MPS) and bowel mucosa histology in a MPS-I mouse model. Methods: Cross-sectional study with a convenience sampling strategy, including patients with a diagnosis of MPS of any type and regardless of enzyme replacement therapy (ERT) status. Patients were assessed by means of a dietary record and an interview focused on gastrointestinal symptoms and also by a set of laboratory tests. DNA samples of patients were also tested for primary lactase hypolactasia, and bowel mucosa specimens from MPS-I mice underwent histological examination. Results: A total of 27 patients were included, with a median age of 12 (1-28) years. The most prevalent gastrointestinal symptoms were flatulence, abdominal distension, abdominal pain, and loose stools. A significant difference in the prevalence of flatulence was observed among different MPS types (P = .004). The prevalence of flatulence and abdominal distension was significantly higher in the non-ERT group than in the ERT group (P = .04 and .03, respectively). Most biochemical tests performed to workup and/or rule out specific conditions were within normal limits. Histological analysis of small-bowel tissue from MPS-I mice found increased cell volume indicative of some form of intracellular accumulation. On molecular testing for lactase deficiency, 58.8% of the patients had the CC genotype, which is consistent with lactose intolerance. Conclusion: Our results suggest that gastrointestinal manifestations are frequent across most MPS types, and ERT plays a role in treating them. The findings of bowel histology analysis in the MPS mouse model are consistent with cellular abnormalities contributing to these manifestations. Further studies focusing on the gastrointestinal manifestations of MPS are warranted to corroborate our findings and provide a better understanding of the pathophysiological mechanisms associated with these symptoms in affected patients.

1073 - Prevalence of Obstructive Sleep Apnea in Children With Mucopolysaccharidosis in Sao Paulo, Brazil

Ana Maria Martins¹, Gustavo A. Moreira², Sandra O. Kyosen¹, Camilla L. Patti¹, Carmen S. C. Mendes¹, Maret H. Rand¹, Patrícia Feliciano¹, Carolina S. Aranda¹, Vânia D'Almeida¹, and Sergio Tufik²

¹Centro de Erros Inatos do Metabolismo, Universidade Federal de São Paulo, Brazil

²Instituto do Sono, Sao Paulo, Brazil

Introduction: Prevalence of respiratory problems is still unclear in patients with mucopolysaccharidosis (MPS), and studies have reported the importance of screening patients with MPS for obstructive sleep apnea (OSA). We aimed to verify the OSA prevalence in patients with MPS, based on the first polysomnography. Methods: A retrospective study of data from the medical files of patients with MPS at the Centro de Referência em Erros Inatos do Metabolismo was conducted. Results: Data from 46 patients (17 MPS-I, 16 MPS-II, and 13 MPS-VI), 12 females and 34 males, with mean age of 4.6 years (range: 2.7-8.3), median age (months) of disease onset of 12 for MPS-I and 18 for MPS-II and –VI, were used. Diagnosis was established 58.4, 44, and 57 months after the initial manifestation of MPS-I, -II, and -VI, respectively. The patients had underwent surgeries (mainly adenoidectomy and/or tonsillectomy) before the diagnosis, 23% of MPS-I and 50% and 53.8% of MPS-II and -VI, respectively. Parents reported snoring in 35.3%, 31.3%, and 30.8% of patients with MPS-I, -II, and -VI, respectively; however, the OSA was prevalent in 76.5%, 56.3%, and 53.8% of patients with MPS-I, -II, and -VI, respectively. Conclusion: These results highlight the importance of screening children with MPS for OSA using polysomnography, irrespective of MPS type and previous complaints of snoring. Financial support: IGEIM, Shire, and BioMarin.

1074 - Immunological Evaluation of Patients With Mucopolysaccharidosis

Carolina S. Aranda¹, Dirceu Solé¹, Patrícia Feliciano¹, Carmen S.C. Mendes¹, Maret H. Rand¹, Sandra O. Kyosen¹, Marco A. Curiati¹, Sueli Canossa¹, Viviani Tiozzo¹, Marcia C. Mallozi¹, Beatriz T. Costa-Carvalho¹, Vânia D'Almeida¹, and Ana Maria Martins¹

¹Universidade Federal de Sao Paulo, São Paulo, Brazil

Introduction: Mucopolysaccharidosis is a group of metabolic diseases caused by the deficiency of lysosomal enzymes that degrade glycosaminoglycans (GAGs). Recurrent respiratory infections, sleep disturbances, and upper and lower airway obstruction are frequently reported in patients with MPS. However, cellular accumulation of GAG fragments leading to progressive multisystem manifestations can clutter homeostasis, also modify the function of other cellular components, their signals, and produce substances. Objectives: To immunologically evaluate patients with MPS to clarify why they are prone to infections. Methods: Eighteen patients with MPS (mean age = 13-year-old, from 5 to 32 years) in enzyme replacement therapy (ERT), 88% male, were evaluated (type I = 5, type II = 9, and type VI = 4) by measurement of complete blood count and quantitative/qualitative serum immunoglobulins (Ig; IgG, IgM, and IgA) and review of their immunization schedules (Bacillus Calmette-Guérin [BCG], hepatitis B, and rubella). Results: All patients had previous history of wheezing and pneumonia, with significant improvement in symptoms after initiation of ERT. Only 1 patient had iron deficiency anemia. Two patients had neutrophils lower than expected, and all patients had adequate number of lymphocytes. All patients were vaccinated for BCG; however, 1 patient had lymph node tuberculosis. Only 1 patient had IgG serum levels lower than third percentile. Three patients had IgM levels lower than third percentile. Regarding the qualitative evaluation of Igs, 1 (5.5%) patient showed no response to rubella vaccine and 10 (55%) patients showed no response to hepatitis B vaccine, despite complete vaccination schedule. Conclusion: The immunological evaluation of patients with MPS is mandatory, especially for the high frequency of respiratory infections presented by them. More studies on humoral and innate immunities are needed to understand the disease and improve the treatment of these complications. Conflicts of interest: Vania D'Almeida: Grants from BioMarin, Genzyme and Shire as a speaker, advisory board and scientific consultant Ana Maria Martins: Grants from BioMarin, Genzyme and Shire as a speaker, advisory board and scientific consultant.

1075 - Mucopolysaccharidosis I Diagnostic Dilemma: Results From Global Patients’ and Physicians’ Surveys

Christine Lavery¹, Rebecca Gould², and Erin Wilkie³

¹Society for Mucopolysaccharide Diseases, Amersham, United Kingdom

²Fulcrum Research Group, Waltham, MA, USA

³Genzyme, a Sanofi company, Cambridge, MA, USA

Objectives: To improve and optimize patient identification for mucopolysaccharidosis I (MPS-I) through better understanding of the diagnostic journey. To explore and map the diagnostic journey and leverage this understanding to inform targeted physician education. Methods: Physician surveys: completed in 2012 to 2014; 210 rheumatologists and 372 pediatricians in the United States, Canada, Brazil, Mexico, Italy, Germany, France, the United Kingdom, the Netherlands, and Belgium. Physicians were asked to provide their suspected diagnoses and anticipated next steps for 2 unidentified cases of MPS-I (pediatric and adult). Patient surveys: completed in 2009 to 2013; 168 caregivers/patients with MPS-I in the United States, the United Kingdom, France, Germany, Spain, Mexico, Argentina, Brazil, Colombia, and Venezuela. Assessed diagnostic journeys of patients with MPS-I. Results: Results varied by region, specialty, and MPS phenotype. At a global level, patients most commonly received their diagnosis from a geneticist or a metabolic disease specialist; more than 50% of patients saw at least 2 other types of physicians prior to being referred to the diagnosing physician. Patient surveys indicated delays of 0.5 to 8 years between symptom presentation and diagnosis. Only 9% of physicians included MPS in their differential; most commonly suspected diagnosis was rheumatoid arthritis (29% of surveyed physicians). Approximately 75% of pediatricians referred the patients to a rheumatologist or a pediatric rheumatologist. Only 23% of physicians referred to a geneticist or a metabolic disease specialist. Only 19% of surveyed physicians chose a test likely to lead to MPS diagnosis. After reviewing educational information about MPS, the percentage of physicians willing to test a current patient for MPS increased >30% points. Conclusion: Mucopolysaccharidosis I is underrecognized; affected individuals visit numerous specialists before being correctly diagnosed. There is a strong interest from the physician community to learn more about MPS-I. Earlier detection may be improved through targeted differential diagnosis education to encourage prompt diagnosis. This study was supported by Genzyme, a Sanofi company. Conflicts of interest: Erin Wilkie is an employee of Genzyme, a Sanofi company.

1077 - Evaluation of Spinal Cord Compression in Mucopolysaccharidosis

Anneliese Lopes Barth¹, Ana Carolina Esposito¹, Daniel de Souza e Silva¹, Alessandra Augusta Penna e Costa¹, and Anna Patricia Riello²

¹IFF/FIOCRUZ, Rio de Janeiro, Brazil

²Rede Labs Dor, Rio de Janeiro, Brazil

Spinal cord compression (SCC) is a known complication of mucopolysaccharidosis (MPS) and is expected to occur in the natural history of the disease, regardless of enzyme replacement therapy (ERT), as intravenous enzyme does not cross the blood–brain barrier. Because magnetic resonance image (MRI) demonstrates the spinal cord and canal directly, it is the mostly used technique in diagnosing spinal stenosis and compression. Craniovertebral junction stenosis indicates cord compression, although some authors consider the medullar hyperintense signal as the true statement of this diagnosis. The onset of SCC is currently unknown, since most patients do not undergo routine imaging until symptoms or signs of neurological compromise develop. In order to diagnose SCC, we evaluated 23 patients with different types of MPS at distinct times of their disease. All 3 patients with MPS-I showed craniocervical stenosis, while 2 had hyperintense signal. The 5 patients with MPS-II had stenosis of the craniovertebral junction with normal cord signal on MRI. All the 7 patients with MPS-IV presented craniocervical stenosis with spinal cord hyperintense signal. Among the 8 patients with MPS-VIA evaluated, 6 had stenosis with hyperintense signal, 1 showed craniocervical stenosis, and 1 had normal MRI. In patients with multiple MRIs, we observed that without intervention in the craniocervical stenosis, most cases evolved to hyperintense signal, denoting spinal cord suffering. Besides spinal cord MRI, we performed neurophysiological assessments in order to analyze the integrity of nerve transmission. All patients showed motor and sensory conduction involvement in varying degrees, suggesting that medullar impairment begins before the image change. Since both quality of life and life expectancy have improved after ERT, SCC in MPS will be a challenge in the long-term management of these diseases. Thus, it becomes imperative to redefine the diagnostic criteria and optimal timing for intervention. Support: BioMarin, Genzyme, and Shire. Conflicts of interest: Continuing medical education provided by BioMarin, Genzyme, and Shire.

1093 - Morquio A Syndrome: Diagnosis and Current and Future Therapies

Shunji Tomatsu¹, Tsutomu Shimada¹, Eriko Yasuda¹, Pravin Patel¹, Tsutomu Shimada¹, William G. Mackenzie¹, Robert W. Mason¹, Mihir M. Thacker¹, Mary Theroux¹, Adriana M. Montaño², Carlos J. Alméciga-Díaz², Luis A. Barrera², Yasuyuki Suzuki³, and Tadao Orii³

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Saint Louis University, St Louis, MO, USA

³Gifu University, Gifu, Japan

Introduction: Morquio A syndrome is an autosomal recessive disorder, 1 of 50 lysosomal storage diseases, and is caused by the deficiency of N-acetylgalactosamine-6-sulfate sulfatase. Deficiency of this enzyme causes specific glycosaminoglycan accumulation: keratan sulfate and chondroitin-6-sulfate. The majority of KS is produced in the cartilage; therefore, the undegraded substrates accumulate mainly in cartilage and in its extracellular matrix (ECM), causing direct leads to direct impact on cartilage and bone development and leading to the resultant systemic skeletal spondyloepiphyseal dysplasia. Method: In this presentation, screening, diagnosis, pathogenesis, and current and future therapies of Morquio A are discussed from the past articles. Results: Chondrogenesis, the earliest phase of skeletal formation that leads to cartilage and bone formation, is controlled by cellular interactions with the ECM, growth and differentiation factors, and other molecules that affect signaling pathways and transcription factors in a temporal–spatial manner. In patients with Morquio A, in early childhood or even at birth, the cartilage is disrupted presumably as a result of abnormal chondrogenesis and/or endochondral ossification. The unique clinical features are characterized by a marked short stature, odontoid hypoplasia, protrusion of the chest, kyphoscoliosis, platyspondyly, coxa valga, abnormal gait, and laxity of joints. In spite of many descriptions of the unique clinical manifestations, diagnosis delay still occurs. Conclusion: The pathogenesis of systemic skeletal dysplasia in Morquio A syndrome remains an enigmatic challenge.

1095 - Growth Charts for Patients With Hunter Syndrome

Shunji Tomatsu¹, Pravin Patel¹, Yasuyuki Suzuki², Eriko Yasuda¹, Tsutomu Shimada¹, Kenji E Orii², and Tadao Orii²

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

² Gifu University, Gifu, Japan

Introduction: Children with mucopolysaccharidosis II (MPS-II), also known as Hunter syndrome, an X-linked disorder, have a multisystem dysfunction caused by the accumulation of glycosaminoglycans. However, there has been no systemic report on the growth of patients with MPS. Method: The purpose of this study is to describe the growth patterns of patients with MPS-II and to compare with the patterns of age-matched controls. Data (height, weight, age, etc) were collected in a longitudinal study of Japanese male patients with MPS-II (n = 111). Results: The mean birth length was 50.31 ± 1.42 cm, while the mean birth weight was 3.35 ± 0.39 kg. The mean final height and weight at 18 years and older were 125.63 ± 9.09 cm and 37.18 ± 8.72 kg, respectively, corresponding to a lower difference of −46.40 cm and −25.89 kg, when compared with healthy Japanese male controls. The mean birth body mass index (BMI) was 10.84 ± 3.29 kg/m², while the mean BMI at 18 years was 29.41 ± 6.15 kg/m². The growth pattern in patients with MPS-II was characterized by overgrowth for the first several years, although growth velocity fell below that of the normal healthy controls after 1 year of age. There was no statistical difference in growth between patients with the attenuated and severe phenotypes from birth until 8 years of age. Conclusion: This report describes the natural history of growth in patients with MPS-II, which can help in monitoring the progression of the disease as well as assessing therapeutic efficacy.

1103 - The Emerging Deformation of the Pelvis and Femoral Head in Patients With Mucopolysaccharidosis VI

Esmee Oussoren¹, Gert J. H. J. M. Bessems², Iris Plug¹, Annick S. Devos³, George J. G. Ruijter⁴, Hannerieke J. M. P. van den Hout⁵, and Ans T. van der Ploeg¹

¹Department of Pediatrics, Center for Lysosomal and Metabolic Diseases, ErasmusMC-Sophia Children’s Hospital, ErasmusMC-Sophia Children’s Hospital, Rotterdam, the Netherlands

²Department of Pediatrics Orthopedics, ErasmusMC-Sophia Children’s Hospital, Rotterdam, the Netherlands

³Department of Pediatrics, Division of Radiology, ErasmusMC-Sophia Children’s Hospital, Rotterdam, the Netherlands

⁴Department Clinical Genetics, Center for Lysosomal and Metabolic Diseases, ErasmusMC University, Rotterdam, the Netherlands

⁵Department of Child Neurology, Center for Lysosomal and Metabolic Diseases, ErasmusMC-Sophia Children’s Hospital, Rotterdam, Netherlands

Introduction: Mucopolysaccharidosis type VI (MPS-VI) is caused by the deficiency of N-acetyl galactosamine 4-sulfatase leading to intralysosomal accumulation of the glycosaminoglycans dermatan and chondroitin 4-sulfate in connective tissue, cartilage, and bone. Dysostosis multiplex, joint contractures, and debilitating hip problems are characteristic features. Enzyme replacement therapy (ERT) is effective, but hip problems appear relatively resistant to therapy. We prospectively studied hip pathology in MPS-VI to create a better understanding of mechanisms involved. Methods: We studied pathological features of the pelvis and femoral head by x-ray and magnetic resonance imaging (MRI) over time in 11 patients (ranged 2.2 until 18.2 years) receiving ERT. Results: The shape of the pelvis appeared abnormal in the youngest patients with flaring of the iliac bone, hypoplasia of basilar portion of the ilium, and dysplasia of the acetabulum as the most prominent features. Over time sufficient coverage of the femoral head was maintained by disposition of cartilage at the lateral site of the acetabulum (shown on MRI). Eventually, a neoacetabulum was formed. In none of the patients subluxation of the hips was observed. The femoral head appeared normal (x-ray and MRI) at young age, but gradually the shape of the epiphysis started to change with increasing age. Avascular necrosis developed at the medial site. Eventually, a coxa magnum was formed. Arthrosis of the femoral head was observed with cysts, abnormal formation of cartilage and bone as specific hallmarks. The cartilage covering the femoral head (MRI) remained normally present. In the eldest and in 1 severely affected patient with MPS-VI, the angle of inclination of the femur had changed to varus position. Conclusion: Our study shows that patients with MPS-VI develop hip pathology at very young age starting with the pelvis affected first and later also the femoral head. Hip pathology could not be prevented by early start of ERT.

1106 - Exploratory Analysis of Growth Plate Mechanical Environment During Bone Development: A Computational Model

Johana M. Guevara¹, Miguel A. Moncayo², Juan J. Vaca², Maria L. Gutierrez², Luis A. Barrera¹, and Diego A. Garzón²

¹Institute for the Study of Inborn Errors of Metabolism, Pontificia Universidad Javeriana, Bogotá, Colombia

²Numerical Methods and Modeling Research Group (GNUM), Universidad Nacional de Colombia, Bogotá, Colombia

Introduction: Mechanical stimuli play a significant role in the normal process of long bone development as evidenced by clinical observations and in vivo studies. Such stimuli may also play an important role in the progression of several genetic chondrodysplasias as those developed in mucopolysaccharidosis. Up to now, approaches to understand stimuli characteristics have been limited to the first stages of epiphyseal development. Furthermore, knowledge about mechanical behavior in the growth plate, mainly responsible for longitudinal bone growth, is scarce. Objectives: To study stress distribution on epiphysis and growth plate during different stages of normal bone development, from gestation to adolescence, as a first approach to understand mechanical influences in normal and pathological states. Methods: A finite element analysis of mechanical stress distribution within growth plate was performed using an axisymmetric (3-dimensional) model of a generic epiphyseal geometry. A possible correspondence between stress patterns found and morphological characteristics of the growth plate was explored. Different growth plate locations, morphologies, and widths as well as different epiphyseal developmental stages were simulated. Results: Results showed that stress distribution during bone development established patterns that may influence growth of local epiphyseal structures and coincide with histological arrangement of growth plate. Furthermore, our results suggest that mechanical stimuli may play different regulation roles in growth plate behavior through normal long bone development. Conclusion: The model used revealed important information related to epiphyseal and growth plate stress distribution and the ossification process. Results from our study may be useful for understanding general mechanisms underlying mechanical influence on bone development, in particular to formulate hypotheses regarding bone pathologies resulting from genetic or acquired conditions. Further work is needed to consider factors such as epiphyseal shape, loading conditions, and growth plate morphology in specific bones.

1113 - The Impact of Morquio A Syndrome (Mucopolysaccharidosis IVA) Among Patients in Colombia and Brazil

Roberto Giugliani¹, Martha Solano², Regina Garcia Prospero³, Luz Victoria Salazar⁴, and Mohit Jain⁵

¹Medical Genetics Service, HCPA, Department of Genetics, UFRGS, and INAGEMP, Porto Alegre, Brazil

²Fundación Cardioinfantil, Colombia

³Allianca Brasil de Mucopolissacaridoses (APMPS), Brazil

⁴Asociación Colombiana de Pacientes con Enfermedades de Depósito Lisosomal, Colombia

⁵BioMarin Europe Limited, San Rafael, CA, USA

Objectives: To assess mucopolysaccharidosis IVA (MPS-IVA) burden among adult and child patients in Brazil and Colombia. Methods: A patient-reported outcome survey was undertaken in Brazil and Columbia as part of a globally conducted survey (United Kingdom, Turkey, Spain, and Germany) assessing MPS-IVA burden among adults (≥18 years,) and children (5-17 years). The survey assessed disease impact on mobility, pain, fatigue, and quality of life (QoL). It was administered in person (Colombia) or by mail (Brazil) with assistance by patient associations. The QoL assessments was done using EQ-5D-5 L and converted to index scores using UK crosswalk (ranging from −0.654 to 1.000). Pain was assessed using Brief Pain Inventory Short Form (BPI-SF) in adults and Adolescent Pediatric Pain Tool (APPT) in children. Fatigue was assessed by determining the number of evenings patients felt very tired. Results: Results were from 25 patients (8 adults and 17 children); 76.5% (13 of 17) of children and 62.5% (5 of 8) of adults had joint pain. Mobility was impaired; 41.2% (7 of 17) of children and 62.5% (5 of 8) of adults used wheelchairs or walking aids. The BPI-SF and APPT results showed patients always using wheelchairs had less pain but greater pain interference than those using only when needed. In all, 70.6% (12 of 17) of children and 50.0% (4 of 8) of adults reported fatigue. Increased mobility among wheelchair users was associated with more fatigue. Actively mobile patients had significantly better QoL, with index scores of 0.884 for adults not using wheelchairs, 0.386 for those using only when needed, and −0.328 for patients always using wheelchairs; scores were 0.495, 0.674, and −0.180, respectively, in children. Decreased mobility, self-care, and daily activities had greatest impact on QoL. Conclusion: Patients with MPS-IVA less reliant on wheelchairs or not using wheelchairs experience more pain and fatigue but have better QoL than less mobile patients. Improvement in mobility, pain, and fatigue reduction and functional capacity can improve QoL in patients with MPS-IVA. Results from Brazilian and Colombian patients are similar to the global population results, indicating similar disease manifestations. Conflicts of interest: Roberto Giugliani received consulting fees and several speaker honoraria fees from BioMarin; investigator in several research projects and clinical trials sponsored by BioMarin. Martha Solano, Regina Garcia Prospero, and Luz Victoria Salzaar have no conflict of interest. Mohit Jain is a paid employee and holder of stocks of BioMarin Europe Ltd.

1129 - Ultrasound Examination Reveals Typical Alterations in Joints of Patients With Morquio (Mucopolysaccharidosis IV) and Other Mucopolysaccharidosis

Nesrin Karabul¹, Michael Beck¹, Alexander Sólyom², Eugen Mengel¹, and Christina Lampe¹

¹Villa Metabolica, Children’s Hospital, University of Mainz, Germany

²Pediatric Rheumatology, Pediatric Hospital, University of Pécs, Hungary

Introduction: One of the main features of several mucopolysaccharidoses (MPSs) is bone damage and remodeling, along with synovial thickening, clinically manifested as coarse facies, thickened and widened bones on x-rays, and joint contractures of varying severities. These signs and symptoms can be the presenting features of the disease and lead to clinical diagnosis when properly interpreted. The aversion to unnecessary exposure of patients to radiation and the question of which bones to examine by x-ray are considerable issues. Patients with MPS are additionally at a much higher risk of severe sequelae from anesthesia, making magnetic resonance imaging examination more difficult. Therefore, the question of the best method by which to measure bone and joint involvement and progression in patients with established disease is a difficult one. Methods: We used ultrasound to examine patients with MPS having joint disease, comparing the results to those typically found in inflammatory arthritis. The changes we have found in patients with MPS-IV are illustrated by a representative case report. We present documentation of ultrasound changes in patients with MPS, which might be useful to speed the diagnosis of disease and serve as a readily available and harmless tool for monitoring of changes in the bones and joints of patients. We also propose a basic scoring system for quantification of such changes. Results: From our observations, it appears that there are certain specific changes in the bones and joints of patients with MPS apparent on ultrasound examination. Conclusion: Ultrasound is a useful and convenient method for documenting and following bone and joint disease in patients with MPS. We have proposed a preliminary scoring system to follow bone and joint involvement in MPS and will explore the clinical correlations further.

1133 – Ear, Nose, and Throat Disease and the Early Diagnosis of Mucopolysaccharidoses: The HATT Project

Simon A. Jones¹, Iain A. Bruce², Micheline Wille³, Kristina Man³, and David Molter³

¹The Willink Biochemical Genetics Unit, St Mary’s Hospital, Manchester, United Kingdom

²Paediatric ENT Department, Royal Manchester Children’s Hospital, Manchester, United Kingdom

³Shire, Eysins, Switzerland

⁴Department of Otolaryngology, Washington University School of Medicine, St Louis, MO, USA

Introduction: Mucopolysaccharidoses (MPSs) are rare metabolic diseases resulting from deficiencies of specific lysosomal enzymes. Progressive upper airway obstruction and hearing loss are associated with several types, including MPS-I, -II, and -VI. The aim of this project is to evaluate ear, nose, and throat (ENT) interventions combined with other early disease manifestations as a strategy to promote early diagnosis of MPS. Methods: A systematic literature review was undertaken to determine median age at diagnosis, incidence of ENT interventions, prevalence and timing of ENT surgery for MPS-I, -II, and -VI (treatable MPS disorders). Results: The median ages at diagnosis of MPS-I, -II, and -VI are 2.6, 3.3, and 5 years, respectively. In MPS-II, the incidence of ventilation tubes is 40% to 100% and upper airway obstruction 48% to 100%, with corresponding incidences for MPS-I, 23% to 86% and 18% to 100%, and for MPS-VI, 66% to 100% and 45% to 85% (ranges represent lowest and highest values currently described in the literature), respectively. Adenotonsillar surgery and ventilation tubes are common interventions in early childhood that may precede diagnosis of MPS. Conclusion: The ENT surgeons could assist in early diagnosis of MPS. The HATT project—MPS-I, -II, and -VI Screening in a High Risk Population With Previous Surgical Repair or Presence of Inguinal and/or Umbilical [H]ernia in Combination With Pediatric Ear, Nose and Throat Surgery ([A]denoidectomy and/or [T]onsillectomy and/or [T]ympanostomy)—will evaluate a history of ENT surgery, combined with common early disease manifestations, as a strategy to promote early MPS diagnosis and management. This project will be discussed, with an invitation to join the international multicenter study. Conflicts of interest: Dr Bruce has received a travel grant and honorarium payable to the ‘Paediatric ENT Research Fund' at the Royal Manchester Children’s Hospital to give an invited lecture by Shire. Dr Jones has received honoraria, travel grants, or research grants from Shire. Dr Molter is an investigator in the HATT project and is a consultant for publication review and planning for Shire. He is also an educational lecturer for BioMarin. Drs Wille and Man are employees of Shire.

1136 - Mucopolysaccharidoses IIIA and IIIB: A Preliminary Comparison of Disease Trajectory Using Baseline Data From 2 Independent Natural History Studies

Kathleen Delaney¹, Chester Whitley¹, Maureen Cleary², Hayley Bullock², Laila Arash³, and Eugen Mengel³, Miriam Hartmann³, Paul Harmatz⁴, Nicolle Napier-Ionascu⁴, Nitin Nair⁵, Patrick Haslett⁵, and Elsa Shapiro¹

¹University of Minnesota, Minneapolis, MN, USA

² Great Ormond Street Hospital for Sick Children, London, United Kingdom

³Villa Metabolica, Center for Pediatric and Adolescent Medicine, MC University of Mainz, Germany

⁴Children’s Hospital Oakland, Oakland, CA, USA

⁵ Shire, Lexington, MA, USA

Introduction: Mucopolysaccharidosis III (MPS-III) A and B are progressive neurodegenerative diseases. Utilizing baseline data from natural history studies of MPS-IIIA (NCT01047306) and MPS-IIIB (NCT01509768), the cognitive, adaptive behavioral, and motor functions of patients were compared. Methods: Assessments used Vineland Adaptive Behavior Scales (VABS-II) for adaptive behavioral function and Bayley Scales of Infant and Toddler Development (BSID-III) or Kaufman Assessment Battery for Children (KABC-II) for cognitive function. Data were expressed as age equivalents (AEq) and developmental quotients (DQ = AEq/chronological age × 100). Results: Twenty-five patients with MPS-IIIA and 18 patients with MPS-IIIB were enrolled. Mean (standard deviation) age was 75 (±11) months and 148 (±26) months for MPS-IIIA and MPS-IIIB, respectively. Both cohorts included approximately 60% of male, and approximately 80% of the patients were diagnosed before 6 years of age, a surrogate for the “classic,” most severe phenotype. Plots of AEq and DQ versus age for adaptive behavior and cognitive status revealed overlap in the distributions for MPS-IIIA and IIIB. There was a strong, significant, correlation between cognitive AEq (BSID-III or KABC-II) and adaptive behavioral function (VABS-II) for both disease groups (r = .95 [MPS-IIIA]; r = .83 [MPS-IIIB]), indicating concurrent validity of these measures in both diseases. Correlation coefficient between the groups was similar in both magnitude and direction. Age differences between the populations with MPS-IIIA and MPS-IIIB and the small number of patients limit the scope of this analysis. Also, the lack of patients with MPS-IIIB <5 years means this critical early period of disease progression cannot be compared. Conclusion: This cross-sectional analysis suggests that rates of cognitive decline are comparable in older patients with MPS-IIIA and MPS-IIIB. However, the lack of younger patients with MPS-IIIB precludes any definitive conclusions about the comparability of trends in that age group. Conflicts of interest: These studies (NCT01047306 and NCT01509768) were funded by Shire. Ms Delaney has received consulting fees from Shire. Dr Whitley has received consulting fees from Actelion, Biomarin, Genzyme, Pfizer, Protalix, and Shire. He has received grants from Actelion, Amicus, Biomarin, Genzyme, Pfizer, Protalix, and Shire. Dr Arash has received consulting fees from Shire. Dr Mengel has received consulting fees from Actelion, Biomarin, Genzyme, and Shire. He has performed contracted research for Actelion, Biomarin, Genzyme, and Shire. Dr Harmatz has received travel, honoraria, and consulting fees from BioMarin, Shire, and Alexion and has undertaken contracted research for Alexion-Enobia, BioMarin, FerroKin-Shire, Sanofi-Genzyme, and Shire. He has also been the recipient of educational grants from BioMarin, Sanofi-Genzyme, and Shire. Drs Nair and Haslett are Shire employees. Dr Shapiro has received consulting fees from Armagen, Genzyme, and Shire, and grants from Genzyme, National MPS Society, Ryan Foundation, Shire, and Team Sanfilippo. Ms Hartmann and Drs Cleary, Bullock, and Napier-Ionascu have nothing to declare.

1137 - Phonological Assessment in Patients With Mucopolysaccharidoses I, II, and VI

Cintia M. Gonçalves¹, Sueli Canossa¹, Marco A. Curiati¹, Carolina S. Aranda¹, and Ana Maria Martins¹

¹Centro de Referencia em Erros Inatos do Metabolismo-Universidade Federal de Sao Paulo, Sao-Paulo, Brazil

Introduction: Mucopolysaccharidoses (MPSs) are a heterogeneous group of disorders caused by reduced degradation of one or more glycosaminoglycans. The MPS disorders are characterized by auditory, visual, musculoskeletal, cardiovascular and stomatognathic system, abnormal chewing, and swallowing. Objective: To identify characteristics of the organs’ phonoarticulatory muscles and functions such as swallowing, speech, voice, language, and hearing. Methods: We evaluated 46 patients with MPS-I, -II, and -VI at Centro de Referência em Erros Inatos do Metabolismo -Universidade Federal de Sao Paulo, MPS-I: 20 patients (12 males and 8 females), MPS-II: 16 patients (15 males and 1 female), and MPS-VI 10 patients (7 males and 3 females), all patients receiving enzyme replacement therapy. They were assessed using the protocol for the phoniatrics evaluation that seeks to recognize the structure and function of the stomatognathic system. Food were used for evaluation of swallowing and considering evaluation of voice, speech, and language the spontaneous talk was used. This instrument was chosen due to the difficulty in expression of these children. Results: All patients had at least 1 change in each of the items cited: difficulty in swallowing (39.6%), change in points articulation of speech sounds (67.4%), voice and tense hypernasality (60.9%), and difficulties in comprehension and expression (54.35%) and hearing impairment (67.4%). Conclusion: We conclude that patients with MPSs I, II, and VI show the changes in posture, tone, mobility, and sensitivity of the organs’ phonoarticulatory muscles, beyond the functions of swallowing, speech, and language. We proposed early intervention therapy, for these events showed improvement or remained without negative effects.

1154 - Alterations in Stomatognathic System of Patients With Mucopolysaccharidosis

Maria Beatriz Cabral¹, Regina Wanderley Cruz¹, Laira Renata Lemos¹, and Nelson Eduardo Freitas¹

¹Universidade Federal da Bahia, Salvador, Brazil

Introduction: According to the literature, patients with mucopolysaccharidosis (MPS) present a range of facial, joint, and bone changes that also affect the stomatognathic system. Objective: To present the changes found in the stomatognathic system of 29 patients with MPS at the outpatient clinic of Medical Genetics, the Federal University of Bahia (UFBA) Hospital in Salvador—BA (2011-2012). Methods: Cross-sectional study including all patients who are already monitored in the hospital and who agreed to participate in the study. Data collection was performed in 2 stages: oral examination and standardized interview conducted with the mother or the child’s main caretaker or with the patient himself or herself, focusing on the patient’s socioeconomic and behavioral variables related to oral health care. The study was approved by the Committee for Ethics in Research, Faculty of Dentistry, UFBA. Results and Discussion: Twenty-nine Brazilian patients with MPS were evaluated. A general situation of late diagnosis was found, with an average time for the diagnosis around 8.8 years (n = 19). Of the respondents’ parents, 43% are farmers and all families receive between 1 and 2 minimum wages per month. The most frequent findings in the stomatognathic system were macroglossia (88.5%), hypotonic lips (52%), reduced mouth opening (92.3%), ogival palate (100%), and frontal open bite (53.8%). Regarding caries experience, the dmft and decay missing or filled teeth scores were low, despite the poor oral hygiene that characterized the participants. The data suggest that the clinical approach to these patients should be multidisciplinary, and dentists should be aware of systemic clinical manifestations and those affecting the stomatognathic system so that the best treatment plan can be performed.

1156 - Determination of Clinical Characteristics of Colombian Patients With Morquio A Syndrome

Johanna C. Acosta Guio¹, Sandra M. Tapiero², Martha Solano³, and Harvy M. Velasco²

¹Instituto de ortopedia infantil roosevelt - instituto de nutrición genética y metabolismo, Ubosque, Bogotá, Colombia

²Maestría de Genética Humana, Universidad Nacional de Colombia, Cundinamarca, Colombia

³Fundación Cardio infantil, Cundinamarca, Colombia

Introduction: Mucopolysaccharidosis (MPS) type IVA or Morquio A syndrome (Online Mendelian Inheritance in Man # 253000) is an autosomal recessive disease, caused by mutations in the N-acetylgalatosamine-6-sulfate-sulfatase gene, generating deficiencies in the enzyme N-acetylgalactosamine-6-sulfate-sulfatase, responsible for the degradation of glycosaminoglycans keratan sulfate and chondroitin 6 sulfate, leading to the accumulation of these mainly in bone, cartilage, heart, and lungs. Since MPS-IVA has a high incidence in Colombia (0.68:100 000), the phenotypic description of a population sample was performed. Materials and Methods: We analyzed 14 patients with clinical diagnosis of MPS-IVA confirmed with enzymatic activity in leukocyte; demographic variables, anthropometric variables, and clinical endophenotypes were analyzed using clinical methodology proposed by Montaño et al. Results: Fourteen patients were analyzed from 12 unrelated families (50% male and 50% female), with a mean age of 13.2 years (confidence interval [CI] ±8.5). With respect to the beginning of symptoms, 57.14% occurred between 2 and 3 years, 28.57% between 3 and 6 months, and 14.29% between 5 and 7 years. Among the most common symptoms, thoracic deformity, genu valgus, disproportionate short stature, and gait disturbances are described. The mean age at diagnosis was 6.7 years (CI ±7.16). The 92.85% present severe phenotype, while 7.15% have attenuated phenotype. Among the comorbidities of severe cases, 23.07% had cord compression, 76.92% had scoliosis, and 84.61% had hip dislocation. Discussion: As previously described in the literature, a higher percentage for occurrence of severe phenotype is found; additionally, the authors believe that the presence of neuro, orthopedic, and cardiovascular comorbidities must be taken into account to classify patients according its clinical severity.

1167 - Patient, Therapeutic, and Metabolic Predictors of Sleep Disordered Breathing in Mucopolysaccharidosis I

Abhijit Ricky Pal¹, Eveline J. Langereis², Muhammad A. Saif¹, Jean Mercer³, Karen L. Tylee³, Heather J. Church³, Robert F. Wynn⁴, Frits A. Wijberg², Iain A. Bruce⁴, Jones Jones⁴, and Brian W. Bigger⁵

¹Department of Paediatric Otolaryngology, Royal Manchester Children’s Hospital, Manchester; United Kingdom

²Department of Paediatric Metabolic Diseases, Emma Children’s Hospital, AMC, the Netherlands

³Willink Biochemical Genetics Unit, Genetic Medicine, St Mary’s Hospital, Manchester, United Kingdom

⁴Department of Haematology/BMT, Royal Manchester Children’s Hospital, Manchester, United Kingdom

⁵Stem Cell & Neurotherapies, Faculty of Medical and Human Sciences, University of Manchester, Manchester, United Kingdom

Introduction: Mucopolysaccharidosis I (MPS-I) commonly manifests with airway obstruction and sleep disordered breathing (SDB). The success of current treatment strategies, including hematopoietic stem cell transplantation (HSCT) for the severe Hurler phenotype and enzyme replacement therapy (ERT) for the attenuated Hurler-Scheie form, may be influenced by a number of factors, including age at commencement of treatment and monitored using biomarkers of metabolic correction. We aim to determine whether therapeutic factors and biomarkers predict the severity of SDB. Methods: Therapeutic, clinical, and biomarker data, including 158 sleep oximetry studies, urine dermatan sulfate–chondroitin sulfate (DS–CS) ratio, and leukocyte α-l-iduronidase (IDUA) enzyme level post-HSCT were collected in 62 patients with MPS-I (44 Hurler and 18 Hurler-Scheie) between 6 months pretreatment and 16 years posttreatment (mean follow-up 2.5 years). The presence and functional nature of an immune response to ERT was determined using enzyme-linked immunosorbent assay and a novel cellular uptake inhibition assay. Multivariate analysis was performed to determine significant predictors of SDB. Results: Forty-one patients received HSCT, while 21 received ERT alone. The incidence of SDB in our cohort is 68% with a median oxygen desaturation index 4% (ODI4%) of 6.6/h. A higher proportion of ERT-treated patients demonstrate progression of SDB compared to HSCT-treated patients (73% vs 26%). The DS–CS ratio is a significant predictor for the presence, progression, and severity of SDB in patients with MPS-I (P = .025, .0026, .016). The leukocyte IDUA level 1 year post-HSCT and age at transplant predict for the presence and progression of SDB in patients with Hurler syndrome (P = .011, .05). Cellular uptake inhibition in ERT-treated patients was a significant predictor of median nocturnal oxygen saturation and ODI4% (P = .0007, 0.0015). Conclusion: Sleep disordered breathing continues to create a significant burden of disease in MPS-I, despite the current therapeutic strategies. The severity and progression of SDB may be reduced by early treatment and factors that optimize metabolic correction.

1168 - Spinal Cord Compression in Patients With Mucopolysaccharidosis VI

William O. S. Cerqueira¹, Ingrid L. S. Gomes¹, Angelina Acosta¹, and Emilia K. E. A. Leão¹

¹Universidade do Estado da Bahia, Salvador, Brazil

Objective: To identify clinical signs of spinal cord compression (SCC) in patients with mucopolysaccharidosis (MPS) VI in enzyme replacement therapy (ERT). Methodology: Observational and descriptive study of series of cases. Sample consists of individuals with biochemical diagnosis of MPS-VI who attended the outpatient medical genetics service of Hospital Universitário Professor Edgard Santos/Federal University of Bahia. Neurological clinic evaluation was realized for patients on ERT. Results: The study included 15 patients (53.3% from Monte Santo—Bahia). In this sample, there were 67% male, and the average age of the patients was 11 years. The average age of diagnosis was 5 years, the average age of onset of ERT was 7 years, and the average time of ERT was 4 years. Only 4 (27%) patients realized magnetic resonance imaging (MRI) during the start of the treatment and the examinations showed stenosis of the craniovertebral junction and cervical spinal canal. Among these patients, 2 male siblings from Monte Santo on ERT for 6 years showed the following findings: progressive limbs weakness and worsening of gait, global hyperreflexia and bilateral clonus, and Babinski sign, associated with the important thoracic lumbar spinal deformity. Both the patients and other patients from Monte Santo have the p.H178L mutation. Conclusion: Spinal cord compression is a neurological complication of MPS-VI, and the clinical signs are very suggestive. The MRI contributes to the diagnosis, but only neuroimage did not confirm the SCC and the detailed clinical examination is very important. The SCC can occur in people with MPS-VI even if they are on ERT, but 1 question remains: do the ERT increase this risk of SCC?

1173 - Skeletal Disease of 3 Brazilian Siblings With Mucopolysaccharidosis VI Who Received Enzyme Replacement Therapy

Ada Maria Farias Sousa Borges¹, Kelnner Portela Luz², and Erlane Marques Ribeiro²

¹College of Medicine Estácio de Juazeiro-do-Norte, Estácio-FMJ, Juazeiro do Norte, Brazil

²Esp., Hospital Geral of Fortleza, HGF, Fortaleza, Brazil

Introduction: The skeleton is generally one of the most severely affected organs in patients with mucopolysaccharidosis VI (MPS-VI; Maroteaux-Lamy syndrome), causing severe morbidity. Patients with MPS-VI typically show dysostosis multiplex. The aim of this study was to describe 3 Brazilian siblings with MPS-VI, in order to illustrate the wide spectrum of possible manifestations. Methods: Case reports of 3 siblings with MPS-VI who are receiving enzyme replacement therapy (ERT) with recombinant human acetylgalactosamine 4-sulfatase (ARSB; Naglazyme BioMarin Pharmaceutical Inc, Novato, California). The initiation of treatment for each patient was, respectively, at 6 years and 3 months for the first patient, 2 years and 9 months for the second patient, and 5 days of life for the third patient. Results: At 5 years of age, the first patient presented more severe radiographic lesions than the second patient, and ERT had not been initiated for both the patients yet. At 5 years of age, the first patient presented radiographic lesions suggestive of dysostosis multiplex, but these lesions were less severe than in the second patient. The ERT was not started for the 3 patients for 3 months after the start. The third patient does not present clinical manifestations for radiographic lesions, while the first and second patients who started ERT later present an altered walking. Cervical spine magnetic resonance imaging showed lesions more severe in first patient than in the second patient and did not show lesions in third patient. Conclusion: Although the third patient has started therapy early, it is not known whether bone lesions resulted from no treatment for 3 months or whether the Naglazyme dose should be adjusted to ERT in the neonatal period. Despite bone lesions at 5 years in the third patient, probably the discontinuation of therapy interfered with the efficacy of the therapy and determined the radiographic lesions that did not affect the quality of life.

1175 - Obstructive Sleep Apnea Syndrome in Patients With Mucopolysaccharidosis

Danielle de Araujo Torres¹, Ana Carolina Esposito¹, Anneliese Lopes Barth¹, and Dafne Horovitz¹

¹Instituto Nacional da Saúde da Mulher, da Criança e do Adolescente-Fernandes Figueira/ FioCruz, Rio de Janeiro, Brazil

Introduction and Objectives: In patients with mucopolysaccharidosis (MPS), the macroglossia, adenotonsillar hypertrophy, and deposition of glycosaminoglycans (GAGs) on tracheobronchial mucosa may lead to the development of obstructive sleep apnea syndrome (OSAS). This study aims to evaluate the prevalence of OSAS in a group of patients with MPS and evolutionarily compare the severity of OSAS in those on enzyme replacement therapy (ERT). Materials and Methods: Review of records of 23 patients with MPS (3 type I; 6 type II; 6 type IV and 8 type VI), with age range 3 to 36 years, followed in Instituto Fernandes Figueira/FioCruz, Rio de Janeiro, Brazil, who underwent polysomnography (total of 48 examinations). The American Academy of Sleep Medicine (AASM) criteria for OSAS by age group were used. Results: Of the 23 patients, 21 fulfilled the diagnostic criteria for OSAS, revealing a prevalence of 91.3% in the group. Among the 48 examinations, 9 (18%) were normal, 12 (25%) were classified as mild OSAS, 15 (31%) as moderate, and 12 (25%) as intense. Fourteen patients, all on ERT, underwent more than one evaluation, which allowed an evolutionary comparison of the OSAS severity. There was an evolutionary improvement in 5 (35%) patients, maintenance of severity in 3 (21%) patients, and worsening in 6 (42%) patients. Discussion and Conclusion: The OSAS is often found in patients with MPS. Different treatments may be offered such as adenotonsillectomy or appliances using positive airway pressure (continuous positive airway pressure /bilevel positive airway pressure), the true impact of ERT in OSAS still unknown. Due to the high prevalence of OSAS in MPS, patients should systematically undergo sleep studies, focusing on the detection and treatment of respiratory abnormalities. Further studies are needed to verify the efficacy of ERT in OSAS associated with MPS.

1179 - Mucopolysaccharidosis Type VI: Clinical Aspects of 10 Years Follow-Up of 2 Sisters Accompanied in University Hospital Bettina Ferro De Souza, Belem, Para, Brazil

Isabel C. N. Souza¹, Raimunda H. F. Feio¹, and Luiz C. S. Silva¹

¹Universidade Federal Do Pará, Belém, Brazil

Report of the evolution of 2 sisters with mucopolysaccharidosis VI (MPS-VI) in enzyme replacement therapy (ERT) for 10 years, at the University Hospital Bettina Ferro de Souza. LMP is of short stature aged 9 had 100 cm corneal clouding +/4+, hepatomegaly, and reduced joint mobility ++/4+. After 10 years of ERT, LMP showed a growth of 22.5 cm, had maintained corneal clouding, without hepatomegaly, and showed improvement in joint mobility. In the evaluation of complementary examinations and glycosaminoglycan (GAG) presented in the initial polysomnography, mild restrictive respiratory disorder was observed and in control mild snoring was observed. The initial echocardiogram showed thickening of the mitral and aortic leaflets, mild mitral regurgitation and in control thickening of the mitral, aortic, and tricuspid leaflets, left atrium enlarged with mild mitral, aortic, and tricuspid insufficiency were observed. Increased GAG and normal after. The FMP at age 7 had the same height as her sister, 100 cm; corneal clouding + /4 +, hepatomegaly, and reduced joint mobility ++/4+. After grown 26.5 cm, corneal clouding maintained, without hepatomegaly, improves the mobility of small joints, maintaining commitment shoulder. Initial polysomnography showed mild restrictive disordered breathing and in control, severe obstructive disorder was observed. The initial echocardiogram showed thickening of the mitral, aortic and tricuspid leaflets, mild regurgitation mitral, aortic and tricuspid and, in control, thickening of the mitral leaflets and aortic, mitral regurgitation and mild aortic was observed. Increased GAG and increased slightly after. The ERT initiated 2 years earlier by FMP seem to have allowed greater height growth than her sister, despite having greater joint involvement. Regarding the cardiac involvement, there is also evidence of better progress than LMP. Generally, ERT combined with regular clinical follow-up has been providing both satisfactory gains of several manifestations of this complex disease.

1181 - Prevalence of Respiratory Allergies in Patients With Morquio A Syndrome and Investigation of its Potential Association With Urinary Glycosaminoglycans Levels

Clarissa T. Habekost¹, Luciana Giugliani¹, Cláudia Vanzella^1,2, Débora M. B. Pereira¹, and Roberto Giugliani^1,2,3

¹Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

²Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

³INAGEMP, Porto Alegre, Brazil

Introduction: Morquio A syndrome or mucopolysaccharidosis IVA (MPS-IVA) is a lysosomal storage disease caused by the deficiency of the enzyme N-acetylgalatosamine-6-sulfate-sulfatase, which catalyzes a step in the catabolism of glycosaminoglycans (GAGs), keratan sulfate, and chondroitin-6-sulfate. Respiratory problems were always reported as a frequent issue in all mucopolysaccharidoses. In addition, up to now, the chest anatomical alterations were considered the main etiology of the respiratory findings and, to our knowledge, there are not any reports regarding a higher frequency of respiratory allergies in patients with MPS-IVA. Objectives: To investigate the frequency of respiratory allergies in Brazilian patients with MPS-IVA in comparison to literature data and in relation to the urinary GAGs. Methods: History of allergic chronic rhinitis and chronic sinusitis and asthma was considered as evidence of respiratory allergies. The MPS Brazil network has records of 135 patients with MPS-IVA, and we were able to evaluate 47 of those patients in regard to their medical history and urinary GAGs. Results: Forty-seven percent had history of respiratory allergies. Approximately 17% had presented with asthma and 30% with rhino sinusitis symptoms. The levels of urinary GAGs were not related to the history of respiratory allergies neither through regression analyses (P = .18) nor through comparison between medias (P = .18). Conclusion: Our results show that respiratory allergies are quite frequent in the population with MPS-IVA and should be considered as an important factor of respiratory symptoms in this population. However, further studies are necessary for better understanding of the pathophysiological mechanisms of allergy in these patients.

1182 - Neurophysiological Evaluation in Cervical Myelopathy in Patients With Mucopolysaccharidosis: The Somatosensory and Motor-Evoked Potentials

Daniel S. Silva¹, Anneliese L. Barth¹, Ana C. Esposito¹, Alessandra P. Costa¹, Juan C. Llerena¹, and Dafne DG. Horovitz¹

¹Instituto Fernandes Figueira, Rio de Janeiro, Brazil

Introduction: Cervical myelopathy occurs in patients with mucopolysaccharidosis (MPS) having different degrees of functional impairment. Magnetic resonance imaging (MRI) has been the method of choice to detect spinal cord compression. Somatosensory-evoked potentials (SEPs) and motor-evoked potentials (MEPs) may offer a look at physiologic anatomy and provide a sensitive tool for assessment of central sensory and motor pathways. Methods: We present 28 patients with MPS having spinal cord compression in whom we recorded ulnar and posterior tibial nerve SEPs (ulnar SEPs: brachial plexus potentials [N9], cervical spinal cord potentials [N13], cortical waveforms [N20]; posterior tibial SEPs: lumbar potentials [N21] and thalamocortical potentials [P37]) and calculated central conduction time; we also performed MEPs using magnetic stimulation of roots and brain and calculated central motor conduction time. Results: Somatosensory-evoked potentials: SEPs were performed 32 times in 25 patients and the results were abnormal after stimulation of upper and lower limbs in almost all cases (with only 2 exceptions). Motor-evoked potentials: waveforms were obtained in awaken patients; MEPs were performed 25 times in 17 patients and the results were abnormal in all patients (no exceptions). Conclusion: Evoked potentials and magnetic resonance imaging are complementary tests. The former provides a view of functional anatomy, whereas the latter registers structure. In the literature, it is established that patients with MPS often develop spinal cord compression during the course of the disease; in our opinion, the term “dysfunction” is more adequated in this context because, despite the different anatomic and physiologic backgroud in each type of the disease, in all of them neurophysiological evaluation has shown severe impairment of conduction in sensory and motor central pathways. We believe that SEP and MEP analyses are useful to detect functional impairment of the sensory and motor central pathways in these patients. Evoked potentials allow mapping the anatomic specificity, the functional sensitivity, and have the ability to monitor changes over time.

1185 - The Speech in Mucopolysaccharidosis

Danielle S. Silva¹, Joice S. Santana², Angelina X. Acosta³, Emilia K. E. A. Leão¹

¹Universidade do Estado da Bahia, Salvador, Brazil

²Hospitalar Universitário Professor Edgard Santos, Salvador, Brazil

³Chefe do Serviço de Genética do HUPES, Salvador, Brazil

Objective: To characterize the speech disorders and the stomatognathic system in individuals with mucopolysaccharidosis (MPS) who attended a reference medical genetics service in the state of Bahia. Methodology: Observational and descriptive study of series of cases. Sample consists of individuals with biochemical diagnosis of MPS who attended outpatient medical genetics service Hospitalar Universitário Professor Edgard Santos/Universidade do Estado da Bahia. Protocols were applied containing evaluation of posture, morphology, mobility, and tone of the articulators and speech through the naming and repetition of words in the ABFW test. Result: The study included 9 patients with MPS types II (1), III (2). and VI (6), the average age was 11 years, and 8 patients are on enzyme replacement therapy. In the evaluation of the stomatognathic system, 68% (6 of 9) had everted lower lip, 55% (5 of 9) enlarged tongue, 89% (8 of 9) high and narrow palate, and 78% (7 of 9) anterior open bite. Hypofunction of buccinator and tongue was found in 100% (9 of 9) of patients and impaired mobility of the mandible was observed in 78% (7 of 9) of the participants. The speech evaluation revealed that 89% (8 of 9) have frontal lisp, 78% (7 of 9) phoneme substitution, and 45% (4 of 9) distortion. Conclusion: Structural alterations were common in the study that agrees with the literature findings. This condition mainly arises because of accumulation of glycosaminoglycans in the upper airways. Speech disorders were prevalent and justified by the disharmony of oral myofunctional; once-for-a-good joint phonemic is necessary for the integrity of the articulators. The frontal lisp was the most prevalent condition for abnormal speech, consistent with the findings of high rates of anterior open bite and hypofunction tongue. The results suggest that orofacial myofunctional disorders in patients with MPS significantly undermine the speech. Speech therapy is essential to ensure the effectiveness of verbal communication of these individuals.

1187 - Morquio A Syndrome (Mucopolysaccharidosis IVA): Brothers Presentations

Olga Y. Echeverri¹, Eugenia Espinosa², Johana M. Guevara¹, Yudy A. Ardila³, Ninna F. Pulido³, and Lisseth Carbarcas³

¹Instituto de Errores Innatos del Metabolismo. U. Javeriana, Bogotá, Colombia

²Instituto de Ortopedia Infantil Roosevelt, Bogotá, Colombia

³Hospital Universitario San Ignacio, Bogotá, Colombia

Introduction: Mucopolysaccharidosis IVA (MPS-IVA) is characterized by an important skeletal involvement without compromise of the mental sphere. Objectives: To present 2 couples of brothers diagnosed as MPS-IVA. For both couples, the second case was detected during familial study after diagnosis of the index case. In the first couple, the initial clinical presentation of the index case is outstanding; the second one is a couple of half-brothers. Methods: All patients were evaluated by different medical specialties. Diagnosis was made based on skeletal alterations and dysmorphic features. Studies requested included urine analysis and bone radiology. Diagnosis was confirmed by enzyme activity measured in blood cells. Results: Couple 1: Females, currently 7.7 and 2.7 years old. Older sister, the index case, consulted by generalized edema and was diagnosed as nephrotic syndrome. The MPS-like phenotype was observed in this patient without compromise of central nervous system. Biochemical and enzymatic studies confirmed the MPS-IVA diagnosis. Diagnostic tests were also performed on the younger sister who presented flat nasal bridge and hip dysplasia as the only abnormal findings. The biochemical studies confirmed the MPS-IVA diagnosis. Couple 2: Males, currently 10 and 4 years old. Older brother, the index case, presented signs and symptoms suggestive of an MPS, for this reason biochemical studies were requested. Results confirmed MPS-IVA diagnosis. In a second maternal brother initially without suggestive phenotype, the N-acetylgalatosamine-6-sulfate-sulfatase deficiency was also confirmed. Family refused molecular studies. Conclusion: The enzyme replacement therapy for MPS-IVA was recently approved. Thus, for a successful treatment, it is of great importance to make an early diagnosis. Unfortunately, in most cases diagnosis is based on clinical manifestations that occur at an advanced age in which the outcome of treatment may not be as successful as in early treated patients, therefore family studies are crucial for early diagnosis in siblings.

1189 - Morquio B Syndrome (Mucopolysaccharidosis IVB): Clinical Case Presentation

Olga Y. Echeverri¹, Johana C. Acosta², Yudy A. Ardila³, Johana M. Guevara¹, Liseth Cabarcas³, Ninna F. Pulido³, and Luis A. Barrera¹

¹Instituto de Errores Innatos del Metabolismo. U. Javeriana, Bogotá, Colombia

²Instituto de Ortopedia Infantil Roosevelt, Instituto de investigación en nutrición genética y metabolism, Bogotá, Colombia

³Hospital Universitario San Ignacio, Bogotá, Colombia

Introduction: Mucopolysaccharidoses are a group of inborn errors of metabolism that present a wide clinical and biochemical spectrum. Although diagnosis may be facilitated by the striking physical features’ characteristics, only the biochemical studies allow classifying among subtypes, which is important as enzyme replacement therapy has been developed for some of them. Objectives: To report a clinical case of 7-year-old female patient, born from the second pregnancy, without perinatal complications. Although her parents are from the same geographical area, no consanguinity was established. First, signs and symptoms were evident at 8 months when hip dysplasia was detected. At 18 months, the patient presented gait disturbance as a consequence of genu valgu that has been slowly progressive. Since she was 6 years old, thoracic deformity was noted (pectum carinatum). Initial diagnosis was spondylo-metaphyseal chondrodysplasia. Methods: Column radiography, cardiac evaluation, and biochemical analysis for MPS were performed. Results: Patient’s physical examination revealed disproportionate short stature (114 cm < P3), mediofacial hypoplasia, anteverted nares, systolic murmur grade II, increased thoracic anteroposterior diameter, and short thorax. Initial x-rays reported hyperlordosis and lumbar gibbus, genu valgu, epiphyseal widening, and hip dysplasia. Columnar x-ray showed thoracolumbar scoliosis, ovoid vertebral bodies (thoracic and lumbar), and diminished bone density. Biochemical studies showed N-acetylgalatosamine-6-sulfate-sulfatase enzyme activity as normal (4.33 nmol/h/mg; control 6.87 nmol/h/mg) and β-galactosidase as diminished (0.55 nmol/h/mg; control: 21.42 nmol/h/mg), establishing diagnosis of MPS-IVB. Molecular studies are in process in order to establish possible genotype–phenotype correlation. Conclusion: Clinical characteristics observed in the patient lead to consider MPS as a possible diagnosis, and MPS-IVB was confirmed by biochemical studies. This disease is one of the less frequent among MPS and is clinically indistinguishable from MPS-IVA. Spondylo-metaphyseal chondrodysplasia is usually the first diagnosis considered in these patients, since these diseases are more frequent; however, Morquio disease must always be included in the presumptive diagnosis.

1190 - Skeletal Features in Patients With Nonclassical Mucopolysaccharidosis IV Seen in Northern Ireland

Fiona J. Stewart¹, and Simon Jones²

¹Northern Ireland Regional Genetics Service, Belfast, Northern Ireland

²Willink Unit Manchester, Manchester, England

Northern Ireland has a population of 1.7 million people. In this population, there are 15 patients with mucopolysaccharidosis IV (MPS-IV) Morquio disease. Of these, 5 have the classical form of the disease and 10 have a nonclassical form. In the nonclassical cases, heights of female range from 140 to 171 cm, and heights of male range from 151 to 170 cm. The patients presented in mid-childhood with abnormal gait and pain in their hips. Childhood x-rays showed flattening and irregularity of the femoral heads. There was later development of irregularity of the vertebrae. All were felt to have either spondyloepiphyseal or spondylometaphyseal dysplasia. In late teens and early 20s, the changes in hips deteriorated. They were described as being like severe osteoarthritis, and 8 of 10 patients have had at least 1 hip replaced. With increasing age, the patients developed degeneration changes in their elbows with irregularity of the articular surface and loose bodies. They all started to get severe pain in their ankles. Imaging described the talus as having an appearance akin to avascular necrosis. There was also vertical fracturing of the talus described and severe osteoarthritis of the ankle joint. Radiological images showing all these features will be shown. One patient developed severe changes in his spine when young. He had a scoliosis and had very extensive surgery. Now in his mid-30s, he has severe pain in his back. Much of the early metalwork has fractured, and he is currently being assessed for spinal surgery. This report aims to illustrate the aggressive joint destruction that can occur in nonclassical MPS-IV with resultant pain, limited mobility, and consequently an inability to work. This has had a major impact on their quality of life. Conflicts of interest: Both authors have received travel assistance and honoraria from BioMarin.

1194 - Unrecognized Phenotype of Mucopolysaccharidosis Type VI

Anna Tylki-Szymanska¹, Agnieszka Jurecka², and Agnieszka Rozdzynska-Swiatkowska³

¹Department of Pediatrics, Nutrition and Metabolic Diseases, The Children’s Memorial Health Institute, Warszawa, Poland

²Department of Genetics, University of Gdańsk, Gdańsk, Poland

³Anthropology Laboratory, The Children’s Memorial Health Institute, Warszawa, Poland

Background: Mucopolysaccharidosis type VI (MPS-VI; Maroteaux-Lamy syndrome, Online Mendelian Inheritance in Man 253200) is caused by mutations in the gene coding for N-acetylgalactosamine-4-sulfatase (4-sulfatase, arylsulfatase B, EC 3.1.6.12), a lysosomal enzyme involved in the degradation of dermatan sulfate. The clinical presentation of MPS-VI varies greatly with respect to age of onset and rate of disease progression, and 2 types of attenuated MPS-VI phenotypes can be distinguished: osteoarticular and cardiac, both with a clear genotype–phenotype correlation. Methods: We describe a cohort of newly recognized patients with MPS-VI (n = 4) homozygous for the p.R152W mutation. Results: The first clinical signs in these patients developed around their teenage years and included the triad of heart involvement, joint limitation, and skeletal abnormalities. Symptoms of cardiac valve disease were the most prevalent chief complaints before the diagnosis of MPS-VI. Prior to diagnosis, both joint and skeletal abnormalities, though radiologically significant, did not lead to clinically significant symptoms and could have been easily missed in routine health care. Similarly, other features characteristic for MPS-VI such as facial dysmorphia were either mild or absent. Conclusion: Individuals with p.R152W in the homozygous state seem to significantly differ from other attenuated patients with MPS-VI. Relatively mild osteoarticular symptoms in these patients do not lead the patients to seek professional help and therefore cause a significant diagnostic delay.

1197 - Dentofacial Characteristics of Children and Adolescents With Mucopolysaccharidosis: A Pilot Study

Tahyná Duda Deps¹, Esdras Campos França¹, Eugenia Ribeiro Valadares¹, Isabela Almeida Pordeus¹, and Ana Cristina Borges Oliveira¹

¹Hospital de Clínicas da UFMG, Belo Horizonte, Brazil

Objective: To describe the dentofacial characteristics of children and adolescents with mucopolysaccharidosis. Methods: Data collection from this pilot study was performed in the dental clinics for children/adolescents at the Faculty of Dentistry of the Federal University of Minas Gerais (UFMG) in Belo Horizonte, Brazil. This study included 9 children/adolescents diagnosed with MPS aged 5 to 21 years, assisted by the Association of Mucopolysaccharidosis of Minas Gerais or by the Clinic of Inborn Errors of Metabolism of the Clinics Hospital of the UFMG. The Research Ethics Committee of the UFMG approved this study. Dentofacial characteristics were investigated by clinical examination of malocclusion (vertical and transversal), dental caries, and oral hygiene. Results: The average age of the participants was 12.5 years (+3.4), with most of them being males (66.7%). Regarding the type of MPS, 33.3% were type I, 33.3% type II, and 33.3% type VI. Most (66.7%) children/adolescents were identified with some malocclusion. Dental caries was present in 44.4% of the participants and oral hygiene was satisfactory in 66.7% of them. Conclusion: The prevalence of dentofacial alterations present in this portion of the population was high. The oral hygiene was satisfactory in most children/adolescents with MPS. Conflicts of interest: The study “Oral Features of Children/Adolescents Wwith Mucopolysaccharidosis: A Pilot Study” is approved by the Ethics Committee of the Federal University of Minas Gerais and presents no conflict of interest.

1202 - Cerebrospinal Fluid Flow Study Using Magnetic Resonance Imaging in Mucopolysaccharidosis

Carmen S. C. Mendes¹, Maret H. Rand¹, Marco A. Curiati¹, Patrícia Feliciano¹, Carolina S. Aranda¹, Maria Lucia Borri², and Ana Maria Martins¹

¹Centro de Referência em Erros Inatos do Metabolismo-Universidade Federal de Sao Paulo, Sao Paulo, Brazil

²DDI-Universidade Federal de Sao Paulo, Sau Paulo, Brazil

Introduction: Cerebrospinal fluid (CSF) flow study is a noninvasive imaging technique that is useful for the evaluation of patients with hydrocephalus. Objective: To evaluate the CSF flow using magnetic resonance imaging (MRI) in 5 patients with mucopolysaccharidosis having neurological manifestations. Methods: We analyzed CSF flow study by phase-contrast MRI (PC-MRI) in 5 patients: MPS type I in 2 patients, MPS type I in 2 patients, and MPS type VI in 1 patient. The age range was 5 to 32 years, 3 females and 2 males, with neurologic signs and symptoms. Results: All patients showed neurological examination abnormalities; the most frequent findings were pyramidal signs in 5 patients and macrocephaly in 3. Severe cognitive impairment was observed in 1 patient. The MRI abnormalities were observed in all patients. The most frequent MRI findings were dilated perivascular spaces in all 5 patients, indicating hydrocephalus in 3 patients and white matter changes in 3. Three patients showed abnormalities in CSF flow study, 2 of them with hydrocephalus, and all had stenosis in craniovertebral junction. Patient 1: MPS-VI, 5 years, CSF flow reduced in foramen magnum, craniovertebral stenosis at C1 and C2. Patient 2: MPS-II, 3 years, no CSF flow in foramen magnum, narrowing of the spinal canal at C1 and C2. Patient 3: MPS-I, 7 years, hyperdynamic CSF flow in third and fourth ventricles, mesencephalic aqueducts, and reduced flow in foramen magnum, craniovertebral, and cervical stenosis. Conclusion: Neuroradiological changes in MPS have been described before, although we have few articles regarding this subject. The role of brain CSF flow study is an adjunct for the diagnosis and therapy planning of abnormalities like hydrocephalus and high intracranial pressure.

1205 - Prevalence of Sleep Apnea in Patients With Mucopolysaccharidosis IVA

Andressa Federhen¹, Angela B. John², Camila M. Bittar¹, Simone C. Fagondes², Taiane A. Vieira³, and Roberto Giugliani¹

¹Medical Genetics Service, Hospital de Clinicas de Porto Alegre, Brazil

²Pulmonology Service, Hospital de Clinicas de Porto Alegre, Brazil

³Medical Genetics Service/Post-graduate Research Group, Hospital de Clinicas de Porto Alegre, Brazil

Objective: To determine the prevalence of obstructive sleep apnea (OSA) in a cohort of patients with mucopolysaccharidosis (MPS) IVA before start of enzyme replacement therapy (ERT) with recombinant human N-acetylgalactosamine-6-sulfatase (BMN110, approved by Food and Drug Administration as Vimizim). Methods: Patients enrolled in a phase III study (arms: placebo, drug weekly, drug every other week, and for 24 weeks) followed by an open-label extension study (arms: drug weekly, and drug every other week) underwent standard polysomnography (PSG) at baseline. Results: Fifteen patients (8 males) with median age of 26.3 years (5-34) underwent PSG before the start of ERT. Results showed a median apnea-hypopnea index of 3.1 (0.6-15.2) in 15 patients, and 9 of 15 patients had OSA (7 mild and 2 severe). Conclusion: The prevalence of OSA in patients with MPS-IVA (60%) seems to be lower than in other MPS and does not seem to be related to the patients age. These data will be instrumental to allow the interpretation of the results of PSG after treatment with ERT. Conflicts of interest: Some authors are investigators/study coordinators in sponsored trials.

1215 - Knee Evaluation in Patients With Mucopolysaccharidosis IVA

Paula F. V. Medeiros¹, Fabio G. Nepomuceno², Thiago O. Silva¹, Adriana L. Ortega², Cátia Eufrazino¹, Aline F. Alves¹, and Arthur A. Moreira¹

¹Universidade Federal de Campina Grande, Hospital, Campina Grande, Paraíba, Brazil

²Universidade Cruzeiro do Sul, São Paulo, Brazil

Objectives: To evaluate knee angle and strength of the quadriceps femoris muscle in patients with mucopolysaccharidosis IVA (MPS-IVA). Methods: Nineteen patients with MPS-IVA were included, 6 females and 13 males, aged 7 to 44 years. The patients were evaluated for the measure of the angulation of their lower limbs separately through a single-film radiologic examination with a goniometer (normal value 7-9°). A digital dynamometer was used to estimate the strength of the quadriceps femoris muscle with the knee in 45° of flexion. Results: The 12 patients without knee surgery presented average valgus lower limbs angulation of 30.55° (10-55) in the right knee and 26.81°(16-40) in the left one, and with average strength of 16.07 N in the right knee and 19.9 N in the left one. The 7 patients who underwent orthopedic surgery to correct knee valgus presented an average valgus of 10.57° (−7 to 30) in the right knee and 7.14° (−5 to 21) in the left one, with average strength of 22 N in both right and left knees. The study shows that 72% of the patients operated can walk, whereas only 50% of those nonoperated can. Three siblings have significant phenotypic variation: 2 males are unable to walk, with severe valgus (average of 47.5° in the right knee and 29.5° in the left one), whereas the female one can walk (10° and 18°) in left and right knees, respectively, and had about 6 times more knee strength than her brothers. Of the females with MPS-IVA, 66.7% can walk although none of them had been operated, whereas only 53.84% of male patients can walk and 53.84% underwent a knee corrective surgery. Conclusion: The study detected severe valgus and knee strength deficit among the patients with MPS-IVA unable to walk. These parameters seem worse in the nonoperated and in male patients.

1223 - Clinical Manifestations and Natural Course of Mucopolysaccharidosis IVA

Tatiana Munoz¹, Julian Raiman², Hanna Faghfoury², and Jennifer Semotok³

¹Hospital for Sick Children, Division of Clinical and Metabolic Genetics, Toronto, Canada

²Clinical and Metabolic Genetics, Hospital for Sick Children, Toronto, Canada

³Health Network and Mount Sinai Hospital, Toronto, Canada

Introduction: Mucopolysaccharidosis (MPS) type IVA (MPS-IVA)is an autosomal recessive lysosomal storage disease caused by the deficiency of N-acetylgalactosamine-6-sulfate sulfatase (GALNS), needed to degrade the glycosaminoglycans (GAGs) keratan and chondroitin-6-sulfate. Objectives: To describe the natural history of patients with MPS-IVA, from childhood through to adulthood. Methods: Retrospective review of patients diagnosed with MPS-IVA over the last 25 years at 2 centers in Toronto, Canada. Data were collected retrospectively from medical records. Results: A total of 14 patients were enrolled in this study, 7 males and 7 females. The mean age of the patients was 21.7 years. Initial symptoms were noticed between 6 months and 5 years of age. The average age of diagnosis for these patients was 3.1 years (9 months-6 years). All patients received multidisciplinary care with a mean of 7.23 specialties per patient (5 to 9). A progressive skeletal dysplasia was commonly observed. On average, patients needed some type of wheelchair support by the age of 12.1 years. Surgeries were performed in order to improve posture, mobility, and quality of life. The mean number of surgeries per patient was 2.9 (0-9). The most common surgical sites include leg (33%), neck (22%), ear (11%), hip (11%), strabismus, and hernia repair (2% each). The GALNS activity varied from 0 to 0.15 nmol/mg prot/17 h. Molecular testing for GALNS gene was confirmatory in 10 patients, 4 patients have pending results. Length of follow-up varied from 10 to 33 years, and no deaths were observed. Conclusion: The MPS-IVA is a degenerative lysosomal disorder that requires a multidisciplinary approach. Skeletal abnormalities are the main complications, which are mostly treated with surgery. A thorough understanding of natural course of MPS-IVA is mandatory at both local and international levels, in order to assess the response to therapeutic interventions including enzyme replacement therapy.

4. Biochemical/Biomarkers/Screening

1015 - Improvement in Biomarkers After Intrathecal Iduronidase for Children With Mucopolysaccharidosis I-Hurler

Troy Lund¹, Linda Polgreen¹, Weston Miller¹, and Paul Orchard¹

¹University of Minnesota, Minneapolis, MN, USA

Introduction: Mucopolysaccharidosis type I-Hurler (MPS-IH) is caused by the deficiency of α-l-iduronidase and defective metabolism of glycosaminoglycans leading to fatal neurodegeneration corrected only by bone marrow transplant. To bypass the blood–brain barrier, we tested the hypothesis that Aldurazyme can be given directly to the central nervous system (CNS) via intrathecal (IT) administration and measured cerebral fluid biomarkers to assess efficacy. Methods: Eighteen patients with MPS-1H received IT enzyme replacement therapy (ERT) at 4 time points: 8 to 12 weeks prior to bone marrow transplant (BMT), 14 days prior to BMT, 100 days after BMT, and 180 days after BMT. We measured cerebrospinal fluid (CSF) white cells, protein, opening pressure (OP), heparin II cofactor–thrombin complex (HCIIT), and biomarkers of inflammation. Results: We found a significant reduction in the OP between the first and second doses of IT ERT (22.5 mm H₂O vs 18 mm H₂O; P = .03). We found significantly higher levels of CSF monocyte chemoattractant protein-1 (MCP-1), stromal cell-derived factor 1 (SDF-1), interleukin (IL) 1 receptor antagonist, IL-8, macrophage inflammatory protein 1b, and vascular endothelial growth factor in patients with MPS-IH when compared to non-MPS-IH patients, and transplant led to a decline in MCP-1 and SDF-1 levels over the 4 doses of IT ERT (976 ± 126 to 169 ± 53pg/mL for MCP-1, 396 ± 31 to 302 ± 48 pg/mL for SDF-1). Our analysis of CSF HCIIT levels showed a marked reduction in the amount of HCIIT between the first and second IT ERT doses. Conclusion: This is the first in-human experience with IT ERT in patients with MPS-IH. Patients with MPS-IH tolerated IT ERT well; there were no adverse events observed, and the delivery was safe without increased morbidity or mortality. We show significant declines in several biomarkers of MPS-IH including CSF OP, HCIIT, and several CSF cytokines. The most significant results were found after the first dose of IT ERT prior to BMT. The IT ERT may provide patients with MPS-1H a “bridge” of CNS protection against the inflammatory component of MPS-1H, prior to undergoing BMT. Conflicts: This trial had support from Genzyme.

1020 - Quantitative Ultra-Performance Liquid Chromatography Tandem Mass-Spectrometry Multiplex Urinary Analysis of Glycosaminoglycans for Patients With Mucopolysaccharidoses

Christiane Auray-Blais¹, and Pamela Lavoie¹

¹Université de Sherbrooke, Quebec, Canadá

Introduction: Mucopolysaccharidosis (MPS) disorders are a result of primary defects in lysosomal enzymes. Depending on the specific gene defect, the catabolism of one or more of the MPS is blocked leading to the accumulation of the corresponding glycosaminoglycan (GAG) substrates. Objectives: To improve the diagnosis and monitoring of patients affected with different types of MPSs, such as Hurler/Scheie (MPS-IH, -IS, -IHS), Hunter (MPS-II), Sanfilippo (MPS-III), Morquio (MPS-IV), and Maroteaux-Lamy (MPS-VI) syndromes. In order to do so, we developed a urinary analysis quantitative methodology using a tandem mass spectrometry (MS/MS) multiplex approach. Dermatan sulfate (DS), heparan sulfate (HS), keratan sulfate (KS), and chondroitin sulfate (CS) were specifically targeted. Method: A methanolysis was performed by adding methanol-HCl•3 N to a previously nitrogen-evaporated urine sample and heating at 65°C for 75 minutes. After evaporation under nitrogen, the residue was redissolved in 200 µL of a solution containing the deuterated internal standards synthesized in house. Sample of 5 µL was injected onto an Acquity-I-Class ultra-performance liquid chromatography (UPLC) coupled to a Xevo TQ-S MS/MS (Waters Corp, Milford, Massachusetts). Results: Our results show an efficient differentiation between patients with MPS and controls. This 6.5-minute multiplex method allows high sensitivity and good resolution for the detection of small quantities of urinary GAGs. Linearity was good from 0 to 400 µg/mL for KS, DS, HS, and CS. Each MPS type can be distinguished from one another due to the specific GAG profile, except MPS-I and -II, which present a similar elevation in DS and HS. Conclusion: This UPLC-MS/MS method aiming at quantifying urinary GAGs for MPS disorders is simple, efficient, and rapid. Keratan sulfate analysis might be applicable to patients with Morquio syndrome for detection, diagnosis, and monitoring. This multiplex method is applicable for high-risk screening of patients with MPS in a single urine analysis. Conflicts: We have received an Investigator-Initiated Research grant from Shire. Nevertheless, Shire had no involvement whatsoever in the protocol, design, analysis, and interpretation of the results.

1024 - The Role of Biomarkers in Treatment Outcomes

Simon Heales¹

¹Great Ormond Street Hospital & UCL Institute of Child Health, London, United Kingdom

Biomarkers, from a laboratory point of view, are chemicals that can be measured and quantified in patient samples. The ultimate objective is to offer clinicians and patients meaningful results that can support a diagnosis and reflect the efficacy of treatment strategies. Concerning lysosomal storage disorders, there are a number of biomarkers available to laboratories, many of which reflect the nature of the stored material that accumulates as a result of the enzyme deficiency, for example, glycosaminoglycans for mucopolysaccharide disorders, glucose tetrasaccharide for Pompe disease, and globotriaosylceramide for Fabry disease. The above-mentioned biomarkers are useful with regard to monitoring treatment compliance and can, but not always, correlate with clinical outcome. Research is now in progress to identify new biomarkers that will support the existing laboratory repertoire and provide better information with regard to clinical outcome.

1047 - Biochemical Diagnosis of Mucopolysaccharidosis IVA (Galactosamine-6-Sulfate Sulfatase) in Mexican Patients

Jose E. Garcia-Ortiz¹, Thiago D. da Silva-Jose¹, Jesus A. Juarez-Osuna¹, and Sandra C. Mendoza-Ruavalcaba¹

¹Division Of Genetics, Cibo-Imss, Guadalajara, Mexico

Introduction: Mucopolysaccharidosis IVA can be diagnosed based on clinical grounds and, as other lysosomal diseases, can also be confirmed by biochemical analyses (dried blood spots [DBSs] or leukocytes) and/or molecular analysis on N-acetylgalatosamine-6-sulfate-sulfatase (GALNS). Objective: To determine leukocyte residual activity of galactosamine-6-sulfato sulfatase in 65 suspected Mexican patients with Morquio syndrome by clinical features and/or DBS positivity. Methods: Leukocytes were extracted using standard method with 0.25 mol/L saccharose and triton X-100 and homogenized by sonication. Proteins were measured by Lowry method in a Beckman Coulter DU 730 spectrophotometer (Beckman Coulter, Pasadena, California). Residual activity of galactosamine-6-sulfate sulfatase was measured using a modification of the method published by van Diggelen et al (1990): the reaction was performed with 10 µg of diluted proteins with 0.2% bovine serum albumin and 1 mmol/L MU-BGAL-6S.NH4 and incubated at 37°C for 18 hours. Later addition of phosphate buffer was realized and a final incubation with β-galactoside galactohydrolase was performed at 37°C for 2 hours. Enzymatic activity was measured with a Turner 450 fluorometer at 360 nm filter and 450 nm emission. A 4-µm curve was performed as quality control in each medication. Results: A total of 65 patients (44 females/21 males) were included. The distribution by geographic zones clustered in the central (26), western (19 patient), southern (15), and northern (5) regions. Based on our reference values on Mexican population of 44.4900 to 231.7533 nmol/mg prot/18 h, average 138.1257 nmol/mg prot/18 h, 43 patients (66% of the sample) were confirmed due to absent or minimal residual enzymatic activity (0.00%-3.5%) and 21 were regarded as MPS-IVA (and also as MPS-IVB by β-galactosidase enzymatic activity). Molecular analysis on GALNS will be performed in the near future on these positive patients. Conclusion: In this sample of Mexican patients with suspected diagnosis of MPS-IV, the confirmation of diagnosis by leukocyte residual activity of galactosamine-6-sulfato sulfatase was positive in 66%.

1060 - Optimization of Keratan Sulfate Separation by Using Peltier System Following an Improved Rapid Isolation of Urinary Glycosaminoglycans in Small Volume of Urine Samples

Mihriban Tijien Tanyalcin¹

¹Izmir, Turkey

Introduction: Measurement of urine glycosaminoglycans (GAGs) in patients with mucopolysaccharidosis (MPS) is considered to be the first step in the diagnosis of this heterogenous group of lysosomal storage disorder presenting clinical phenotype. Method and Results: Urine sample containing 300 µg of GAGs is the most appropriate concentration that gives best precipitation with 1000 µL cetylpyridinium (CPC)/citrate buffer. Instead of considering the creatinine concentration in urine, we suggest the use of urine GAG concentration because it presents better precipitation with CPC; therefore, we should target GAGs instead of urine creatinine for optimized precipitation of GAGs since it gives a clear pattern of high-resolution GAG electrophoresis (GAGE) following high-speed centrifugation at 12 200 rpm. The high-resolution electrophoresis (HRE) micromethod described here enables a clear separation of keratan sulfate from chondroitin sulfate based on the effect of cold buffer using low voltage. The GAGs HRE banding patterns are more clear, easily identified, and provide a guide for the enzyme analysis deficient in the MPS disorders. In order to maintain a cool medium, Peltier is used. Peltier according to its structure is a kind of a substance that, when the voltage is applied, gets cooler on one side while the other side gets warmer. Cooling sides of the Peltiers are in contact with aluminum plate 20 × 30 cm where the electrophoresis tank is placed. The system is installed with 6 Peltiers/30 watt supported by the 380-watt power supply. The temperature of buffer in the electrophoresis tank can be cooled down to 8°C to 10°C with this Peltier system. Conclusion: This procedure allows GAG isolation and high-resolution GAGE to be easily performed in routine clinical diagnostic laboratories by giving us a distinct pattern of GAGs in patients with MPS-I, MPS-II, MPS-III, MPS-IV, and MPS-VI .

1069 - Levels of Glycosaminoglycans in the Cerebrospinal Fluid of Healthy Young Adults, Surrogate-Normal Children, and Patients Having Hunter Syndrome With and Without Cognitive Impairment

Christian J. Hendriksz¹, Joseph Muenzer², Adeline Vanderver³, Jonathan M. Davis⁴, Barbara K. Burton⁵, Nancy J. Mendelsohn⁶, Nan Wang⁷, Luying Pan⁷, Arian Pano⁷, and Ann J. Barbier⁷

¹Salford Royal NHS Foundation Trust, Salford, United Kingdom

²University of North Carolina, Chapel Hill, NC, USA

³Children’s National Medical Center, Washington, DC, USA

⁴Floating Hospital for Children at Tufts Medical Center, Boston, MA, USA

⁵Northwestern University Feinberg School of Medicine/Children’s Hospital, Chicago, IL, USA

⁶Children’s Hospitals and Clinics of Minnesota, MN, USA

⁷Shire, Lexington, MA, USA

Introduction: Accumulation of glycosaminoglycans (GAGs) in urine and tissues is the hallmark of the mucopolysaccharidoses (MPSs). In Hunter syndrome (MPS-II), approximately two-thirds of patients are affected by cognitive impairment. We investigated the levels of GAGs in cerebrospinal fluid (CSF) in different populations. Methods: We established normal ranges in a population of 31 healthy adults as well as in 202 surrogate-normal children, defined as children who underwent a lumbar puncture for a clinical indication other than suspicion of a lysosomal storage disease and compared these with patients having MPS-II with and without cognitive impairment. Results: The average GAG level in healthy adults (n = 31) was 46.4 ±19.1 ng/mL (mean ± standard deviation). In surrogate-normal children, the mean GAG levels for neonates were 68.4 ± 22.8 ng/mL (n = 24), for 1- to 23-month-olds, they were 61.8 ± 27.8 ng/mL (n = 58), for 2- to 11-year-olds 54.7 ±27.2 ng/mL (n = 77), and for 12- to 18-year-olds 51.4 ±25.6 ng/mL (n = 43). Glycosaminoglycan levels in non-MPS-II patients were all less than approximately 200 ng/mL. In contrast, 16 patients with MPS-II having cognitive impairment, who enrolled in a phase I-II study of intrathecal idursulfase-IT (HGT-HIT-045/NCT00920647), had GAG levels between 423.7 and 3426.6 ng/mL at baseline, with a mean of 1570.4 ± 885.7 ng/mL. Data from 3 additional pediatric patients with cognitive impairment showed levels between 842.9 and 2360.9 ng/mL. We also obtained samples from 2 pediatric and 4 adult patients with MPS-II without cognitive impairment and found that 5 of 6 had cerebrospinal fluid (CSF) GAG levels between 356.8 and 459.3 ng/mL and 1 had a CSF level of 1181 ng/mL. Conclusion: These data indicate that patients with MPS-II and cognitive impairment have markedly elevated levels of CSF GAG, whereas attenuated patients with MPS-II typically have levels that fall between those of the cognitively affected patients and healthy controls. Conflicts of interest: These studies were funded by Shire (NCT00920647 [HGT-HIT-045], NCT01449240 [HGT-HIT-072]). Dr Hendriksz has received consulting fees from Actelion, BioMarin, Glaxo-SmithKline, and Sanofi-Genzyme and has undertaken contracted research for Actelion, Amicus, BioMarin, GlaxoSmithKline, Sanofi-Genzyme, Shire, and Synageva. Dr Muenzer has been a consultant to BioMarin Pharmaceutical, Shire HGT, Green Cross, and PTC Therapeutics and serves on advisory boards and speaker’s bureaus for Genzyme, BioMarin, and Shire. He is currently the principal investigator for phase I/II IT enzyme replacement clinical trials for MPS-II sponsored by Shire. Dr Vanderver has received consulting fees from Shire and has performed (unpaid) consulting for Stemcells, Inc. Dr Davis has no conflicts to declare. Dr Burton has received consulting fees from, and serves on advisory boards for, BioMarin and Shire and has undertaken contracted research for BioMarin, Cytonet, Genzyme, Shire, Synageva, and Ultragenyx. Dr Mendelsohn has received travel funding from Genzyme, BioMarin, and Shire and has received grant funding from Genzyme, BioMarin, and Shire. She sits on the North American advisory and the publications committee boards for Shire. Ms Wang and Drs Pan, Pano, and Barbier are all employees of Shire.

1083 - Biochemical Diagnosis of Egyptian Children With Oligosaccharidoses

Ekram Maher Fateen¹, Manal Fouad², Mona Sabry Aglan¹, Mona Mahmoud Ibrahim¹, Noha El Bougdady², and Amira Radwan¹

¹National Research Centre, Giza, Egypt

²Cairo University, Giza, Egypt

Introduction: Oligosaccharidoses are disorders caused by a defect in the breakdown of complex carbohydrate side chains of glycosylated proteins. They resemble mucopolysaccharidosis (MPS) but are less common. Skeletal deformities and coarse facies may range from mild to severe. There is usually intellectual disability, often with behavioral difficulties, progressive neurological symptoms, and seizures. Early onset is more frequent than in MPS and are often fatal within few years. Diagnosis is based primarily on detection of increased urinary excretion of abnormal oligosaccharides and glycosaminoglycans (GAGs) in urine are normal; confirmation is made by enzyme analysis and molecular studies. Our goal is to establish a protocol for the diagnosis of Egyptian patients with oligosaccharidosis in order to provide proper genetic counseling for families of affected patients. Methods: The study included 46 patients and 50 normal controls. Patients were subjected to history taking, pedigree analysis, clinical examination, measuring the level of total GAGs, and 2-dimensional electrophoresis of total GAGs in urine to exclude MPS, thin layer chromatographic (TLC) separation of oligosaccharides, and assessment of enzyme activity according to the pattern of the TLC to confirm the diagnosis of oligosaccharidoses type. Results: In all, 16 (34.8%) patients had abnormal pattern of TLC but only 4 (8.7%) of them were diagnosed by deficient enzyme activity. Conclusion: Mucopolysaccharidoses and oligosaccharidoses share many clinical features, but they are less common. The biochemical diagnosis of both disorders is important for counseling of the affected families to avoid more affected siblings.

1084 - Analysis of α-l-Iduronidase, Iduronate Sulfatase, and Arylsulfatase B in Dried Blood Spots: Experience From 9 Years of Selective Screening in Colombian Patients With Hurler-Like Features

Alfredo Uribe¹, Adis Ayala², Monica España¹, and Natalia Pacheco¹

¹Universidad de los Andes, Centro de Investigaciones en Bioquimica, Bogotá, Colombia

²Universidad Distrital Francisco Jose de Caldas, Cundinamarca, Colombia

Introduction: The glycosaminoglycan metabolic disorders or mucopolysaccharidoses (MPSs) are deficiencies of a specific lysosomal enzyme that sequentially degrades these compounds. This causes a progressive accumulation of macromolecules at the cellular level generating a multisystemic commitment. This is reflected in the clinical symptomatology that includes, among others, coarse facial features, short stature, multiple skeletal dysplasias, corneal opacity, and visceromegalies. The diagnostic approach is challenging because it requires specialized biochemical analyses that are not easily available to patients living in areas geographically distant from the principal cities, where the studies are done. This is why the use of samples collected in solid phase is an advantage when the purpose is the study of high-risk populations, where it is necessary to avoid cooling processes associated with liquid samples. The present work aims to present the experience of 9 years (2005-2014) of selective screening in Colombia through the enzymatic evaluation of α-l-iduronidase (IDUA), iduronate sulfatase, and arylsulfatase B in dried blood spots of possible patients with MPS-I, -II, and -VI, respectively. Methodology: A group of 1962 patients was evaluated (age: 1 month-35 years) with end point enzymatic fluorometric quantifications using 4-methylumbelliferyl as a marker and 1.2 mm punches. The β-galactosidase activity was estimated as a control enzyme. Results: The presented analyses enabled us to establish reference values for Colombian population and facilitated the diagnostic definition of 21 patients with MPS-I (enzymatic activity range for IDUA: 0.0-0.65, reference value [RV]: 1.5-20.1), 20 with MPS-II (activity range for IDS: 0.0-1.86, RV: 10.7-45.2) and 34 with MPS-VI (activity range for ASB: 0.0-2.0, RV: 2.9-43.3; activity range in nmol/h/mL). Conclusion: These results allowed an early incorporation of patients in the available enzymatic replacement therapies and to offer a preliminary perspective of the incidences of these diseases in our country.

1090 - Development of a Novel Biomarker for Mucopolysaccharidoses: Level of Disulfated Keratan Sulfate

Shunji Tomatsu¹, Tsutomu Shimada¹, Robert W. Mason¹, Eriko Yasuda¹, William G. Mackenzie¹, Adriana M. Montaño², Francyne Kubaski¹, Roberto Giugliani^{3 ,4}, Seiji Yamaguchi⁵, Yasuyuki Suzuki⁶, and Kenji E Orii⁶

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Saint Louis University, St Louis, MO, USA

³Medical Genetics Service, Hospital de Clınicas de Porto Alegre, Porto Alegre, Brazil

⁴Department of Genetics, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

⁵Shimane University, Matsue, Japan

⁶Gifu University, Gifu, Japan

Introduction: Keratan sulfate (KS) is known as a storage material in mucopolysaccharidosis IV (MPS-IV). However, no detailed analysis has been reported on subclasses of KS: monosulfated KS and disulfated KS. Methods: We have established a novel assay method for mono- and disulfated KS using liquid chromatography tandem mass spectrometry and have measured both KS levels in various specimens. Results: Disulfated KS is dominant in shark cartilage and rat serum, while monosulfated KS is dominant in bovine cornea and human blood. Levels of both mono- and disulfated KS vary with age in blood and urine of control participants and patients with MPS-II, -IVA, and -IVB. The mean levels of both forms of KS in blood from patients with MPS-II, -VA, and -IVB were elevated compared with that in age-matched controls. The fraction of disulfated KS in total KS in control participants increased with age, reaching 40%. The fraction of disulfated KS in patients with MPS-IVA was around 40% for all ages. The proportion of disulfated KS of total KS in patients with MPS-II was similar to control participants except between 5 and 10 years of age. Levels of mono- and disulfated KS in urine of all patients with MPS-IVA and -IVB were more than 3 standard deviations above the mean of the age-matched controls. Conclusion: The level of disulfated KS and its proportion of total KS distinguish control participants from patients with MPS-II, -IVA, and -IVB, indicating that disulfated KS is a novel biomarker for these disorders.

1091 - Chondroitin 6-Sulfate as a Novel Biomarker for Mucopolysaccharidoses IVA and VII

Shunji Tomatsu¹, Tsutomu Shimada¹, Eriko Yasuda¹, Robert W Mason¹, William G. Mackenzie¹, Francyne Kubaski¹, Roberto Giugliani^2,3, Seiji Yamaguchi⁴, Yasuyuki Suzuki⁵, Kenji E Orii⁵, and Tadao Orii⁵

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Medical Genetics Service, Hospital de Clınicas de Porto Alegre, Porto Alegre, Brazil

³Department of Genetics, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

⁴Shimane University, Matsue, Japan

⁵Gifu University, Gifu, Japan

Introduction: Chondroitin 6-sulfate (C6S), a glycosaminoglycan (GAG), is distributed mainly in the growth plates, aorta, and cornea; however, the physiological function of C6S is not fully understood. One of the limitations is that no rapid, accurate quantitative method to measure C6S has been established. Mucopolysaccharidoses (MPS) IVA and VII are caused by the deficiency of N-acetylgalactosamine-6-sulfate sulfatase and β-d-glucuronidase, respectively, resulting in accumulation of C6S and other GAGs. Although levels of keratan sulfate (KS), heparan sulfate, and dermatan sulfate in samples from patients with MPS are well described, this is the first report of quantitative analysis of C6S levels in samples from patients with MPS-IVA and -VII. Methods: We developed a method to digest polymeric C6S and measure resultant disaccharides using liquid chromatography tandem mass spectrometry (LC/MS/MS). The C6S levels were measured in blood from control participants and patients with MPS-IVA and -VII aged from 0 to 58 years. We also assayed KS levels in the same samples for comparison with C6S. Results: Levels of C6S in blood decreased with age and were significantly elevated in patients with MPS-IVA and -VII, compared with age-matched controls. Levels of KS in patients with MPS-IVA were also higher than those in age-matched controls, although differences were less pronounced than that with C6S. Combining KS and C6S data discriminated patients with MPS-IVA from age-matched controls better than either C6S or KS levels alone. Conclusion: This is the first report showing that blood levels of C6S are quantitatively evaluated in patients with MPS-IVA and -VII and indicate that C6S could be a useful biomarker for these metabolic disorders.

1092 - RapidFire Tandem Mass Spectrometry: Application to Diagnosis and Monitoring of Mucopolysaccharidoses

Shunji Tomatsu¹, Tsutomu Shimada¹, Eriko Yasuda¹, Pravin Patel¹, Robert W. Mason¹, William G. Mackenzie¹, Francyne Kubaski¹, Joan Kelly², William A. LaMarr², Seiji Yamaguchi³, Yasuyuki Suzuki⁴, and Tadao Orii⁴

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Agilent Technologies, Inc, Santa Clara, CA, USA

³Shimane University, Matsue, Japan

⁴Gifu University, Gifu, Japan

Introduction: Mucopolysaccharidoses (MPSs) are caused by the deficiency of the lysosomal enzyme, resulting in excessive accumulation of glycosaminoglycans (GAGs). We developed GAG assay method by liquid chromatography tandem mass spectrometry (LC-MS/MS; Oguma et al 2007a); however, it takes 4 to 5 minutes per sample to be analyzed. Therefore, we need to have another rapid analytical method for a large number of samples. Methods: RapidFire with tandem mass spectrometry (RF-MS/MS) system, an integrated solid-phase extraction robot, allows the analytical measurement of samples derived directly from quenched assay plates without additional need of sample desalting/preprocessing, and therefore, each sample is processed within 10 seconds (1 million samples per year). We aimed to develop a higher throughput system of heparan sulfate (HS) assay by using RF-MS/MS. The HS levels were measured in blood from controls and patients with MPS-II, -III, and -IV. Results: Results obtained from RF-MS/MS showed (1) that there were strong correlations in δDiHS-0 S and δDiHS-NS between conventional LC-MS/MS and RF-MS/MS, (2) that levels of HS in blood were significantly elevated in patients with MPS-II and -III, (3) that the level of HS in a patients with severe type of MPS-II was higher than that in an attenuated type, and (4) that reduction in blood HS level was observed in patients with MPS-II treated with enzyme replacement therapy or hematopoietic stem cell transplantation. Conclusion: The RF-MS/MS provides much higher throughput than LC-MS/MS-based methods with similar sensitivity and specificity in HS assay, indicating that it is feasible for diagnosis, monitoring, and screening of MPS.

1096 - Assay for Glycosaminoglycans by Tandem Mass Spectrometry and its Applications

Shunji Tomatsu¹, Tsutomu Shimada¹, Robert W. Mason¹, Eriko Yasuda¹, Joan Kelly², William a LaMarr², Adriana M. Montaño³, Seiji Yamaguchi⁴, Yasuyuki Suzuki⁵, and Tadao Orii⁵

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Agilent Technologies, Santa Clara, CA, USA

³Saint Louis University, St Louis, MO, USA

⁴Shimane University, Matsue, Japan

⁵Gifu University, Gifu, Japan

Introduction: Glycosaminoglycans (GAGs) are distributed in the whole body and play a variety of important physiological roles associated with inflammation, growth, coagulation, fibrinolysis, lipolysis, and cell-matrix biology. Accumulation of undegraded GAGs in lysosomes gives rise to a distinct clinical syndrome, mucopolysaccharidoses. Measurement of each specific GAG in a variety of specimens is urgently required to understand GAG interaction with other molecules, physiological status of patients, and prognosis and pathogenesis of the disease. Method and Results: We established a highly sensitive and accurate tandem mass spectrometry (liquid chromatography tandem mass spectrometry [LC-MS/MS]) method for measurements of disaccharides derived from 4 specific GAGs (dermatan sulfate, heparan sulfate [HS], keratan sulfate, and chondroitin sulfate). Disaccharides were produced by specific enzyme digestion of each GAG and quantified by negative ion mode of multiple reaction monitoring. Subclasses of HS and GAGs with identical molecular weights can be separated using a Hypercarb column (2.0 × 50 mm, 500 mm) with an acetonitrile gradient in ammonium acetate (pH 11.0). We also developed a GAG assay by RapidFire with tandem mass spectrometry (RF-MS/MS). The RF system consists of an integrated solid-phase extraction robot that binds and desalts samples from assay plates and directly injects them into a MS/MS detector, reducing sample processing time to 10 seconds. The RF-MS/MS consequently yields much faster throughput than conventional LC-MS/MS-based methods. However, the RF system does not have a chromatographic step, and, therefore, cannot distinguish GAGs that have identical molecular weights. Both methods can be applied to analysis of dried blood spots, blood, and urine specimens. Conclusion: We compare the assay methods for GAGs and describe their potential applications.

1098 - Newborn Screening and Diagnosis of Mucopolysaccharidoses

Shunji Tomatsu¹, Tsutomu Shimada¹, Robert W. Mason¹, Tadashi Fuji², Masaru Fukushi², Toshihiro Oguma³, Yuniko Shibata⁴, Hideyuki Futatsumori⁴, Seiji Yamaguchi⁵, Yasuyuki Suzuki⁶, and Tadao Orii⁶

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Sapporo IDL

³Daiichi Sankyo, Chūō, Japan

⁴Seikagaku Co, Tokyo, Japan

⁵Shimane University, Matsue, Japan

⁶Gifu University, Gifu, Japan

Introduction: Mucopolysaccharidoses (MPSs) are caused by the deficiency of lysosomal enzyme activities needed to degrade glycosaminoglycans (GAGs), which are long unbranched polysaccharides consisting of repeating disaccharides. Glycosaminoglycans include chondroitin sulfate (CS), dermatan sulfate (DS), heparan sulfate (HS), keratan sulfate (KS), and hyaluronan. Their catabolism may be blocked singly or in combination depending on the specific enzyme deficiency. There are 11 known enzyme deficiencies, resulting in 7 distinct forms of MPSs with a collective incidence of higher than 1 in 25 000 live births. Accumulation of undegraded metabolites in lysosomes gives rise to distinct clinical syndromes. Generally, the clinical conditions progress if untreated, leading to developmental delay, systemic skeletal deformities, and early death. The MPS disorders are potentially treatable with enzyme replacement therapy or hematopoietic stem cell transplantation. For maximum benefit of available therapies, early detection and intervention are critical. Method: We recently developed a novel high-throughput multiplex method to assay DS, HS, and KS simultaneously in blood samples using high-performance liquid chromatography/tandem mass spectrometry for MPS. Results: The overall performance metrics of HS and DS values in patients with MPS-I, -II, and -VII versus healthy controls at newborns were as follows using a given set of cutoff values: sensitivity, 100%; specificity, 98.5%-99.4%; positive predictive value, 54.5% to 75%; false positive rate, 0.62% to 1.54%, and false negative rate, 0%. Conclusion: These findings show that the combined measurements of these 3 GAGs are sensitive and specific for detecting all types of MPSs with acceptable false-negative/-positive rates. In addition, this method will also be used for monitoring therapeutic efficacy. We review the history of GAG assay and application to diagnosis for MPS.

1105 - A New Approach in the Diagnosis of Mucopolysaccharidoses

Kimiyo M. Raymond¹, Jean M. Lacey¹, Roberto Giugliani², Charles Marques Lourenço³, Mark J. Magera¹, Dimitar K. Gavrilov¹, Silvia Tortorelli¹, Devin Oglesbee¹, Piero Rinaldo¹, and Dietrich Matern¹

¹Mayo Clinic, Rochester, MN, USA

²Federal University of Rio Grande do Sul, Porto Alegre, Brazil

³University of São Paulo, São Paulo, Brazil

Introduction: We developed 3 highly sensitive and specific methods and a simple postanalytical algorithm for use in the biochemical screening for Fabry disease, metachromatic leukodystrophy (MLD), saposin B deficiency, multiple sulfatase deficiency, mucolipidosis II, and mucopolysaccharidoses (MPSs). Methods: Glycosaminoglycans (GAGs): urine specimens are evaporated and the dry residue is subjected to methanolysis yielding the mucopolysaccharides for analysis as their unique repeating disaccharide units. Liquid chromatography tandem mass spectrometry (LC-MS/MS) is performed using a short LC column to separate the mucopolysaccharides from the bulk of the specimen matrix. Keratan sulfate (KS): urine specimens, after digestion with keratanase II, are centrifuged through a 10 000-molecular weight cutoff filter to remove large molecules (such as proteins). The prepared extract is then analyzed by LC-MS/MS. Ceramide trihexosides (CT) and sulfatides (S): urine specimens are extracted with 2:1 chloroform–MeOH for determination of CT and S. The dry residue is reconstituted and analyzed by LC-MS/MS. Results: Method verification demonstrates acceptable accuracy and precision. Analysis of the results (GAGs, KS, CT, and S) using an in-house developed algorithm enables correct differential diagnosis of the listed disorders. Clinical sensitivity and specificity are as follows: GAGS: sensitivity 100% for MPS disorders (N = 31), specificity 98% to 100% (N = 308 normals); KS: sensitivity 100% (N = 18, MPS-IV or GM I gangliosidosis), specificity 99.1% (N = 224 normals); CT and S: sensitivity 100% for Fabry or MLD (N = 33 total), specificity 90% to 96% (N = 255 normals). Conclusion: We describe 3 laboratory tests and a simple algorithm for the detection of multiple disorders using <1 mL urine. This improves upon the existing methods with respect to sample volume, sample preparation, and greatly improves clinical sensitivity and specificity.

1107 - Mucopolysaccharidosis VI Diagnosis: Another Way to Look at Enzyme Activity Data

Vanessa G. Pereira¹, Matheus T. Queiroz¹, Marion C. Braga¹, Joyce U. S. Yamamoto¹, Ana M. Martins¹, and Vânia D’Almeida¹

¹Universidade Federal de São Paulo, São Paulo, Brazil

Introduction: Mucopolysaccharidosis type VI (MPS-VI) is caused by the deficiency of arylsulfatase B (ASB) due to mutations in the arylsulfatase B gene (ARSB). Laboratory diagnosis includes quantitative and/or qualitative analysis of urinary glycosaminoglycans, determination of ASB enzyme activity in different biological samples, and detection of mutations in the ARSB gene. We have been performing fluorimetric assays to determine ASB enzyme activity in leukocytes and dried blood spots for the diagnosis of MPS-VI, using Pb²⁺ and Ag⁺ ions to remove endogenous inhibitors and to inhibit arylsulfatase A (ASA), respectively. Objectives: To compare data on enzyme activity from leukocytes and dried blood spots, as well as molecular analysis (when available), to improve and facilitate the interpretation of biochemical results by physicians when diagnosing MPS-VI. Methods: The ASB activity in leukocytes and dried blood spots was compared, and data on ASA + ASB activity in leukocytes were also analyzed in samples sent to our laboratory for MPS-VI diagnosis. Results: Determination of ASB activity in leukocytes was shown to be more specific than in dried blood spots, probably due to the use of ASA inhibitor in the leukocytes assay. In addition, the calculation of a ratio between ASB and (ASA + ASB) enabled a better agreement between results from both methods and was shown to be a more reliable parameter to conclude or exclude MPS-VI diagnosis, when compared to the evaluation of ASB activity alone. Conclusion: The use of ASB–(ASA + ASB) ratio may be a useful tool to facilitate the interpretation of enzyme activity data for MPS-VI diagnosis.

1110 - Experience in the Diagnosis and Management of Patients With Mucopolysaccharidoses in Slovakia

Katarína Hlavatá¹, Ján Chandoga², Anna Hlavatá¹, Darina Behúlová², Helena Poupětová⁴, and Lenka Dvořáková⁴

¹2nd Department of Pediatrics Comenius Univ Med School and Children's Univ Hosp, Bratislava, Slovakia

²Inst of Med Bio, Genet and Clinic Genetics, Faculty of Med, Comenius Univ, Bratislava, Slovakia

³Centre of Inher Metabol Disease, Depart of Lab Medicine, Univ Children's Hosp, Bratislava, Slovakia

⁴1st Facul of Med, Charles Univ Prague, Gen Univ Hosp, Prague, Czech republic

Introduction: Mucopolysaccharidoses (MPSs) are a group of inherited lysosomal storage disorders, which were previously considered untreatable or just limited therapeutical options were available. These disorders are caused by absent or reduced activity of a specific enzyme; this leads to the accumulation of glycosaminoglycans in different tissues which results in progressive mental and physical deterioration in childhood or early adulthood. In recent decades, we have seen a significant progress in clarifying the pathogenesis as well as in diagnostics and in particular in the possibility of causal therapy. The first successful treatment of certain types of MPS was bone marrow transplantation. Over the last decade, new therapeutic approaches have become available including enzyme replacement therapy and substrate reduction therapy. Methods: In Slovakia, the patients with lysosomal storage disorders are treated in the Center of Inherited Metabolic Disorders in Faculty Hospital in Bratislava (CDMP). Laboratory diagnosis is carried out in cooperation with the domestic and foreign laboratories. For the successful treatment of MPS, early diagnosis is essential. Results: By 2001, in Slovakia 23 patients were diagnosed with MPS by syndromology and enzymology. After the introduction of screening and quantitative determination of glycosaminoglycans in urine and their identification by electrophoresis followed by a targeted enzymological examination, the number of diagnosed patients increased. Nowadays, there are 37 patients with MPS in Slovakia. Conclusion: The availability of prenatal diagnosis in treatable types (I, II, VI) enables early initiation of the therapy. We have treated 13 patients and our experience with treatment of MPS shows that all patients had some benefits from this therapy, but their quality of life strongly depends on the time of initiating the therapy. The task for the next decade is to verify the long-term therapeutic effect of treatment of patients with MPS.

1116 - Pilot Newborn Screening Program for Treatable Lysosomal Diseases in Brazil: Study Design

Fernanda Bender¹, Gabriel Civallero¹, Sandra Leistner-Segal¹, Maira Burin¹, Ana Carolina Brusius-Facchin¹, Graziela Ribas¹, Carmen Vargas¹, and Roberto Giugliani¹

¹Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

Introduction: Lysosomal storage disorders (LSDs) are inherited disorders caused by the deficiency of specific enzymes. This deficiency causes the storage of substrate, leading to a progressive and severe bone dysplasia and to problems in many organs and systems. All LSDs are inherited in an autosomal recessive manner, except Hunter syndrome (mucopolysaccharidosis [MPS] II) and Fabry disease, which are X-linked recessive disorders. Objective: At present, there are no known cures for LSDs. Today, bone marrow transplantation and enzyme replacement therapy (ERT) are available treatment options for patients with certain types of LSDs. As LSDs can be treated with ERT and as there is evidence that a better result can be expected in cases treated early, a program of neonatal screening for LSDs was created on this specific area. Methods: To the program already in place for phenylketonuria, congenital hypothyroidism, hemoglobin disorders and cystic fibrosis, now also including biotinidase deficiency and congenital adrenal hyperplasia, tests for Gaucher, Fabry, Pompe, MPS-I, MPS-II, and MPS-VI, were added to the screening panel. The project aims, in its first stage, to adapt the enzyme assays to fluorimetric micromethods, reducing the cost of reagents and mainly of the expensive substrates. Results and Conclusion: The study will evaluate the operational issues, cost, false-positive rate, and other aspects related to the inclusion of the lysosomal panel in the newborn screening program and provide valuable information to the newborn screening operators in Brazil.

1125 - Loss of Distinct Lysosomal Enzymes Limiting the Degradation of Glycosaminoglycans in Mucolipidosis II Mice

Sandra Markmann¹, Katrin Kollmann¹, Melanie Thelen², Volkmar Gieselmann², Jeffrey Esko³, and Braulke Thomas³

¹Department of Biochemistry, University Medical Center Hamburg-Eppendorf, Children’s Hospital, Hamburg, Germany

²Institute of Biochemistry and Molecular Biology, University of Bonn, Bonn, Germany

³Department of Cellular and Molecular Medicine, University of California, San Diego, CA, USA

More than 50 lysosomal enzymes and proteins require mannose 6-phosphate (M6P) residues for efficient transport to lysosomes and maintenance of lysosomal function. Mutations in the N-acetyl-d-glucosamine 1 (GlcNAc-1) phosphotransferase complex catalyzing the formation of M6P targeting signals result in missorting of lysosomal enzymes and cause the lysosomal storage disorder mucolipidosis type II (ML-II). However, the total deficiency of all lysosomal enzymes is partially compensated by enzyme- and cell-specific alternative lysosomal targeting. In this study, we examined whether the degradation of glycosaminoglycans (GAGs), impaired in mucopolysaccharidosis (MPS), is affected in a knock-in mouse model for ML-II. The ML-II mice show decreased viability, reduced mean body weight and body length, and severe skeletal abnormalities. Mass spectrometric and histochemical analyses demonstrated accumulation of high-mannose structures, fucosylated branched glycans, gangliosides, and cholesterol in ML-II mouse brain and mouse embryonic fibroblasts (MEFs). Additionally, accumulation of heparan sulfate and chondroitin sulfate was observed after 35S-sulfate labeling of GAGs in ML-II MEFs. SILAC-based comparative stable isotope labeling by/with amino acids in cell culture quantitative analysis of lysosomal fractions isolated from fibroblasts revealed loss of few lysosomal enzymes such as iduronate-2-sulfatase, required for the degradation of chondroitin and heparan sulfate, and α-fucosidase or Niemann-Pick type 2. Other lysosomal enzymes, such as cathepsin D and B, were not affected by the deficiency of the GlcNAc-1-phosphotransferase demonstrating enzyme-specific differences among lysosomal proteins in their susceptibility to the loss of M6P residues. The identification of the lysosomal enzymes limiting the degradation of GAGs in ML-II is ongoing and might allow single or combinatory replacement with recombinant lysosomal enzymes available for treatment of MPS.

1141 - Nonreducing End Glycosaminoglycan Analysis: A Powerful Tool for Drug Discovery and Development, Patient Diagnosis, and Monitoring Response to Therapy in Mucopolysaccharidoses

Shripad Bhagwat¹, Roger Lawrence¹, Evan Adintori¹, Katherine Webster¹, Rob Herman¹, Joe Darin¹, Jillian Brown¹, Mika Aoyagi-Scharber¹, Jon Vincelette¹, Sherry Bullens¹, Stuart Bunting¹, Shih-hsin Khan², Steven Le², Patricia Dickson², Elizabeth Schwarz³, Marzia Pasquali⁴, and Brett Crawford¹

¹BioMarin Pharmaceutical, Inc, Novato, CA, USA

²Department of Pediatrics, Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, Torrance, CA, USA

³ARUP Institute for Clinical and Experimental Pathology, Salt Lake City, UT, USA

⁴Departments of Pathology and Pediatrics, University of Utah Health Sciences Center, Salt Lake City, UT, USA

Introduction: The measurement of substrate storage in lysosomal storage diseases has previously been hampered by the complexity and heterogeneity of the storage material. The Sensi-Pro mucopolysaccharidoses (MPS) assay is an liquid chromatography tandem mass spectrometry-based platform tool designed to selectively measure lysosomal substrate accumulation in all MPS types using a distinct analyte for each disease class. Here, we demonstrate the utility of the Sensi-Pro assay in a number of preclinical and clinical applications. Methods: The assay is based on depolymerization of glycosaminoglycans in the sample using bacterial lyases. The lyases fragment the glycosaminoglycan polymers into disaccharides with an unsaturated bond at the nonreducing end (NRE) of each disaccharide; however, the preexisting NRE is liberated as a fully saturated disaccharide. Due to this mechanism of cleavage, the preexisting NRE can be selectively identified and quantified. Since each MPS type is caused by the deficiency of a different lysosomal enzyme that acts on the NRE, this method generates a unique NRE from each MPS class. The identity of the NRE is diagnostic for the MPS class, and the abundance is a direct measure of the molar abundance of storage material. Results: Data reveal that the Sensi-Pro assay provides a sensitive, selective, and robust means to detect disease and to measure response to therapy for several MPS disorders. The assay facilitates quantitative analysis for a number of applications including the discovery and development of novel enzyme replacement therapies and a central nervous system-penetrant small molecule therapy for MPS-III. Conclusion: The Sensi-Pro assay is a powerful tool for preclinical drug discovery, clinical drug development, patient diagnosis, and managing ongoing therapy of patients and can be applied in any therapeutic mode (enzyme replacement therapy, substrate reduction therapy, chaperone, or unknown mechanisms). Conflicts of interest: Authors Lawrence, Adintori, Webster, Herman, Darin, Brown Aoyagi-Scharber, Vincelette, Bullens, Bunting, Bhagwat, and Crawford are employees and stockholders of BioMarin Pharmaceutical Inc (BioMarin). Authors Le, Dickson, and Khan are contracted clinical researchers for BioMarin. Author Pasquali has provided consulting services and received travel support from BioMarin. Author Schwarz has no conflicts of interest.

1143 - Validation of a Tandem Mass Spectrometry Assay for Quantitation of Keratan Sulfate Disaccharides in Urine of Patients With Morquio A Syndrome

Pamela Lavoie¹, and Christiane Auray-Blais¹

¹ECRCHUS-University of Sherbrooke, Sherbrooke, Canada

Introduction: Mucopolysaccharidosis (MPS) type IVA, also known as Morquio A syndrome, is an autosomal recessive lysosomal storage disorder. This disease is caused by the deficiency of the lysosomal enzyme N-acetylgalactosamine-6-sulfatase, which is involved in the degradation of the glycosaminoglycan keratan sulfate (KS). Diagnosis can be difficult in affected patients, particularly when the disease progression is slow. Objectives: To implement and validate an existing liquid chromatography tandem mass spectrometry methodology to quantify KS disaccharides in urine of patients with Morquio A syndrome. Normal reference values were also established following the analysis of urine from healthy controls. Methods: Keratanase II (KII) solution of 10µL was transferred to a polypropylene tube containing 100 µL of urine sample. Ammonium acetate buffer of 100 µL was also added with the same amount of the internal standard solution. Digestion of the KS macromolecule was performed at 40°C ± 2°C for 2 to 4 hours to obtain related disaccharides. After centrifugation, 20 µL of the digested sample was injected onto an Alliance 2795XE HPLC coupled to a Quattro Micro MS/MS (Waters, Milford, Massachusetts) system. Results: Disaccharide responses were linear from 0.313 to 20 µg/mL. Intraday and interday accuracy and precision assays were good with relative standard deviation and BIAS percentages at ≤20%. No carryover was observed, and the heavy-labeled internal standards were corrected for matrix effects. Our results show an efficient differentiation between patients with MPS-IVA and age-matched controls. Conclusion: The implementation of a tandem mass spectrometry assay for quantitation of KS disaccharides in urine of patients with Morquio A syndrome might be a useful tool for high-risk screening studies and for the diagnosis and monitoring of patients with MPS-IVA under enzyme replacement therapy. Conflicts of Interest: I receive honoraria from BioMarin Pharmaceutical Inc.

1150 - Prenatal Diagnosis of Mucopolysaccharidoses in Egypt: Counseling Aspects and Diagnostic Tools

Ahmed A. L. Aboulnasr¹, and Ekram M. Fateen²

¹Gynecology & Obstetric department faculty of medicine, Cairo university, Giza, Egypt

²Biochemical Genetics department, National Research Centre, Giza, Egypt

Objective: Prenatal counseling for mucopolysaccharidoses (MPSs) diagnosis. Methods: A total of 106 pregnant women were counseled in the last 14 years. All have one or more affected sibling with MPS except 2 cases with MPS-IVA having positive family history in a close relative. The MPS types were 39 (36.8%) type I, 15 (14.15%) type II, 14 (13.2%) type III, 17 (16%) type IVA, and 21 (19.8%) type VI. In all, 63 couples counseled in 1 pregnancy and 20 couples counseled 43 times in successive pregnancies, 18 couples in 2, 1 couple in 3, and 1 couple in 4 pregnancies. Consanguineous marriage was present in 91 (85.8%) pregnancies. In 39 (36.8%) pregnancies, couples have no normal children. However, in 73 (68.9%), couples have no normal boys. Prenatal diagnosis (PD) was performed in 83 (78.3%) pregnancies. Amniocentesis was done at 14 to 15 weeks gestational age in 39 (47%) to withdraw 10 mL for analysis of glycosaminoglycans (GAGs) by 2-dimensional electrophoresis (2-DEP). Chronic villus sampling (CVS) was done at 11 to 12 weeks gestational age in 44 (53%) pregnancies to measure specific enzyme activity fluorometrically. In 7 cases of them, amniocentesis was needed to verify diagnosis of borderline enzyme result (5 cases) or because CVS did not yield enough villi (2 cases). Of the 106 counseled, 23 (21.7%) pregnant women were not subjected to PD. In all, 14 (60.9%) did not show up at scheduled time for PD, 4 (17,4%) had spontaneous abortion before PD, 3 (13%) came late for PD, 1 (4.3%) had vesicular mole, and 1 refused. Results: Of those subjected to PD, 59 (71.1%) have normal fetus and 24 (28.9%) have affected fetus. Conclusion: All types of MPSs could be diagnosed prenatally. Analysis of GAGs by 2-DEP of amniotic fluid is sensitive and accurate method for PD of MPS. Prenatal diagnosis by measuring enzyme activity in chorionic villi is recommended as CVS is done 3 to 4 weeks earlier than amniocentesis which is more favorable medically, ethically, and psychologically. High consanguinity rate in Egypt leads to more genetic diseases. To have a normal boy is a motive for repeated pregnancies.

1166 - Preliminary Analyses of Biomarkers of Oxidative Stress in Mucopolysaccharidoses I and VI

Alexandre Silva de Mello¹, Ana Carolina Breier², Marina Frusciante¹, Carolina Antunes¹, Gabrielli Borbolato¹, Jéssica Marinho¹, Mariane Wohlenberg¹, Fernanda S. Machado¹, Niara S. Medeiros¹, Claúdia da Silva Funchal¹, Caroline Dani¹, and Janice Carneiro Coelho²

¹Centro Universitário Metodista IPA, Porto Alegre, Brazil

²Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

Introduction: High levels of reactive oxygen species have been associated with oxidative stress and inflammation being related to cellular changes characteristic, caused by changes in metabolic pathways of individuals with inborn errors of metabolism. Patients with mucopolysaccharidoses (MPSs) characterized by biomolecular and tissue damage that results in the accumulation of glycosaminoglycans not degraded in the cells of various organs and systems. Methods: Three biomarkers of oxidative stress were evaluated in patients having MPS-I (n = 7) and MPS-VI (n = 7), deficiency in α-l-iduronidase and arylsulfatase B enzymes, respectively, apart from healthy controls (HC; n = 14). The antioxidant capacity of blood plasma was measured by the enzyme superoxide dismutase (SOD) and catalase (CAT) since the damage to lipids (lipid peroxidation) was measured by the presence of thiobarbituric acid reactive substances (TBARS). Analysis of variance followed by the Tukey post hoc, with Pearson correlation was used to compare results of analysis of plasma with those of both HC and patients with MPS. Analysis was performed using statistical software package SPSS 17 (SPSS Inc., Chicago, Illinois), and level of significance was set at P < .05. Results: We found a significant increase (P = .02) in lipid peroxidation (TBARS) in MPS-I, but in MPS-VI, no change in any of the parameters studied in the plasma of groups was observed. Analyzing SOD and CAT, there were no significant differences (P > .05) among the groups. Conclusion: As the MPS-I and MPS-VI diseases are characterized as rare diseases, the sample size of this study was low. However, with the analysis of the results, there was an increase in damage to lipids in MPS-I, suggesting that this disease is more vulnerable to oxidative damage than MPS-VI.

1199 - Insights into the Interplay Between α-l-Iduronidase and Cholesterol by a Protein–Protein Interaction Network Analysis

Ursula Matte¹, Barbara Z. Matinelli², Joice F. Poloni², and Diego Bonatto²

¹Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

²Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

Objectives: To design and analyze protein–protein interaction (PPI) networks by applying system biology tools in order to elucidate the interplay between proteins involved in α-l-iduronidase (IDUA) activity and cholesterol metabolism. Methods: We used STRING data set to design a PPI network with IDUA interactions and a PPI network with proteins involved in cholesterol metabolism. The results were analyzed using Cytoscape software. The Advanced Network Merge tool performed the union of these networks, and the union PPI network obtained was clustered by Molecular Complex Detection (MCODE) tool. The most relevant proteins were identified by centrality analysis using CentiScaPe plugin for the nodes and WERW-kpath for the edges. The gene ontology analysis was applied in each cluster to obtain information about the major biological processes associated. Results: The analyses of interactome network showed 1975 proteins clustered in 22 modules and involved in a variety of biological processes. The most prominent processes in the union PPI network are related to system development (eg, development of blood vessels, heart, lymphoid organs and nervous system, regulation of growth, angiogenesis, and organ morphogenesis), regulation of signaling pathways, cell adhesion, migration, endocytosis, and regulation of cell death. Considering specifically the proteins from intersection, we observed their involvement in the regulation of signaling pathways, system development, and immune system response, which means that these processes are highly influenced by the interaction of proteins linking IDUA and cholesterol networks. In addition, the centrality analysis revealed that IDUA is one of the bottlenecks controlling the flow of information through the network. Conclusion: Our results showed a network linking IDUA and cholesterol metabolism proteins. The implications of these findings for the clinical manifestations of mucopolysaccharidosis I should be further investigated.

5. Molecular Genetics

1011 - Characterization of Algerian Patients With Morquio Type A: Novel Mutation in the GALNS Gene

Abdelmadjid Benmansour¹, Arndt Rolfs², Anne Katrin Giese², and Catherine Caillaud³

¹Oran, Algeria

²Akos Institute, University of Rostock, Rostock, Germany

³Necker enfants malades hospital, Paris, France

Objectives: To describe new patients with N-acetylgalactosamine-6-sulfatase (GALNS) gene mutation and investigate intrinsic variability of mucopolysaccharidosis type IVA (MPS-IVA; Online Mendelian Inheritance in Man #253000) or Morquio A syndrome (MPS-IVA) in patients sharing the same genotype. Methods: Direct Sanger sequencing of GALNS gene in 3 patients from 2 unrelated families with MPS-IVA clinical description of the patients. Results: We identified in both pedigrees a homozygous mutation in exon 5 of the GALNS gene (c.454dupC-p.Leu152Profs6*), which creates a frameshift at codon 152 and results in a stop codon 5 position downstream. The expression of MPS-IVA is different: while the 2 siblings have a moderate form of MPS-IVA, the third patient is severely affected. Conclusion: Mucopolysaccharidosis type IVA is an inherited autosomal recessive disease caused by a deficient activity of the lysosomal enzyme GALNS. More than 180 different mutations have been described in the GALNS gene. Based on the severity of the skeletal dysplasia, a mild “attenuated” and a severe “classic” form are distinguished. Our patients, who carry a novel mutation in the GALNS gene, provide evidence that there must be factors influencing disease severity beyond basic genotype–phenotype correlations.

1028 - Morquio A Syndrome (Mucopolysaccharidosis IVA): A Review of 277 Gene Mutations Curated in a New GALNS Locus-Specific Database

Nicole Miller¹, Amelia Morrone², Anna Caciotti², Robert Atwood³, Kathryn Davidson¹, Chaoyi Du³, Patricia Francis-Lyon⁴, Paul Harmatz⁵, Matthew Mealiffe¹, Sean Mooney³, Tal Ronnen Oron³, April Ryles⁴, and Karl A Zawadzki⁶

¹BioMarin Pharmaceutical Inc, Notvato, CA, USA

²Molec and Cell Biol Lab, Ped Neurol Unit and Lab, Meyer Children’s Hospital, Florence, Italy

³The Buck Institute for Research on Aging, Novato, CA, USA

⁴Department of Computer Science, University of San Francisco, San Francisco, CA, USA

⁵Children’s Hospital & Research Center Oakland, Oakland, CA, USA

⁶Health Interactions Inc, San Francisco, CA, USA

Introduction: Morquio A syndrome (mucopolysaccharidosis IVA [MPS-IVA]) is caused by deficient activity of the enzyme N-acetylgalactosamine-6-sulfatase (GALNS) resulting from mutations in the GALNS gene. Morquio A-associated GALNS mutations are numerous and heterogeneous. New mutations are continuously published. To aid the detection and interpretation of GALNS mutations, we summarize all Morquio A-associated published mutations in GALNS and report a new public-access, locus-specific database for the GALNS gene. Methods: We summarize published mutations in GALNS from 541 patients with Morquio A, together with an additional 81 published, Morquio A-associated GALNS mutations that were not described in the context of genotypes from individual patients. Results: A total of 277 unique GALNS mutations associated with Morquio A were identified from 1091 published GALNS alleles. In agreement with the previous findings, most GALNS alleles reported from patients are missense (79%), and even the most frequent mutations are relatively uncommon. The 3 most common missense alleles (R386C, I113F, and G301C) together only represent 14% of all alleles. There is significant geographical and/or ethnic origin-based allele frequency variability. Of these alleles, 11% are insertions/deletions, 6% intronic, and 4% nonsense. Most Morquio A-associated mutations have only been reported 1 to 2 times. We find that 48% of patients are homozygous for a GALNS mutation, 39% heterozygous, and 13% have only 1 mutation detected. The locus-specific database for the GALNS gene catalogs all reported mutations in GALNS to date. Conclusion: Challenges in both mutation detection and genotype–phenotype interpretation are caused in part by the heterogeneity of GALNS mutations and lack of multiple independent families with the same mutations. Parental molecular testing is encouraged. Reporting of new alleles facilitates distinguishing pathogenic from benign mutations. The gold standard for diagnosis of Morquio A is still deficient GALNS enzyme activity in leukocytes or fibroblasts, together with wild-type activity of control enzymes. Conflicts of Interest: Dr Fietz has received travel support and honoraria from BioMarin Pharmaceutical. Drs Church, Morrone, and Tylee have received consultant fees and limited travel support from BioMarin Pharmaceutical and provide a diagnostic service for MPS for samples from Turkey that is funded by BioMarin. Dr Pollard is a paid employee of the Greenwood Genetic Center, which has contracts with BioMarin. Dr Wang holds a financial interest in BioMarin. Dr Mooney serves as a consultant for BioMarin Pharmaceutical. Mrs Davidson and Dr Miller are employees of BioMarin. Drs Al-Sayed, Brusius-Facchin, Caciotti, Coll, Gort, Kubaski, Lacerda, Laranjeira, Leistner-Segal, Pajares, and Ribeiro declare no potential conflicts of interest.

1228 - Morquio Syndrome: New Heterozygous Mutation of the GALNS Gene in 2 Siblings From South-West Colombia

Harry Pachajoa^1,2, María Fernanda Hernandez-Amariz¹, Felipe Ruíz-Botero¹, and Sabrina Eichler³

¹Centro de Investigaciones en Anomalías Congénitas y Enfermedades Raras, Facultad de Ciencias de la Salud, Universidad Icesi, Cali, Colombia

²Fundación Clínica Valle del Lili, Cali, Colombia

³ Director Diagnostic Analytics Centogene, Rostock, Germany

Introduction: Mucopolysaccharidosis type IV A, or Morquio syndrome, is an autosomal recessive lysosomal storage disorder that is caused by mutations in the N-acetylgalactosamine-6-sulfatase (GALNS) gene, leading to the deficiency of GALNS enzyme which is encoded by this gene, resulting in the accumulation of keratan sulfate and chondrotin sulfate in certain tissues. It is expressed as generalized skeletal dysplasia with corneal clouding, resulting in short stature, pectus carinatum, platyspondylia, odontoid hypoplasia, kyphoscoliosis, and genu valgum. Cardiovascular and respiratory systems can also be affected. This phenotype has a broad variability associated with more than 180 mutations that have been reported. Until recently, there was no effective therapy for treating the disease aside from a multidisciplinary approach, and this year a recombinant enzyme was approved. Objective: To report the cases of 2 siblings with new mutation in GALNS gene. Methods: Nine and six-year-old brothers with clinical characteristic of severe Morquio syndrome presenting deficiency of GALNS enzyme. The GALNS gene was analyzed by polymerase chain reaction and exome sequencing. Results: A previously reported mutation in exon 3 (c.280C>T p.R94C) and a new heterozygous variant in exon 9 (c.998G>A p.G333D) were found. They were analyzed with polyphen-2, SIFT, and Align-GVGD softwares with a prediction of damaging mutations. Conclusion: These brothers have received an approach in a multidisciplinary team including pediatrician, orthopedist, geneticist, endocrinologist, neurosurgeon, physiatrist, and neuropsychologist, and the enzymatic replacement therapy is being considered. This multidisciplinary approach is recommended for the best control of the disease.

1038 - A Complex New Splicing Mutation in IDUA Gene Present in Compound Heterozygosity in a Mexican Family With 2 Siblings Affected by Mucopolysaccharidosis I

Yuritzi Santillán-Hernández¹, Aurea Vera-Loaiza¹, and Raul Eduardo Piña-Aguilar¹

¹Medical Genetics Department, Centro Médico Nacional “20 de Noviembre”, ISSSTE, Mexico city, Mexico

Objective: To describe a Mexican family with siblings having mucopolysaccharidosis type I presenting a new complex mutation. Results: Sibling 1: second pregnancy after first ectopic pregnancy. Normal pregnancy and normal milestones development. After skull fracture at 17 months, coarse facial features and brain mild atrophy were detected, and he was referred to Genetics. Subsequently, he presented umbilical and inguinal hernia, recurrent ear infections, dysostosis multiplex, hepatomegaly, global development delay, and corneal opacity. He began enzymatic therapy with Aldurazyme at 54 months and was transplanted at 65 months with umbilical cord blood progenitor cells. He died of an infection 2 months later. Sibling 2: third pregnancy. At the last trimester of pregnancy, the mother presented high blood pressure. At birth diagnosed with clubfoot. Further laboratory studies were performed due to history of affected brother and confirmed the diagnosis in the patients. Nowadays, he has mild corneal opacities, and he is receiving enzyme replacement therapy with Aldurazyme since 5 months. The family did not authorized bone marrow transplant. Laboratory studies of sibling 2: enzymatic activity for α-l-iduronidase (IDUA) activity in a dried blood sample was 0.1 mmol/L/h. Sequencing of IDUA gene found 2 heterozygous mutations. The first is located in exon 2/intron 2: c.299_299+1delinsAT (p.R100Nfs*32). This is a result of combination of 2 heterozygous changes: c.299G>A (p.R100 K) and c.299+1G>T; both are not previously reported. PolyPhen-2 and Mutation Taster indicated that both are damaging and Alamut 2.2 predicts an aberrant effect in splicing. The second mutation is located in exon 11 c.1598C>G (p.P533R). The father is carrier of c.299_299+1delinsAT and the mother of c.1598C>G. Conclusion: There are more than 200 mutations described in IDUA, including 3 complex mutations. Only 1 is a deletion–insertion; the present new splicing mutation expands the type of changes that affect the function described for IDUA gene.

1044 - System Biology Approach to Mucopolysaccharidosis Through the Use of a Computational Human Metabolic Reconstruction

Carlos J. Almeciga¹, Diego A Salazar², Edwin A. Rodriguez¹, George E. Barreto², Janeth Gonzales¹, and Carlos J. Almeciga-Diaz¹

¹Institute for the Study of Inborn Errors of Metabolism, Pontificia Universidad Javeriana, Bogotá, Colombia

²Pontificia Universidad Javeriana, Bogotá, Colombia

Objective: To identify the cellular mechanism impaired on mucopolysaccharidosis and new biological markers through a system biology approach using a computational metabolic human network reconstruction. Methods: The human metabolic reconstruction Recon2 was used to model the metabolic changes observed after silencing each one of the mucopolysaccharidosis (MPS)-related genes. Synthesis of adenosine triphosphate was selected as objective function. Models were analyzed using COBRA toolbox through flux balance and variability analysis. Genes associated with reactions that changed after gene silencing were subjected to enrichment analysis. Results: Models for MPS-I, -II, -III (A to D), -IV (A and B), -VI, and -VII were generated. For all the evaluated MPS models, several genes associated with cellular respiration and oxidative phosphorylation were altered as previously reported for other lysosomal storage disorders. New or unexplored metabolic pathways were also observed, such as the metabolism of some amino acids, peroxisome proliferator-activated receptor-γ signaling, and purine and pyrimidine metabolism. Flux variability analysis allowed to identify different grades of overlapping of the reaction fluxes ranges of the MPS models in comparison to those observed with the wild-type model. Reaction fluxes ranges in the MPS models, which were outside those observed in the wild-type model, were classified as possible biomarkers. Metabolism of sphingolipids and aminosugar, as well as transport and exchange/demand reactions, showed the highest number of reaction fluxes ranges outside the wild-type ranges. Conclusion: The use of the human metabolic reconstruction Recon2 is a valuable tool that allows to model the metabolic consequences of glycosaminoglycan catabolism impairment and to predict new biomarkers. In addition, these models might be used to identify new therapeutic targets.

1046 - Idorunate-2-Sulfatase Gene: Molecular Characterization of 103 Latin American Patients

Ana Carolina Facchin¹, Ida Vd. Schwartz¹, Francyne Kubashi¹, Roberto Giugkiani¹, and Sandra Leistner-Segal¹

¹Medical Genetics Service, Hospital de Clinicas de Porto Alegre, Porto Alegre, Brazil

Objective: To identify the disease-causing mutations in 103 unrelated patients with mucopolysaccharidosis II (MPS-II) from Latin America. Methods: Samples were first analyzed through polymerase chain reaction (PCR)/restriction fragment length polymorphism for the presence of the common inversion/disruption of the idorunate-2-sulfatase (IDS) gene. Samples with no evidence of the IDS–IDS2 recombination were analyzed throughout the 9 exons and intron–exon boundaries of the gene by PCR and sequencing. Results: We have found great allelic heterogeneity among our patients; 57 different mutations in 103 patients and 30 novel mutations. All the novel point mutations were considered to be causative for the disease after analysis in 100 alleles of unaffected, and unrelated controls and bioinformatics analyses, performed by Polyphen v.2, predicted that these mutations are probably damaging. Alterations such as inversion/disruption was found in 13 (12%) of 103 patients, partial deletions was found in 4 (4%) of 103 patients, and total deletion of the IDS gene was found in 3 (3%) of 103 patients. Small insertions/deletions/indels (<22 bp) and point mutations were identified in 83 (88%) of 103 patients. Intronic mutations were found in 3 (3%) of 103 patients, all of which involves the consensus splice donor or acceptor site. Regarding the type of the 57 different small alterations found, 2 (3.5%) of 57 were deletions, 2 (3.5%) of 57 were indels, 4 (7.0%) of 57 were duplications, and 49 (85%) of 57 were point mutations. Among point mutations, 7 (10.6%) of 49 were splice site, 10 (21.2%) of 49 were nonsense, and 32 (68%) of 49 were missense mutations. Conclusion: This is the largest sample of Latin American patients with MPS-II reported to date. We believe that the methodology employed in this study is appropriate for the diagnosis and the identification of mutations in patients with MPS-II and possible carriers. Therefore, in the present state of knowledge, the identification of the mutation present in individuals with MPS-II has, as main objective, the genetic counseling of families.

1052 - Clinical and Molecular Genetic Analysis of Korean Patients With Mucopolysaccharidosis Type III (Sanfilippo Syndrome)

Ah-Ra Ko¹, Youghee Kwun², Rim Huh², Jieun lee², SungYoon Cho², YounBae Sohn³, and Dong-Kyu²

¹Clinical Research Center, Samsung Biomedical Research Institute, Sungkyunkwan University School of Medicine, Seoul, South Korea

²Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea

³Department of Medical Genetics, Ajou University Hospital, Suwon, South Korea

Introduction: Mucopolysaccharidosis type III (MPS-III, Sanfilippo syndrome) is an autosomal recessive disorder caused by deficiencies in 4 enzymes involved in the lysosomal degradation of the glycosaminoglycan heparan sulfate. It is characterized by progressive neurocognitive declines, behavioral abnormalities, sleep disturbances, and relatively mild somatic manifestations. Objectives: To evaluate the clinical and molecular genetic characteristics of 21 Korean patients with MPS-III. Methods: We retrospectively reviewed 21 patients from 20 unrelated families who were diagnosed as MPS-III by enzyme assay from January 1997 to December 2013 in Samsung medical center. Clinical manifestations and results of molecular genetic analysis were investigated. Results: In all, 10 (48%) patients were diagnosed as MPS-IIIa and MPS-IIIb, respectively, and 1 patient (4%) as MPS-IIIc. The median age of onset of first signs or symptoms was 3.3 years (range 1.5-5.0), and median age at diagnosis was 5.9 years (range 1.9-10.2). The average delay between the first presenting signs/symptoms and the diagnosis was 2.6 years (range 0.2-6.3). The first presenting signs/symptoms of 20 patients were developmental delay (95%), and only 1 (5%) patient showed hepatomegaly. At the time of diagnosis, facial dysmorphism was observed in 17 (80%) patients. The other clinical manifestations of patients who could be followed up were behavioral disturbances (67%), sleep disturbances (62%), seizure (57%), and orthopedic problems (42%). The median age at loss ability to speech was 8 years (range 5.7-11) and to walk was 9.9 years (range 7.9-13.0) in patients who were available. Molecular genetic analysis was performed in 7 patients with MPS-III, and 9 different sequence variants were identified. Four novel mutations (c.703G<C, c.664-42G>A(IVS5-42G>A), c.200T>C, c.1976C>T) were detected. Conclusion: It is suggested that when a patient shows developmental delay and/or characteristic somatic feature of MPS, screening for MPS-III should be considered.

1081 - Molecular Testing of 163 Patients With Morquio A Syndrome (Mucopolysaccharidosis IVA): 39 Novel GALNS Gene Mutations

Nicole Miller¹, Amelia Morrone², Karen L. Tylee³, Moen Al-Sayed⁴, Ana Carolina Brusius Facchin⁵, Anna Caciotti², Heather J. Church³, MaJosé Coll⁶, Kathryn Davidson¹, Michael J. Fietz⁷, Laura Gort⁶, Madhuri Hedge⁸, Francyne Kubaski⁵, Lúcia Lacerda⁹, Francisco Laranjeira⁹, Sandra Leistner-Segal⁵, Sean Mooney¹⁰, Sonia Pajares⁶, Laura Pollard¹¹, Isaura Ribeiro⁹, and Raymond Wang¹²

¹BioMarin Pharmaceutical Inc, Novato, CA, USA

²Meyer Children’s Hospital and University of Florence, Florence, Italy

³Willink Biochem Gen, Cen Manchester U. Hosp NHS Found Tr, United Kingdom

⁴Dept of Med Gen, King Faisal Specialist Hosp and Research Center, Riyadh, Saudi Arabia

⁵Lab de Gen Molec, Hosp de Clínicas de Porto Alegre, Brazil

⁶Servicio de Bioquímica y Genética Molecular, Hospital Clínic de Barcelona, Spain

⁷SA Pathology, Women’s and Children’s Hospital, North Adelaide, Australia

⁸Emory Genetics Lab, Emory University School of Medicine, Atlanta, GA, USA

⁹Centro de Genética Médica Jacinto Magalhães (CGMJM) do Centro Hospitalar do Porto (CHP), Portugal

¹⁰The Buck Institute for Research on Aging, Novato, CA, USA

¹¹Biochemical Genetics Lab, Greenwood Genetic Center, Greenwood, SC, USA. ¹²Children’s Hospital of Orange County, Orange, CA, USA

Introduction: Morquio A syndrome is an autosomal recessive lysosomal storage disorder caused by partial or total deficiency of the enzyme N-acetylgalactosamine-6-sulfatase (GALNS) encoded by the GALNS gene. Mutations occur throughout the gene and many are identified only in 1 patient or 1 family, causing difficulties both in mutation detection and in interpretation. Here, we publish GALNS mutations in patients diagnosed with Morquio A, identify GALNS mutations that previously had only been reported in 1 patient or family, and describe novel Morquio A-associated GALNS mutations. Methods: Mutations in GALNS from patients with Morquio A were reported from 7 different laboratories; 2 clinicians were involved in reporting molecular testing results. Individuals received a diagnosis of Morquio A prior to and independent of molecular testing results. All GALNS mutations were checked against reported single-nucleotide polymorphism (SNPs). Results: Molecular testing of 163 patients with Morquio A identified 99 separate changes, of which 39 were previously unpublished, novel GALNS mutations associated with Morquio A: p.Val16Glu, p.Leu36Arg, p.Asp40Asn, p.Val48Gly, p.Glu51Lys, p.Pro81Leu, p.Ala84Glu, p.Leu91Pro, p.Gly116Val, p.His145Tyr, p.Phe156Leu, p.His166Arg, p.Gly201Glu, p.Leu214Pro, p.Phe216Ser, p.Thr235Lys, p.Ser264Thr, p.Asn289Asp, p.Arg380Gly, p.Gly415Val, p.Ile416Thr, p.Pro420Arg, p.Ala492Thr, p.Gly500Ser, p.Cys507Phe, p.Glu126Ter, p.Trp141Ter, p.Tyr209Ter, p.Arg251Ter, p.Pro357ArgfsTer21, p.Leu372SerfsTer6, p.Tyr385Ter, p.Gln414Ter, p.Val427SerfsTer13, p.Glu477_Gln485del, Complex del-dup (duplication from intron 5 to intron 9, deletion in intron 10), c.120+1g>c, c.405_422+1del, c.758+4a>t. We also identified 26 SNPs. Conclusion: Reporting Morquio A-associated GALNS mutations improves genetic counseling and diagnosis capability. There are limitations in what can be concluded from molecular testing of the patient alone, in addition to limitations in mutation detection. Therefore, it is recommended when possible to also molecularly test both parents. As previously reported, the second disease-associated allele may not be identified up to 15% of the time. Although molecular testing provides useful diagnostic and genetic counseling information, enzyme activity testing of GALNS, along with other enzymes, remains the standard for diagnosis of Morquio A.

1139 - The G116V Mutation is Common in Patients of Pakistani Origin With Mucopolysaccharidosis Type IVA and is Associated With a More Severe Phenotype at Presentation

Saikat Santra¹, Suresh Vijay¹, Shagufta Khan¹, Jinendra Ekanayake¹, and Guirish Solanki¹

¹Birmingham Children’s Hospital, Birmingham, United Kingdom

Introduction: Mucopolysaccharidosis type IVA (MPS-IVA) is a lysosomal storage disorder showing variation in the severity of its widespread skeletal dysplasia between patients. In our center, many patients are of Pakistani origin, in whom mutation analysis reveals a common mutation. Patient records were analyzed to assess whether this mutation is associated with a severe skeletal phenotype. Methods: Twenty-eight patients with MPS-IVA have been treated at our hospital between 2000 and 2013. Patient records including available computed tomography and magnetic resonance imaging were reviewed to assess the spinal manifestations at presentation in these patients. Results: In all, 24 (85%) patients were of Pakistani origin, of whom 17 (70%) were homozygous for the G116V mutation in GALNS and had family members from the Saleh Khana region of Pakistan. Median age at diagnosis in the G116V group was earlier: 16 months (index cases 23.5 months) compared to 24 months (index cases 30 months) in the non-G116V group. Median age of first symptom recognition was 8.5 months in the G116V group and 12 months in the non-G116V group. There were lumbar spine abnormalities at presentation in 100% of the G116V group and 77% of the non-G116V group, and lumbar spinal surgery has been done or is awaited in 29% of the G116V group versus 9% of the non-G116V group. The incidence of cervical cord compression was similar across both the groups but was first noted earlier (median 30 months vs 113 months) and led to earlier intervention (median 5 years vs 10.5 years) in the G116V group. There have been 4 deaths in the G116V group (median 8.6 years) compared to 1 in the non-G116V group (at 23 years). Conclusion: The G116V mutation is a common mutation among patients with MPS-IVA who originate from the Saleh Khana region of Pakistan and is associated with a more severe spinal phenotype than other mutations.

1145 - Analysis of Pathogenic Mutations, Disease Progression, and Antibody Response to Idursulfase in 17 Dutch Patients With Mucopolysaccharidosis II

Audrey Vollebregt¹, Marianne Hoogeveen-Westerveld², Marian A. Kroos², George J. Ruijter¹, Iris Plug¹, Ans T. van der Ploeg¹, and Pim WWM Pijnappel¹

¹Center for Lysosomal and Metabolic Diseases & Department of Pediatrics, Erasmus MC-Sophia, Rotterdam, the Netherlands

²Department of Clinical Genetics, Molecular Stem Cell Biology, Erasmus MC, Rotterdam, the Netherlands

Introduction: Mucopolysaccharidosis type II (MPS-II; Hunter) is a rare X-linked lysosomal storage disorder caused by the deficiency of iduronate-2-sulfatase (I2S), leading to accumulation of glycosaminoglycans (GAGs). Clinical symptoms include short stature, coarse facial features, ivory skin lesions, mental impairment, hepatosplenomegaly, and cardiac valve abnormalities. Objective: To link the genotypes of 17 Dutch patients with MPS-II to biochemical and clinical parameters, including the antibody response to enzyme replacement therapy (ERT). Methods: The effects of I2S mutations on enzyme activity and processing were determined in a transient expression system. Urinary GAG levels were measured. Antibody levels were determined at several time points during ERT using enzyme-linked immunosorbent assay. Results: A total of 15 different pathogenic mutations were identified. These included 2 total gene deletions, 3 small deletions, 1 nonsense, and 9 missense mutations. Six mutations were novel. The effects of these mutations on processing and activity of I2S in vitro were studied. All patients developed a modest antibody response to idursulfase within 12 weeks of treatment. Within the group of 17 patients, the severity and onset of clinical symptoms varied from mild symptoms with no mental impairment to a severe progressive disease phenotype with mental retardation. Conclusion: This study provides insight into the phenotype–genotype relationship in MPS-II in the Dutch population. The antibody response to ERT was mild.

1147 - Determination of Molecular Profile of Colombian Patients With Diagnosis of Mucopolysaccharidosis Type VI: Maroteaux Lamy Syndrome

Johanna C. Acosta Guio¹, Gustavo Giraldo², Paola Ayala², Juan Carlos Prieto², and Reggie Garcia¹

¹Instituto de Investigación en Nutrición, Genética y Metabolismo de la Universidad el Bosque, Inst, Bogotá, Colombia

²Instituto de Genética de la Pontificia Universidad javeriana, Bogotá, Colombia

Introduction: Maroteaux Lamy syndrome (Mucopolysaccharidosis VI [MPS-VI]; Online Mendelian Inheritance in Man # 253200) is a lysosomal storage disease characterized by systematic clinical manifestations and significant functional damage. The reported worldwide incidence is 1:248.000 to 1:300.000 live births, and in Colombia 27 cases are known and 10 belong to indigenous groups. To date, 133 mutations have been reported: 100 missense/nonsense, 9 in splicing site 9, 17 small deletions, and 3 small insertions. Materials and Method: Observational description of a cohort of patients. Population and sample: Confirmed patients with decreased enzyme activity in leukocytes arylsulfatase B (ARSB). Methodology: With previous signature of the informed consent, sample of peripheral blood was taken. DNA extraction and amplification: DNA extraction by salting-out method, conventional polymerase chain reaction for all exons in the gene ARSB, reagents from Promega (Fitchburg, Wisconsin) and Thermocycler BIO-RAD (Hercules, California). Sequencing: sequencing of interest regions in the gene ARSB by a capillary sequencer; analysis of sequences using bioinformatic methods. Results: In all, 13 patients were studied; to date, sequencing of 4 exons in 7 patients have been performed, finding in patient 3 a variant of exon 2, not previously reported, c.1618A>C p.H111P. The Polyphen2, Mutation taster, Mustab, Panther, and Provean programs were run, evaluating the effect on protein, finding a highly deleterious variation. Variants in exon 5 were identified: Patient 1 rs101598; patient 2, rs101598 and rs1065757; patient 4, rs1065757; patient 5, rs1065757; and patient 6, rs1065757. The sequences of the remaining 4 exons for the initial 7 patients and the 8 exons of the remaining 6 patients are currently running. Conclusion: In the samples analyzed to date, a potentially pathogenic variant in exon 2, c.1618A>C p.H111P, not previously reported in the literature, was identified; the sequencing of the remaining exons is in process.

1152 - Mutation Spectrum and Report of 4 Novel Mutations in Iduronate-2-Sulfatase Gene in Indian Patients With Hunter Syndrome

Gaurav Verma¹, Madhulika Kabra¹, Neerja Gupta¹, Shivaram S. Shastri¹, Pallavi Mishra¹, Punt Kaur¹, Savita Sapra¹, Madhumita Roychowdhury¹, and Sheffali Gulati¹

¹Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, India

Introduction: Mucopolysaccharidosis type-II (MPS-II; Hunter syndrome) is an uncommon X-linked recessive multisystem disorder with significant variability in both age of onset and rate of progression. It is caused by the deficiency in the activity of the lysosomal enzyme, iduronate-2-sulfatase (IDS), synthesized by the 24 kb long IDS gene, located at Xq28. Objective: To identify the mutation spectrum of IDS gene in Indian patients with MPS-II. Method: Twenty-two patients were recruited from 19 unrelated families after institutional ethics committee approval and informed consent based on the deficient leukocyte IDS levels. Genomic DNA was amplified by polymerase chain reaction using 9 sets of primers that covered the entire coding region of the IDS gene, flanking intronic splice regions and 5′ and 3′ untranslated regions. Bidirectional Sanger-sequencing was performed using ABI 3130 Genetic Analyzer (Life technologies, Carlsbad, California). Sequences were analyzed using National Center for Biotechnology Information Basic Local Alignment Search Tool. Results and Discussion: Based upon the phenotypic analysis of 22 patients, 18 patients were classified as severe MPS-II. Mutations were identified in 10 families of 19. Missense (3 of 19, 16%), nonsense (2 of 19, 10%), splice site (2 of 19, 10%), small insertion, small duplication, and indel (1 of 19, 5%) each were identified. Four mutations, c.1248C>T, c.205_206insAAAACTGGCAT, c.1435_1456dupAAGCCGAGTTTAAAAGATATAA, and c.1442delGinsTC, were novel and predicted to be pathogenic. Nonsense mutations were associated with severe phenotype in 2 patients. Prenatal diagnosis was done in 1 family and the fetus was found to be a carrier. Majority of the mutations (4 of 19, 21%), though nonrecurrent, were in exon 9 and its flanking splice-site region. The IDS/IDS2 recombination has not yet been tested, and this could be the main reason for not finding mutations in the remaining 9 families. Conclusion: Mutation analysis of IDS gene is helpful in making a specific diagnosis, carrier testing, and prenatal diagnosis. No specific genotype–phenotype correlation was observed. Exon 9 appears to be the mutational hot spot in our Indian patients.

1153 - A Personalized Clinical Genomics Approach to Estimate Gene Stability on Iduronate-2-Sulfatase in a Colombian Southwestern Population Affected With Mucopolysaccharidosis Type II

Jose M. Satizabal¹, Lina J. Moreno², Adalberto Sánchez¹, Julio C. Montoya¹, and Felipe García¹

¹Universidad del Valle Escuela de Ciencias Básicas, Valle Del Cauca, Colombia

²Universidad del Valle Departamento de Pediatria, Genomics, Valle Del Cauca, Colombia

Introduction: The evaluation and characterization of the variability in gene sequences associated with disease processes have led, in recent years, to establish prediction models for change in gene frequencies from bioinformatics analysis in order to sponsor screening programs and clinical intervention at the population level. Objectives: To determine gene model variability in the iduronate-2-sulfatase (IDS) gene in patients with mucopolysaccharidosis type II (MPS-II) and their families. Methods: From DNA sequencing results for the IDS gene in patients with MPS and their families, bioinformatics analysis with PolyPhen-2 and MEGA V6.0 software packages were conducted to establish the effect of gene variants in the pathogenesis and to build a model of evolution in the gene of interest on the population group screened. Results: A group of mutations and polymorphisms, some of them previously reported in the literature and other de novo, were characterized. Their significance and effect on the protein product of the IDS gene were determined. Finally, the presence of a recent founder effect for frequently allelic variants was established, showing that action of genetic drift in medium term on these variants will increase the frequency and likely drive to a change in the incidence of MPS-II in the Colombian southwestern region. Conclusion: In the medium term, the incidence of MPS in colombian southwestern population is expected to increase, which warrants the immediate decision making of public health, to implement a plan of surveillance through neonatal screening.

1155 - Mutation p.T500A in Exon 15 of the GLB1 Gene is not Prognostic for Morquio B Disease

Eduard Paschke¹, Roberto Giugliani², Charles Marques-Lourenco³, Karl Paul⁴, and Werner Windischhofer⁴

¹Department of Pediatrics, Medical University of Graz, Graz, Austria

²Medical Genetics Service, HCPA and Department of Genetics, UFRGS, Porto Alegre, Brazil

³Neurology Service, Hospital das Clinicas, FMRP-USP, Ribeirao Preto, Brazil

⁴Department of Pediatrics, Medical University of Graz, Graz, Austria

Introduction: Alterations in the GLB1 gene are found in a neurodegenerative disorder, GM1 gangliosidosis (GM1), and in Morquio B disease (MBD) with skeletal dysplasia and normal central nervous system (CNS) function. At least 2 GLB1 alleles, p.W273L and p.T500A, were so far reported as being prognostic for the MBD phenotype. p.W273L was found in homozygous and heterozygous MBD, never detected in GM1, and biochemically related to normal amounts of lysosomally located gene products with specific catalytic impairment of keratan sulfate degradation. In contrast, only 2 previous reports on 3 European cases suggested a phenotype-determining role for p.T500A. Although 2 of them were unequivocally classified as having the specific dysostosis and normal CNS function, a third one had minor, possibly nongenetic mental retardation. We now can add further information on 3 heterozygote p.T500A carriers from Brazil. Methods: Phenotyping of patients using a standardized protocol as well as biochemical and genetic diagnosis was done as previously published.¹ Results: Three Brazilian males (A, B, and C), 7, 31, and 39 years of age, were found to be heterozygote for p.T500A [c.1498A>G] and a small insertion, c.1577dupG, the most common GLB1 allele in Brazil. Causing a frameshift and truncated gene product (p.Gly526GlyfsX5) and affecting a functionally essential domain in exon 16, this allele causes severe infantile GM1 in homozygous patients. Patients with the phenotype p.T500A/c.1577dupG may therefore be regarded as functional homozygotes for p.Thr500Ala. Although expected to express the MBD phenotype, only 2 of them (A and C) were neurologically unaffected. Patient B developed speech difficulties at age 3 and thereafter mild psychomotor delay, neurological regression, and low normal intelligence. Conclusion: p.T500A is not prognostic for MBD. With respect to upcoming therapies, patient databases are required to elucidate the full genetic spectrum of neurologically unaffected GLB1 phenotypes.

1158 - Genotype–Phenotype Correlation in Mucolipidosis III α-β: A comprehensive Study of a Brazilian Patient Exhibiting Novel GNPTAB Mutations

Ida Vanessa Doederlein Schwartz¹, Renata V. Velho², Fernanda Sperb-Ludwig³, Raffaella De Pace⁴, Taciane Alegra², Nataniel F Ludwig⁵, Charles M. Lourenço⁶, Thomas Braulke⁷, and Sandra Pohl⁷

¹Department of Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

²PGP in Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

³PGP in Healthy Sciences, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

⁴Section Biochemistry, Children's Hospital, University Medical Center Hamburg-Eppendorf, Hamburg, Germany

⁵Medical Genetics Service of Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

⁶Hospital de Clínicas de Ribeirão Preto, Universidade de São Paulo, São Paulo, Brazil

⁷Section Biochemistry, Children's Hospital, University Medical Center Hamburg-Eppendorf, Hamburg, Germany

Introduction: Mucolipidoses (ML) II and III α/β are autosomal recessive disorders caused by GNPTAB mutations. GNPTAB encodes the α and β-subunit precursor of membrane-bound N-acetyl-d-glucosamine 1 (GlcNAc-1) phosphotransferase that is synthesized in the endoplasmic reticulum and transported to the Golgi apparatus for proteolytic activation. The GlcNAc-1-phosphotransferase catalyzes the formation of mannose 6-phosphate targeting signals on soluble lysosomal enzymes. Patients with ML-II/III α/β are biochemically characterized by missorting of lysosomal enzymes and the accumulation of nondegraded material in lysosomes which lead to skeletal abnormalities, psychomotor retardation, and cardiorespiratory complications. A considerable variation in the onset and severity of the clinical phenotypes are observed. Objectives: To describe a Brazilian patient with ML-III α/β presenting 2 novel mutations in GNPTAB and analysis of the mutant messenger RNA (mRNA) and protein. Methods: GNPTAB geonomic DNA from the affected family was analyzed. Pathogenic mutations were inserted into a wild-type complementary DNA expression construct. Expression studies, proteolytic activation, and subcellular localization analysis of mutant α and β-subunits by real-time polymerase chain reaction, Western blotting, and immunofluorescence microscopy were performed. Results: A 2-year-old boy born from nonconsanguineous parents was presented for clinical genetic evaluation of suspected mucopolysaccharidoses. The biochemical and clinical diagnosis was suggestive of ML-III. Genomic GNPTAB sequencing revealed that the patient was compound heterozygous for the novel mutations c.1931_1932CA>TG (p.T644 M) and c.3668_3670delCTA (p.T1223del). The amino acid substitution T644M affected a potential N-glycosylation site, whereas the mutation p.T1223del leads to amino acid deletion in the second membrane domain of the α/β-subunit precursor. Analysis of mutant mRNA expression showed no significant differences in comparison with controls. The protein expression, proteolytic cleavage, and subcellular localization of both mutants were comparable to the wild-type protein, but the enzyme activity was different than that of controls. Conclusion: Our data extend the knowledge about the structural requirements for stability, intracellular transport, and proteolytic activation of the GlcNAc-1-phosphotransferase that contribute to understanding of genotype–phenotype correlations in patients with ML-II/-III α/β.

1169 - Mutational Spectrum in a Sample of Mexican Patients With Mucopolysaccharidosis Type VI

Miguel Angel Alcantara¹, and Ariadna Gonzalez-Del Angel¹

¹Department of Human Genetics, National Institute of Pediatrics, Mexico City, Mexico

Introduction: Mucopolysaccharidosis type VI (MPS-VI) is an autosomal recessive disorder caused by a deficiency of arylsulfatase B (ARSB). More than 130 mutations have been identified in the ARSB gene and 75% are point mutations. In Mexico, the incidence, prevalence, and mutational spectrum of MPS-VI are unknown. Objective: To describe the ARSB genotypes in a sample of Mexican patients with MPS-VI. Materials and Methods: Ten nonrelated patients with clinical suspicion of MPS-VI were included; only 3 of them were referred with a decreased ARSB activity. Fully automated sequencing of the 8 exons and exon–intron boundaries of ARSB (RefSeq NG_007089.1, NM_000046.3) was performed using genomic DNA (dried blood spot or total blood). Results: Seven pathogenic alleles were identified, 5 of them are not enlisted in HGMD and MPS6 databases: c.309C>A (p.Tyr103*), c.257A>T (p.Tyr86Phe), c.655G>C (p.Ala219Pro), c.980G>A (p.Arg327Gln), c.176A>G (p.Asp59Gly), and c.904_905inv (p.Gly302Pro). Homozygous genotypes were more prevalent (N = 8 patients) than compound heterozygous genotypes (N = 2 patients). Point mutations account for 70% of MPS-VI alleles, and c.904_905inv comprises 6 alleles (30%, 3 homozygous patients). Novel missense mutations affect the sulfatase superfamily domain; PolyPhen and SIFT analyses predicted them as damaging. Discussion: Predominance of point and novel mutations is in agreement with the mutational ARSB spectrum and the common finding of “private” mutations in MPS-VI. Genotype–phenotype correlation is necessary for the pathogenic classification of novel mutations. To our knowledge, microinversions are not reported in MPS-VI, and predominance of c.904_905inv suggests that this could be a founder allele; haplotype analysis is currently in process. Since 2 mutations were identified, molecular study conducted in patients with clinical suspicion and/or enzymatic diagnosis of MPS-VI is considered a reliable, accurate, and rapid diagnostic test now available in Mexico. Acknowledgments: BioMarin México and Asociación “Pide un deseo” for their financial support to perform the molecular studies.

1170 - α-l-Iduronidase Genotype in a Sample of Mexican Patients With Mucopolysaccharidosis Type I

Ariadna Gonzalez-Del Angel¹, and Miguel Angel Alcantara¹

¹DNA-GEN, SC

Introduction: Mucopolysaccharidosis type I (MPS-I) is an autosomal recessive disorder caused by the deficiency of α-l-iduronidase (IDUA) coded by the IDUA gene located on 4p16.3. More than 100 different mutations have been reported and most of them are private, and due to the great allelic heterogeneity described, national screening studies are required. Objective: To describe the IDUA genotype in a sample of Mexican patients with MPS-I. Materials and Methods: Fourteen patients with clinical diagnosis of MPS-I were included. Fully automated sequencing of the 14 exons and exon–intron boundaries of IDUA were performed using genomic DNA (dried blood spot or total blood). Results: The 2 mutant alleles were identified in all patients. Eleven genotypes due to the presence of 11 pathogenic alleles were observed. The compound heterozygous genotype was the most common (n = 12 patients). Point mutations were observed in 22 alleles, and the most common were c.1205G>A (n = 8) and c.1598C>G (n = 6). Four mutations have not been described before: c.539G>C (p.Trp180Ser), c.525G>A (p.Trp175*), c.901G>C (p.Asp301His), and c.1402 + 1G>C. Novel missense mutation analysis with PolyPhen and SIFT predicted them as pathogenic. Discussion: The presence of 11 alleles in our study is in agreement with the great genetic heterogeneity described in IDUA gene. The c.1205G>A is observed in 50% of mutant alleles in Northern Europe and Spain, and c.1598C>G is observed in 10% of IDUA mutant alleles in Spain. In accordance, in our study, these mutations were the most frequent and together represent the 50% of mutant alleles observed. The third most frequent mutation was the novel c.539G>C, this finding could suggest the presence of a different mutational spectrum of IDUA gene in Mexican population due to its heterogeneity genetic background. Acknowledgments: SANOFI-Genzyme México for their financial support to perform the molecular studies.

1174 - Identification of a Novel Mutation in the Human ARSB Gene on Chromosome 5q14.1 for Patients With Autosomal Recessive Mucopolysaccharidosis Type VI in Southwest Colombia

Maria Amparo Acosta¹, Ramon Lago-Lestón², Francisco Barros-Angueira², and Angel María Carracedo Alvarez³

¹Pediatrics Department, College of Medicine, University of Cauca, Popayán, Colombia

²Clinical Hospital of Santiago de Compostela, Galicia, Spain

³Pathology Department, College of Medicine, University of Santiago de Compostela, Galicia, Spain

Introduction: The mucopolysaccharidosis type VI (MPS-VI) or Maroteaux-Lamy syndrome is a recessive multisystemic progressive lysosomic storage disease caused by the deficiency of N-acetylgalactosamine 4-sulfatase enzyme. In Latin America, few studies have been related to the ethnic origin of patients with MPS-VI, but a difference has been noted in the incidence or prevalence for the region. A total of 32 patients with MPS-VI are identified in Colombia and 16 in the Department of Cauca, corresponding to 50% of the total cases with Maroteaux-Lamy syndrome registered in the country. All 16 patients were identified clinically and by enzyme assay. Methods: DNA sequencing of 2 of these individuals belonging to Guambiano Amerindian shelter with strong inbreeding. Results: Molecular characterization of the mutation in 2 patients with severe form of MPS-VI and their families by sequencing indicated homozygous or heterozygous for the p.Ser403X mutation, which was never reported before. In addition, we report the same haplotype in 2 patients and their heterozygous relatives when N-acetylgalactosamine 4-sulfatase gene was analyzed with intragenic single-nucleotide polymorphisms. Conclusion: These results together with the genealogy analysis strongly suggest an inbreeding effect in this population.

1177 - Use of the Illumina TruSight Inherited Diseases Panel to Assist in the Diagnosis of Lysosomal Storage Disorders

Michael J. Fietz¹, Kristian Brion¹, Tomothy Pyragius¹, and Karin Kassahn¹

¹SA Pathology, North Adelaide, Australia

Introduction: Mutation studies play various important roles in the diagnosis and management of lysosomal storage disorders (LSDs). For most LSDs, mutation testing is performed after obtaining a biochemical diagnosis and is used to confirm the diagnosis to provide prognostic information or to assist with family or prenatal testing. However, for some LSDs, mutation testing is the only means of obtaining a definitive diagnosis. Objective: To assess the suitability of the 550-gene Illumina TruSight Inherited Disease Panel (Illumina, San Diego, California) for the rapid and efficient detection of causative mutations in patients with an LSD. Methods: DNA samples from patients with LSD having known causative mutations or from patients with LSD having a biochemical diagnosis without known mutations or from patients with a clinical suspicion of a relevant LSD were used for validation and testing of the Inherited Disease Panel. Samples were processed according to the manufacturer’s instructions, sequenced using the Illumina MiSeq Sequencing System, and the results analyzed using the Illumina VariantStudio Data Analysis Software. Results: Samples from a number of patients with known disease-causing mutations were examined, revealing that, with the exception of the GBA gene (Gaucher disease), the Inherited Disease Panel reliably detected single-nucleotide changes and small insertions or deletions. Subsequent analysis has enabled the detection of the causative mutations in patients affected by Niemann-Pick disease type C and I-cell disease. Further, detection of mutations in the MCOLN1 and CLN6 genes, respectively, has confirmed clinical diagnoses of mucolipidosis IV and late-infantile neuronal ceroid lipofuscinosis. Conclusion: Analysis of the TruSight Inherited Disease Panel has revealed its ability to rapidly and effectively detect single-nucleotide changes and small insertions/deletions in various LSD genes. However, the results have indicated that the system may not be effective in detecting larger insertions/deletions or in analyzing genes with closely related pseudogenes, for example, GBA.

1193 - Methylation of c.438C>T SNP on IDS Gene Would Lead to a Deamination Cascade Along Gene Sequence Responsible for an Increase in Transitional Mutations

Jose M. Satizabal¹, Adalberto Sanchez¹, Lina J. Moreno², Julio C. Montoya¹, and Felipe García¹

¹Universidad del Valle Escuela de Ciencias Básicas, Valle Del Cauca, Colombia

²Universidad del Valle Departamento de Pediatría – Genomics, Valle Del Cauca, Colombia

Several authors have reported the role of DNA methylation on iduronate 2-sulfatase (IDS) gene as a possible explanation for X chromosome inactivation. Besides, patients with mucopolysaccharidosis (MPS) exhibit a skewed X chromosome-inactivation pattern related to a low or no IDS activity. We reported a pattern of transitional mutation c.438C>T in the relative women of patients with MPS-II caused by point mutations c.641C>T and c.1122C>T. From several bioinformatics analyses, we found an association between the inherited deamination mechanisms, responsible to avoid skewed X inactivation, and transitional mutations in pathogenic spots along IDS gene. Besides, data analysis predicted a possible increase in pathogenic mutations on IDS gene. We consider this finding very valuable to propose a broad screening of methylation target spots in X chromosome of fertile females. Results from these screening tests would help to prevent an increase in allele frequency in X-linked diseases such as MPS, Lesch-Nyhan syndrome, and Duchenne muscular dystrophy.

1196 - Development of a Protocol for Identification of Mutations in Brazilian Patients with Mucolipidosis II/III

Ida V. D. Schwartz¹, Nataniel F. Ludwig², Fernanda S. Ludwig¹, Renata V. Velho¹, Carolina U. Cruz², and Úrsula S. Matte²

¹Universida Federal do Rio Grande do Sul, Porto Alegre, Brazil

²Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

Introduction: Mucolipidoses II and III (ML II/III α/β) is an autosomal recessive disease caused by mutations in the N-acetylglucosamine-1-phosphate transferase, α and β subunits (GNPTAB) gene (MN_024312.3) located on chromosome 12q23.3. This gene encodes 2 subunits (α and β) of N-acetylglucosamine-1-phosphotransferase, which adds a key marker responsible for the recognition of the residue of mannose 6-phosphate that allows lysosomal hydrolases to enter the lysosome. Objective: To develop a protocol for identification of GNPTAB mutations to be applied in Brazilian patients with biochemical diagnosis, or suspect, of ML II/III α/β. Methodology: Retrospective analysis of mutations reported in 16 Brazilian patients with ML II/III α/β who had been previously investigated by our group through sequencing of GNPTAB and had their genotype identified. Results: Twelve different mutations were reported in patients analyzed, the most frequent being c.3503_3504delTC (allele frequency = 37.5%, exon 19). The exons with a higher rate of pathogenic variations are exon 19, exon 13 (4 mutations corresponding to 20% of alleles), and exon 10 (3 mutations corresponding to 12.5% of alleles), followed by exons 3, 12, and 14 (1 mutation each). Discussion/Conclusion: We suggest exon 19 of GNPTAB should be the first one to be analyzed, followed by exons 13 and 10, and, finally, by exons 3, 12, and 14. If we do not find any mutation in these exons, the remaining exons should be analyzed. The use of a protocol analysis for DNA diagnosis has shown great importance, since it decreases the time employed in the analysis and allows reduction in costs. Support: FIPE-HCPA, CNPq, and FAPERGS.

1198 - Whole-Exome Sequencing for Molecular Diagnosis of Mucolipidosis II/III α/β

Ida V. D. Schwartz¹, Fernanda S. Ludwig¹, Taciane Alegra¹, Renata V. Velho¹, Nataniel F. Ludwig², Chong Ae Kim³, Fernando Kok⁴, João P. Kitajima⁴, Eline van Meel⁵, and Stuart Kornfeld⁵

¹Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

²Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

³Universidade de São Paulo, São Paulo, Brazil

⁴Mendelics Genomic Analysis, São Paulo, Brazil

⁵Washington University School of Medicine, St Louis, MO, USA

Objectives: To evaluate the reliability and feasibility of molecular diagnosis by whole-exome sequencing (WES) of mucolipidosis II/III (ML II/III), a genetically heterogeneous autosomal recessive condition caused by mutations in N-acetylglucosamine-1-phosphate transferase, α and β subunits (GNPTAB) or N-acetylglucosamine-1-phosphate transferase, γ subunit (GNPTG). Methods: The patient, an 18-year-old male born to nonconsanguineous parents, had clinical features typical of ML II/III. Previous biochemical investigation showed a very high activity of plasma lysosomal hydrolases and the presence of phosphorylated residues of mannose-6-phosphate in cation-independent mannose 6-phosphate receptor affinity column. Peripheral blood was extracted using Easy DNA kit (Invitrogen). Whole-exome sequencing was performed by capturing 200 000 exons of 20 500 genes with Nextera Exome Capture system, followed by the next-generation sequencing using illumina HiSeq2500 (Illumina, San Diego, California). Sanger sequencing in the patient and parents validated the WES results. Detected variants were analyzed using the algorithms SIFT and PolyPhen2 for prediction of functional impact. Results: Whole-exome sequencing generated 64 363 166 sequences, each target base was read on average 92×, and 94% of the target bases were read at least 10×. Two heterozygous variants in GNPTAB were identified—c.1208T>C (p.Ile403Thr), which were previously reported as deleterious, and the novel variant, c.1723 G>A (p.Gly575Arg), which was not present among more than 8000 normal controls, including 1000 Brazilians. No variants were found in both GNPTG and NAGPA genes. Aame results were obtained using Sanger sequencing. The father was carrier of p.Ile403Thr and the mother of p.Gly575Arg. It was probably predicted that PolyPhen-2 damaged both mutations (respectively, 0.993 and 0.974). SIFT prediction confirmed the first mutation (p.Ile403Thr) as deleterious and pointed the variant p.Gly575Arg as tolerated/neutral. Conclusion: Whole-exome sequencing is a reliable alternative for molecular confirmation of ML II/III and can rapidly arrive at a diagnosis. Prediction of the pathogenicity of rare missense variants is still a problem, and functional studies might be necessary. In this regard, we plan to analyze the expression, proteolytic activation, subcellular localization, and catalytic activity of the mutant enzyme. Support: FIPE/HCPA, FAPERGS, and CNPq.

1200 - Haplotype Analysis of Brazilian Patients With Mucopolysaccharidosis Type IIIC Reveals Possible Founder Effects of HGSNAT Mutations

Carla Martins¹, Sandra Leistner-Segal², Jean-Francois Lefèbvre³, Roberto Giugliani², and Alexey V. Pshezhetsky³

¹Department of Biochemistry, University of Montreal, Montréal, Canada

²Serviço de Genética Médica, Hospital de Clínicas de Porto Alegre (HCPA), Porto Alegre, Brazil

³Division of Medical Genetics, Sainte-Justine University Hospital, Research Center, Montreal, Canada

Introduction: Mucopolysaccharidosis type IIIC (MPS-IIIC) is an autosomal recessive genetic disease caused by mutations in the heparan sulfate acetyl-CoA:α-glucosaminide N-acetyltransferase (HGSNAT ) gene. Sixty-three mutations described so far alter the production and/or activity of the HGSNAT enzyme, leading to the accumulation of heparan sulfate in the lysosome. Previously (Martins et al, in Proc. 12th International symposium on MPS and related diseases, Noordwijkerhout, the Netherlands, 2012), we analyzed molecular defects in 8 Brazilian patients diagnosed clinically and biochemically with MPS-IIIC and found that >65% of the mutant alleles carried 4 mutations (c.234 + 1G>A, c.372-2A>G, c.525dupT, and p.S541L) previously identified in Portuguese patients, while the remaining presented 2 novel mutations, c.1348delG and p.N258I. Considering the major contribution of Portuguese immigrants to the Brazilian genetic pool, we hypothesized that the mutation spectrum of the Brazilian patients with MPS-IIIC could be due to founder effects. Objective: To test this hypothesis by haplotype analysis. Methods: Haplotypes were defined by 21 intragenic single-nucleotide polymorphisms in the HGSNAT gene. PHASE software (Chiago, Illinois) was used to infer the haplotypes. Besides the 8 Brazilian patients with MPS-IIIC, we also analyzed the haplotypes in the previously described patients carrying the same mutations (Hřebíček et al, 2006). The haplotypes of patients with MPS-III were compared with those reported in HapMap database (http://www.hapmap.org). Results: The haplotypes carrying the c.234+1G>A, c.372-2A>G, c.525dupT, and p.S541L mutations are observed in both Brazilian and Portuguese patients. Besides the c.525dupT mutation exclusively observed in Portuguese and Brazilian patients with MPS-IIIC, the haplotypes carrying the other 3 mutations are also observed in other populations. Conclusion: The presence and frequency of the mutations identified in the Brazilian patients with MPS-IIIC are likely due to founder effects. The c.525dupT mutation was most likely introduced in Brazil by Portuguese immigrants and possibly also the c.234+1G>A, c.372-2A>G, and p.S541L mutations.

1207 - Deep Genotyping of the Iduronate 2-sulfatase Gene in Colombian Patients With Hunter Syndrome

Johanna Galvis¹, Jannet Gonzalez², Alfredo Uribe³, and Harvy Velasco¹

¹National University of Colombia, Bogota, Colombia

²Pontifical Xavierian University, Bogota, Colombia

³University of Los Andes, Bogota, Colombia

Introduction: Mucopolysaccharidosis type II (MPS-II) also known as Hunter syndrome is an X-linked disorder caused by mutations in the iduronate 2-sulfatase (IDS) gene, an enzyme that catalyzes the initial step in the catabolism of heparan and dermatan sulfate. Mucopolysaccharidosis type II has significant allelic heterogeneity that limits the establishment of genotype–phenotype correlations. This study assessed the clinical features in conjunction with deep genotyping in a group of Colombian patients with MPS-II and attempted to establish a degree of genotype–phenotype correlation by employing bioinformatic tools. Methods: Eighteen Colombian patients were included after obtaining informed consent. Clinical features including IDS activity were registered for analysis. For genotyping, 3 different molecular methodologies were applied (multiplex ligation-dependent probe amplification, direct exonic sequencing, and restriction fragment length polymorphisms), which used genomic DNA from each patient. Results: In this group of patients, 11% were non-neuronopathic and 89% were neuronopathic. A total of 13 mutations were identified, of which 6 were novel (c.548_564dup16, c.477insT, c.595_607del12, c. 549_562del13, c.182delC, and a complete deletion of exon 7). The frequency of common mutations (R468Q, Q465X, K347Q, K236N, S71N, R88H, and a conversion phenomenon) was 53.85%. Molecular docking was performed on the wild-type and mutant IDS, finding changes in the enzyme–substrate interaction for the mutant IDS. Conclusion: Age at diagnosis was similar to that reported in the literature. By employing the 3 methodologies, the genotyping showed a sensibility of 100%. The frequency of novel mutations (46.15%) is similar to what has been reported elsewhere. The S71N mutation was frequent among the attenuated phenotype, while private frameshift mutations and rearrangements were seen in patients with severe phenotypes. The use of bioinformatic tools was of great utility to predict the repercussions of different mutations on the tridimensional structure of human IDS. However, given a small sample, the phenotype–genotype was not feasible; hence, larger group study samples are required.

1211 - Analysis of Nonpathogenic Alterations of the GNPTAB gene in the Brazilian population

Ida Vanessa Schwartz¹, Vitor Bertolozzi Mendes¹, and Fernanda Ludwig Sperb¹

¹UFRGS, Porto Alegre, Brazil

Introduction: Mucolipidoses II and III (ML II and III) are autosomal recessive lysosomal disorders in which the essential mannose 6-phosphate recognition marker system is deficient. Objective: To evaluate the frequency of nonpathogenic variations in N-acetylglucosamine-1-phosphate transferase, α and β subunits (GNPTAB) gene in healthy controls. These variants have been previously described in Brazilian patients with ML II and III α/β. Methods: DNA was extracted from peripheral blood of 100 anonymous healthy donors using the Easy DNA kit (Invitrogen). Ten intragenic polymorphisms have been analyzed (-41_-39delGGC, c.18G>A, c.27G>A, c.323+20delT, 365+96_97delGT, c.365+145C>T, c.1285-166G>A, c.1932A>G, c.3135+5T>C, and c.3336-25T>C). Results: Until now, analysis of 4 polymorphisms has been completed: c.365+96_97delGT (allele frequency = 43.5%, intron 4), c.365+145C>T (allele frequency = 46%, intron 4), c.1285-166G>A (allele frequency = 64%, intron 10), and c.3336-25T>C (allele frequency = 44.5%, intron 17). The other polymorphisms are still under analysis. Conclusion: This series is the most extensive in terms of the number of polymorphisms analyzed for ML II and III. Based on the results, the GNPTAB gene proved to be quite polymorphic. The most frequent alteration was c.1285-166G>A (intron 10). It is important to emphasize the study of polymorphisms, because polymorphisms enable us to evaluate the linkage disequilibrium of these alterations, generate haplotype analyses, and determine the origin of mutations. Support: CNPq, FAPERGS, and FIPE-HCPA.

1216 - A Novel Disease Causing Mutation of Iduronate 2-sulfatase Gene in 2 Independent Families From Colombian Southwestern Region

José M. Satizabal¹, Adalberto Sanchez¹, and Lina J. Moreno²

¹Universidad del Valle, Escuela de Cencias Básicas, Valle Del Cauca, Colombia

²Universidad del Valle Departamento de Pediatría Genomics, Valle Del Cauca, Colombia

DNA sequencing of iduronate 2-sulfatase (IDS) gene was performed on 2 independent families with members having Hunter disease. An unreported mutation that creates a shift in the reading frame at codon D190 in exon 5 of IDS gene was detected. The new frame ends in a stop codon at position 8 downstream. Bioinformatics analyses were performed using PolyPhen-2 and SIFT software packages. This mutation likely results in either a truncated protein or the loss of protein synthesis. The mutation c.566dupT leads to a change in p.D190Gfs*9 on IDS protein. Fluorometry assays of iduronate 2-sulfatase activity on a young male with Hunter disease showed a pathological decreasing. A functional study would be performed to confirm pathogenic association.

6. Quality of Life/Pshycosocial

1010 - Bowen Oliver—A Life in Reflection

David Oliver¹

¹Hornsby Heights, Sydney, Australia

Bowen Oliver was a friendly, generous, and positive young man whose friendship greatly improved the lives of those around him. Diagnosed with mucopolysaccharidosis type VI (MPS-VI) at age 5, Bowen was fortunate to commence enzyme replacement therapy (ERT) at age 9, thanks to the work of the Adelaide LDRU team, and this treatment opened up the possibility of a full and wonderful life. His health improved following the commencement of ERT, enabling him to thrive through high school and enter university to study writing, international relations, and politics. Along the way, Bowen gathered a great group of friends around him and found joy in reading books, in watching cinemas, and in photography. For many in the Australian MPS community, Bowen was both a friend and an example of what could be achieved in life despite the obstacles of MPS. Bowen succumbed to a seizure at age 20, just as he was launching into his adult life and enjoying all of the adventures that come with it. This poster is a reflection of Bowen’s life, through his own words, and the words of his family and friends who knew and loved him. It seeks to show just how special he was and how meaningful his contribution to this world truly was.

1066 - Assessment of the Relevance of Quality-of-Life and Activities-of-Daily-Living Questions in Patients With Morquio A Syndrome (MPS-IVA) and Primary Carers: A Focus Group Approach

Christine Lavery¹, Larisa Mihoreanu², and Mohit Jain²

¹Society for Mucopolysaccharides Diseases, Amersham, United Kingdom

²BioMarin Europe Ltd, London, United Kingdom

Objectives: To assess the relevance of patient-reported outcome and activities of daily living tools in capturing the impact of Morquio A syndrome on patient’s quality of life and functional ability. Methods: This study was undertaken to inform a “Morquio A Burden of Illness Study.” Three focus groups of patients (N = 6) and caregivers (N = 8) were asked to assess the relevance of questions taken from the 5-level version of European QoL-5 Dimensions (EQ-5D-5L) questionnaire, mucopolysaccharidosis Health Assessment Questionnaire (MPS-HAQ), Zarit Burden Scale (ZBS), the Brief Pain Inventory Short Form (BPI-SF), and the Adolescent Pediatric Pain Tool (APPT). Results: Patients with Morquio A syndrome report constant challenges in life related to mobility, pain, fatigue, and an environment poorly adapted to their needs. Patients felt a quarter of the questions in the self-care domain of the MPS-HAQ were neither relevant nor specific in capturing the impact of the disease on self-care activities. However, questions in both the mobility and caregiving domains were deemed more specific and relevant. These patients’ perspectives bring more insight into understanding the tests’ results and their relevance in capturing the benefit of the treatment. Although patients felt the generic and widely used EQ-5D-5L was nonspecific to Morquio A, the domains assessed were deemed to capture the relevant parameters. The pain tools (BPI-SF and APPT) were considered to be appropriate, but patients struggled to objectively respond to the questions due to difficulties in remembering living without pain. Caregivers felt that ZBS did not capture the impact on many areas of their daily caring activities such as the financial, family, and personal burden of caregiving and the overwhelming feeling of guilt associated with losing personal time. Conclusion: The focus group highlighted the patient relevance of questions. Patient focus groups are recommended in developing any “burden of illness study.” Conflicts of Interest: Christine Lavery received financial support in person or by the Society for Mucopolysaccharide Diseases from BioMarin in the following capacities: participant on advisory board, patient access program for clinical trials, travel grants, and unrestricted educational grants. Mohit Jain received financial support/salary as employee of BioMarin. Larisa Mihoreanu received financial support/salary as employee of BioMarin.

1101 - A Workshop for Children With Lysosomal Storage Disorders and Their Parents

Shauna A. Kearney¹ and Robert N. Jobe¹

¹Birmingham Children’s Hospital, Birmingham, United Kingdom

Objectives: (1) To explore children’s understanding of their lysosomal storage disorder (LSD), the impact this has, and their feelings about this and (2) to explore the impact of caring for a child with an LSD, including mucopolysaccharidosis (MPS) disorders. Methods: (1) Two clinical psychologists facilitated parallel workshops for children, siblings, and their parents; (2) diagnoses included MPS-I, MPS-IV, MPS-VI, and Pompe disease; (3) 2 males, 4 females, 2 siblings, and 5 parents; (4) age range 7 to 12 years; (5) content included worksheets, group discussion, and role-play; (6) topics included are “me and my condition, things I can/cannot do, identifying and working with feelings”; (7) common themes were extracted from the analysis of group discussions; (8) parents shared their experiences, challenges, and what helped; and (9) participants formed a collage of “a tree and leaves” to provide feedback about the group. Results: The following themes emerged: (1) children had a superficial (age appropriate) understanding of their disorder and did not want to know more; (2) feeling different and restricted in activities; (3) desire to have fun; (4) social isolation/wanting friendships; (5) parents experienced grief after diagnosis, guilt, social isolation, pressure on time, and concerns about siblings; (6) maternal resilience and practical help influenced family functioning; (7) without exception, the children enjoyed the group, with comments (on the collage) such as “this was amazing,” “I liked talking to others,” “I want to come again,” “it was nice letting my feelings out”; (8) parents enjoyed talking/listening to other parents, sharing their stress, and having the chance to reflect on their feelings. Conclusion: Mental health is essential to the quality of life of children with LSDs and their families. In running workshops of this nature, we provide the opportunity for emotional expression, education surrounding their condition, and emotional support. This workshop was very positively received by all involved and highlights the need to remain vigilant to the psychological needs of these families. Conflicts of Interest: Shauna Kearney has received study grants and travel costs from Shire, Biomarin, Genzyme, and Merck Serono. Neither Shauna Kearney nor Robert Jobe have any conflicts of interest to disclose.

1104 - The Psychosocial Aspects of Morquio A Syndrome (MPS-IVA)—A Patient-Reported Survey

Christian J. Hendriksz¹, Christine Lavery², Christina Lampe³, Lisa Bell⁴, Andrew Olaye⁵, and Mohit Jain⁵

¹Manchester Academic Health Science Centre, Salford Royal Foundation NHS Trust, Salford, United Kingdom

²The Society for Mucopolysaccharide Disease, Amersham, United Kingdom

³Villa Metabolica, Center of Pediatric and Adolescent Medicine, Mainz, Germany

⁴BioMarin Pharmaceutical Inc, San Rafael, CA, USA

⁵BioMarin Europe Ltd, London, England

Objectives: To assess the psychosocial burden of Morquio A syndrome among adults and children. Methods: A patient-reported outcome survey was undertaken in United Kingdom, Turkey, Spain, Germany, Brazil, and Colombia to assess the burden of Morquio A among adults (≥18 years, N = 27) and children (5-17 years, N = 36). The psychosocial burden of Morquio A was assessed by measuring disease impact on patient’s social life, emotional and psychological well-being, employment, and education using Likert-type response scales. Results: The psychosocial impact of Morquio A in adult patients varied with wheelchair status. Patients not using wheelchairs (NWCs) reported greater optimism, independence and motivation than patients using wheelchairs only when needed (SWCs) or always (AWCs). Patients NWCs had higher employment rates; lower social, emotional, and psychological impacts on employment and education; and less difficulty in integrating with peers and maintaining friendship. Patients SWCs reported the highest levels of anger, demotivation, frustration, and depression. Patients SWCs had the greatest difficulties in beginning and maintaining relationships and highest emotional and psychological impact on their employment. Patients AWCs had greater confidence, less frustration, and anger than patients NWCs and SWCs. Patients AWCs had less difficulty in beginning relationships, were more driven in attaining their career goals, and focused less on the medical impact of their disease. These findings suggest that after an initial adaptation period, wheelchair users become more determined as their disease progresses. Among children, those NWCs enjoyed better social relationships and participated in more physical activities but had greater levels of exhaustion, less support at school, and more missed school days than the wheelchair users. Conclusion: Actively mobile adult patients with Morquio A experience more independence, increased employment rate, and reduced emotional and psychological burden of the disease. In children, increased independence results in greater social contact but less structured school assistance and more missed school days. Conflicts of Interest: (1) Christian Hendriksz received consulting fees from BioMarin. Consultancy for patient organizations, EMEA—paid travel grants to deliver lectures paid for by patient organizations; (2) Christine Lavery received an unrestricted educational grant. MPS Society received an unrestricted educational grant to support a patient carer workshop in respect of this study. Christine Lavery did not receive any payment personally; (3) Christina Lampe received travel support from BioMarin and speaker’s fee; (4) Lisa Bell is a paid employee and holds stocks of BioMarin Pharmaceutical Inc; (5) Andrew Olaye is a paid employee and holds stocks of BioMarin Europe Ltd; (6) Lisa Bell is a paid employee and holds stocks of BioMarin Europe Ltd.

1218 - Development of a Specific Questionnaire for Quality of Life of Patients With Mucopolysaccharidosis

Nicole Ruas Guarany¹, Neusa Sica da Rocha², Marcia Gonçalves Ribeiro², Heber de Souza Maia Filho³, and Ida Doederlein Schwartz²

¹Universidade Federal de Pelotas, Capão do Leão, Brazil

²Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

³Universidade Federal Fluminense, Niterói, Brazil

Introduction: Mucopolysaccharidosis (MPS) have different clinical manifestations that have impact on the quality of life (QOL). So far, there are no specific instruments to assess the QOL of these patients. Objectives: To present the psychometric properties of the field test of the MPS-QOL for the 3 versions: 8 to 12 years, 13 to 17 years, and >18 years. Methods: A controlled study with convenience sampling was performed with 144 Brazilian patients having different types of MPS, age ≥8 years, with or without cognitive impairment, receiving, or not, enzyme replacement therapy (ERT), and 72 patients with other genetic diseases (osteogenesis imperfecta, Gaucher disease, and phenylketonuria), were evaluated. For both groups, the versions of MPS-QOL and generic instruments for assessing QOL (WHOQOL-BREF-DIS and PedsQOL) were applied. Frequency analysis of the data was performed using analysis of ceiling, floor effect, and missing data for MPS-QOL items; internal reliability using Cronbach α; convergent validity between the MPS-QOL and the generic QOL instruments using the Spearman correlation test; and discriminant validity between the variables of interest and the MPS-QOL questionnaires through the Mann-Whitney U test. Results: The frequency analysis of the questions indicated the exclusion of the generic questions (ceiling effect). The Cronbach α coefficient was higher than .70 for the 3 questionnaires. The convergent validity indicated that there is a higher correlation between MPS-QOL questionnaires than among generic QOL instruments (patients with MPS). The discriminant validity showed that MPS-QOL was able to discriminate the differences between the questionnaires by proxy, sex, type of MPS, group of patients, and treatment by ERT. Conclusion: The results indicate that the MPS-QOL questionnaires are appropriate, valid, and reliable when compared to generic instruments. The use of these tools can help identify changes in QOL of patients with MPS, being a possible marker of disease progression or clinical outcomes as specific treatments or supportive therapies.

1219 - Mucopolysaccharidosis: Quality of Life of Caregivers

Nicole Ruas Guarany¹, Matheus Wilke², Ana Paula Vanz³, and Ida Doederlein Swartz²

¹Universidade Federal de Pelotas, Capão do Leão, Brazil

²Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

³Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

Introduction: Mucopolysaccharidosis (MPS) is a group of rare genetic diseases caused by the deficiency of specific enzymes involved in glycosaminoglycans (GAGs) catabolism. The accumulation of GAGs in the body causes multisystemic abnormalities. The quality of life (QOL) is related to physical, mental, and emotional well-being, and social relationships. A caregiver is anyone who supports or takes care of someone who is ill or incapacitated, and in most cases, that person is a family member who is asked to provide most of the care. Objectives: The aim of the study was to evaluate the QOL of caregivers of patients with MPS. Methods: Cross-sectional study, convenience sampling comprised mothers of patients with MPS seen at the Medical Genetics Service, Hospital de Clínicas de Porto Alegre (HCPA), Brazil. WHOQOL-BREF was used for assessing QOL; its scores range from 0 (worst) to 100 (best). Results: This study included mothers of 13 patients with MPS (MPS-I = 1, MPS-II = 5, MPS-IIIA = 1; MPS-IIIB = 2, MPS-IVA = 3, and MPS-VI = 1), and 2 mothers had more than 1 affected child (1 family with MPS-II and 1 with MPS-IVA, respectively). The average score was 46.59. Considering the total sample, the physical domain showed the highest score (mean = 54.9) and the environmental ones showed the worst score (mean = 34.11). Mothers of children with MPS-II showed the lowest QOL, with an average of 44.62 points. Conclusion: These data suggest that the QOL of mothers of patients with MPS is compromised. The lowest QOL of mothers of individuals with MPS-II seems to be related to a more severe symptomatology and greater need for help in daily activities. Studies with larger sample sizes should be conducted to confirm our findings.

1221 - Case Study: Assessing Psychosocial Patient With a Diagnosis of Mucopolysaccharidosis Type I

Petruska O. B. Pereira¹, Izabel C. N. Souza¹, Raimunda H. F. Feio¹, and Maiana A. Reis¹

¹Hospital Universitário Bettina Ferro de Souza (HUBFS) – UFPA, Pará, Brazil

In order to perform psychosocial assessment of patients with mucopolysaccharidosis type I, the Behavioral Inventories from Aseba Patterns and the Test of Nonverbal Intelligence SON were used as instruments, which were applied to their guardians. The reports were applied annually in the period between 2009 and 2013. The results of the tests varied in their applications, with indicators of clinical and borderline scores on items psychosocial and activities. Generally, the patient had more scores for depression, as well as alternations in intelligence scores, indicating different intelligence quotient coefficients level, below the average and normal, what indicates problems in school learning. The existence of treatment evasion in neurogenetics clinic, psychological service, and enzyme replacement therapy (ERT), in periods of depression, must be considered. The discontinuation of clinical follow-up and infusion possibly reflected in the quality of life, worsening health status and well-being, characterized by respiratory problems such as chronic rhinitis and motor worsening, with repercussions on joint motion of hands and wrists. We can consider that the patient has reported normal scores (average, 79%), indicating positive effects during ERT. An impact of this therapy in this patient’s life is clearly the control of respiratory infections and motor skills as well as positive coefficients that appear in Behavioral Tests and Intelligence Tests. Therefore, ERT associated with clinical follow-up allowed patients’ social living and their cognitive and social skills.

7. Enzyme Replacement Therapy

1006 - Mucopolysaccharidosis Type VI—Treatment With Galsulfase: Our Experience

Jorge Sales Marques¹, Dalila Rocha¹, Vera Rocha², and Helena Santos¹

¹Centro Hospitalar Vila Nova De GAIA/ESPINHO, Vila nova de Gaia, Portugal

²Centro Hospitalar do Tâmega e Sousa, Penafiel, Portugal

Introduction: Mucopolysaccharidosis type VI (MPS-VI) is an autosomal recessive disorder. The deficient enzyme is arylsulfatase B. Galsulfase is the replacement therapy. In our 14-year-old boy who was diagnosed with MPS-VI at 15 months of age, we checked clinical improvement during the treatment with galsulfase that began when he was 8 years old. Methods: The data analyzed were weight, height, head circumference, growth velocity, body mass index, coarse face, umbilical hernia, inguinal hernia, hepatomegaly, hip dislocation, spinal cord compression, carpal tunnel syndrome, heart, lungs, vision and eye fundi, hearing, endurance test, psychomotor development, and glycosaminoglycans (GAGs) in urine. Results: The height/weight and head circumference maintained the same percentile, but the body mass reduced. The growth velocity was also the same. No change was observed in his coarse face appearance. Due to umbilical hernia and bilateral hip dislocation, he had to undergo surgery 3 times, and after galsulfase therapy, no more relapse was observed. The patient was operated for inguinal hernia before we started the enzyme therapy. Hepatomegaly reduced from 6 to 3 cm. The patient had spinal cord compression and carpal tunnel syndrome. Electrocardiogram was normal. Heart ultrasound improved from thick mitral and aortic valve to normal structure. Forced expiratory volume in 1 second (FEV1)/FEV ratio increased from 85% to 97%. His eyes still had moderate hipotransparency of the cornea. Hearing change was observed, that is, from transmission hearing loss caused by hypertrophy of the adenoids to normal sounds after surgery. In the 12-minute walk, he showed improvement and walked 575 m and he also finished the test. In the the 3-minute stairs climb, he climbed 6 more stairs. No improvement in development quotient was observed. The GAGs reduced during the treatment. Conclusion: Our case showed that galsulfase improves patient’s resistance, function of heart and lungs, avoiding relapse of hip dislocation and umbilical hernia and reducing liver size. It did not change the evolution of other severe complications probably because the treatment started at the age of 8 years. What remains open is, if galsulfase was started right after the diagnosis, the evolution of the clinical picture of our patient would be different?

1014 - Galsulfase for Mucopolysaccharidosis Type VI: Analysis of Clinical Data Since 2000

Paul Harmatz¹, Christian Hendriksz², Roberto Giugliani³, Elizabeth Braunlin⁴, and Adrian Quartel⁵

¹Children’s Hospital & Research Center Oakland, Oakland, CA, USA

²Birmingham Children’s Hospital NHS Foundation Trust, Birmingham, United Kingdom

³Department of Genetics/UFRGS and INAGEMP, Medical Genetics Service/HCPA, Porto Alegre, Brazil

⁴Pediatric Cardiology, University of Minnesota, Minneapolis, MN, USA

⁵BioMarin Pharmaceutical Inc, Novato, CA, USA

Objective: To summarize the efficacy and safety data of galsulfase (Naglazyme; BioMarin Pharmaceutical Inc, Novato, California) in mucopolysaccharidosis type VI, a disorder caused by N-acetylgalactosamine-4-sulfatase deficiency. Methods: Summarized data reported on the effect of galsulfase on endurance, cardiopulmonary function, growth, survival, and immunogenicity from clinical trials, 10-year follow-up (Resurvey Study) and clinical surveillance program. Results: Endurance parameter in the 12-minute walk test (12MWT) showed significant improvement in mean walk distance of 92 m at week 24 over placebo (clinical trials). After 6.8 years on enzyme replacement therapy (ERT), patients (n = 46) walked a mean of 65.7 m more (in 6MWT) compared to baseline (Resurvey Study). Forced vital capacity (FVC) increased by 17% (n = 33); and forced expiratory volume in 1 second (FEV1) increased by 11% at 96 weeks (n = 33; clinical trials). After 6.8 years of ERT, patients <13 years showed an increase in FVC by 68% (n = 26) and in FEV1 by 55% (n = 25), and those ≥13 years showed an increase in FVC by 12.8% (n = 22) but FEV1 was maintained (n = 22; Resurvey Study). Left ventricular function remained normal and intraventricular septal hypertrophy decreased after 96 weeks. Mitral valve stenosis/regurgitation and aortic valve stenosis remained unchanged from baseline; aortic regurgitation increased but severity increased from trace to mild. Growth rates improved in patients who started ERT at <6 years of age compared to the MPS-VI growth curves; the largest improvement was seen in rapidly progressing patients who started treatment at <3 years of age, showing a mean additional growth of >10 cm at 5 years of age. Treated patients had a 16.5% (17 of 103) mortality rate compared to 50% (7 of 14) in untreated patients. Seroconversion did not correlate with incidence of adverse event (AE) or serious adverse event (SAE) or decreased efficacy. Incidence of AEs or SAEs has not changed since commercial availability of galsulfase. Infusion-associated reactions occurred in >50% of patients but were manageable with premeditations and/or altering ERT infusion rates. Conclusion: Available data support galsulfase safety and demonstrate improvement in endurance, cardiopulmonary function, growth, and long-term survival. Conflicts: Author Quartel is an employee and stockholder of BioMarin. All other investigators provided consulting services, received research grants, and participated in advisory board meetings and received speaker honoraria and travel support from BioMarin Pharmaceutical Inc. This study was supported by BioMarin Pharmaceutical Inc and, in part, with funds provided by the National Institutes of Health/National Center for Research Resources (NIH/NCRR) CTSA grant UL1RR024131 (Dr Harmatz).

1018 - Impact of Long-Term Galsulfase Treatment on Survival of Patients With Mucopolysaccharidosis Type VI

Roberto Giugliani¹, Christina Lampe², Nathalie Guffon³, David Ketteridge⁴, Elisa Leão-Teles⁵, James Wraith⁶, Simon Jones⁶, Cheri Piscia-Nichols, Ping Lin⁷, Adrian Quartel⁷, and Paul Harmatz⁸

¹Department of Genetics/UFRGS and INAGEMP, Medical Genetics Service/HCPA, Brazil

²Villa Metabolica, University Medical Center of the University of Mainz, Germany

³Hôpital Femme Mère Enfant, Bron, France

⁴Women’s and Children’s Hospital, North Adelaide, Australia

⁵Hospital Pediátrico Integrado, Centro Hospitalar de S. João, Porto, Portugal

⁶Manchester Centre for Genomic Medicine, St Mary’s Hospital, CMFT, University of Manchester, United Kingdom

⁷BioMarin Pharmaceutical Inc, Novato, CA, USA

⁸Children’s Hospital & Research Center Oakland, Oakland, CA, USA

Objective: To investigate the impact of long-term galsulfase (Naglazyme; BioMarin, Novato, California) enzyme replacement therapy (ERT) on survival of patients with mucopolysaccharidosis type VI (MPS-VI). Mucopolysaccharidosis type VI is a progressive genetic disorder caused by the deficiency of N-acetylgalactosamine-4-sulfatase. Patients with rapidly progressive disease generally do not live beyond their second to third decade of life, whereas those with slowly progressive disease may survive into their 30s and 50s. Pre-ERT urinary glycosaminoglycan (uGAG) levels of > and ≤200 µg/mg creatinine (assayed using Whitley et al [Clin Chem 1989] method) were used to define rapidly and slowly progressive disease (Swiedler et al, Am J Med Gen A 2005). Methods: Survival data were collected for 117 patients (ERT: n = 103; naive: n = 14) of the 121 patients who previously participated in a cross-sectional study in 2001 to 2002 (Swiedler et al, 2005) and compared by Kaplan-Meier (KM) analysis. Cox proportional hazard model was used to calculate ERT impact on survival and expressed as hazard ratio (HR) with 95% confidence interval (95%CI); the multivariate analysis included adjustments for baseline age and pre-ERT uGAGs. Results: Patients received ERT for 6.8 ± 2.2 years at 10-year follow-up. The observed mortality rate at follow-up was 16.5% (17 of 103) in the treated and 50% (7 of 14) in the naive patients. Results of KM analysis showed a significant separation (Log rank P = .0006), indicating an ERT survival benefit. The unadjusted HR was 0.24 (95%CI, 0.10-0.59) and adjusted HR was 0.11 (95%CI, 0.04-0.29). For patients with rapidly progressive disease, treated patients had improved survival with a mortality rate of 17.9% (12 of 67) compared to naive patients (85.7% [6of 7]). Mean age of the patients who died in the treated and untreated groups was similar (15.4 ± 12.4 vs 14.4 ± 13.5 years) in spite of the difference at baseline (13.7 ± 9.8 vs 19.8 ± 12.8 years). Of the patients who died, treated patients had an overall survival of 7.5 compared to 4.8 years for untreated patients. Conclusion: Long-term galsulfase ERT is associated with improved survival of patients with MPS-VI. Conflicts: Authors Quartel and Lin are employees and stockholders of BioMarin; Piscia-Nichols is a former employee of BioMarin. All other investigators provided consulting services, received research grants, and participated in advisory board meetings and received speaker honoraria and travel support from BioMarin Pharmaceutical Inc. This study was supported by BioMarin Pharmaceutical Inc and, in part, with funds provided by the National Institutes of Health/National Center for Research Resources (NIH/NCRR) CTSA grant UL1RR024131 (Dr Harmatz).

1025 - The Improvement in CNS Defects in MPS-II Mouse Via Systemic High-Dose Enzyme Replacement Therapy

Sung Yoon Cho¹, Youn Bae Sohn², Dong-Kyu Jin³, and Ah-Ra Ko⁴

¹Samsung Medical Center, Seoul, Republic of Korea

²Department of Medical Genetics, Ajou University Hospital, Suwon, Korea

³Department of Pediatrics, Samsung Medical Center, Seoul, Korea

⁴Clinical Research Center, Samsung Biomedical Research Institute, Seoul, Korea

Introduction: Mucopolysaccharidosis type II (MPS-II), also known as Hunter syndrome, is a rare, X-linked lysosomal storage disorder caused by a deficiency of iduronate-2-sulfatase (IDS), which is involved in the lysosomal degradation of glycosaminoglycans (GAGs). Patients with MPS-II have a variety of symptoms that affect all organs and may cause progressive cognitive impairment. Although intravenous enzyme replacement therapy (ERT) is available, amelioration of central nervous system (CNS) defect by ERT is limited by the blood–brain barrier. Therefore, it is important to simultaneously treat the visceral and CNS defects in the patients with MPS-II. This study was performed to investigate responses in brain to high doses of systemic infusion of recombinant human IDS (rh-IDS) in mice. Methods: High dose of systemic ERT was given in 3 different doses (1, 5, and 10 mg/kg weekly) of rh-IDS for 3 different durations (1 month, 3 months) to MPS-II mice of 2 different age (2-month-old and 8-month-old). Analysis of brain tissue including GAG measurement, IDS activity assay, brain pathology, and immunohistochemistry was performed. In addition, behavioral assessment by footprint pattern analysis and Y-maze test was performed. Results: High dose of systemic ERT allowed the IDS to reach the brain, with the substantial correction of the CNS phenotype and neurobehavioral features. Conclusion: Central nervous system defects of MPS-II mice can be treated by systemic ERT, providing the potential for development of an effective treatment for patients with MPS-II.

1033 - Mucopolysaccharidosis Type I: Long-Term Follow-Up of Safety and Effectiveness of Enzyme Replacement Therapy in 10 Argentinean Patients

Norberto B. Guelbert¹, Adriana B. Becerra¹, Alicia N. Giner¹, Nidia Azar¹, Nadia A. Gomez¹, Sandra L. Antonozzi¹, Andrea Delgado¹, and Guillermo A. Guelbert¹

¹Servicio Enfermedades Metabólicas Hospital de Niños de Cordoba, Córdoba, Argentina

Introduction: The mucopolysaccharidosis type I (MPS-I) is a multisystemic autosomal recessive lysosomal disorder caused by deficiency of α-l-iduronidase. It has a broad spectrum of clinical severity divided into 3 syndromes, Hurler (H-severe), Hurler-Scheie (HS-moderate), and Scheie (S-mild), varying the speed of progression and extent of multisystem manifestations and neurodegenerative disease. Objective: To evaluate the safety and efficacy of enzyme replacement therapy (ERT) in a group of MPS-I in Argentina during an average period of 6.8 years. The series consisted of 10 patients with MPS-I, 4 H-severe and 6 HS-mild, 3 women and 7 men belonging to 8 not related families. All had typical manifestations of the disease, and the diagnosis was confirmed by the deficiency of α-l-iduronidase in dried blood spot in filter paper and leukocyte pellet. Other studies are brain and cervical spine magnetic resonance imaging, abdominal ultrasound, echocardiography, measurement range motility, polysomnography, and quantitative urinary excretion of glycosaminoglycans (GAGs) by spectrophotometric method (DMB). At the time of ERT (on average 6.8 years), we observed reduction in hepatosplenomegaly and improvement in cardiomyopathy besides increase in weight and height, disappearance of nocturnal apneas and rhinorrhea, and normalization of urinary GAGs. No change was observed in flexion contractures of the joints, but exercise testing (6-minute walk test and 3-minute stair climb) was normal. We found no improvement in heart valves and corneal clouding. Three H patients stopped the ERT after 3 months and went through successful bone marrow transplant. Conclusion: Our findings showed that ERT reduced lysosomal GAG storage, which was evidenced by the decrease in urinary excretion of dermatan and heparan sulfate. There was a significant improvement in the quality of life of patients and their families. We have not recorded adverse reactions in any case.

1037 - Decentralization of Drug Treatment (Enzyme Replacement Therapy) in Mucopolysaccharidosis

Ana Carolina Esposito¹, Anneliese Lopes Barth¹, Daniela Koeller Rodrigues Vieira¹, Celma Dias Maciel¹, Esther Nunes Platenik¹, and Dafne Dain Gandelman Horovitz¹

¹IFF/Fiocruz, Rio de Janeiro, Brazil

Introduction: In Brazil, most patients with mucopolysaccharidosis are followed by reference centers, where they receive the weekly infusions of enzyme replacement therapy (ERT). Objectives: To discuss the possibility of decentralization of ERT in patients with MPS, in order to help them receive the infusions near home. Methods: Patients with MPS types I, II, and VI, followed by the Department of Genetics, Instituto Fernandes Figueira (IFF/Fiocruz), and on ERT, were selected. We evaluated the medical records and conducted interviews with the families, in order to understand the transportation facilities of patients who lived away from the treatment center and what families and health staff thought of decentralization. Results: The first ERT in IFF/Fiocruz was in 2004, in a patient with MPS-I; it was administered weekly in the pediatric inpatient ward. In December 2007, the outpatient center for venous infusions was inaugurated, with 5 patients receiving ERT (2 MPS-I and 3 MPS-VI). Currently, 17 patients on ERT were being followed in our institution, comprising 4 with MPS-I, 5 with MPS-II, and 8 with MPS-VI. In all, 13 receive infusions in our center, while 2 with MPS-II and 2 with MPS-VI are decentralized, receiving infusions in the city where they live. Before decentralization, local teams were trained by IFF professionals, and all continue to have a periodic clinical monitoring at IFF. Conclusion: With the advances in the diagnosis of rare diseases and identification of new patients with MPS, discussion regarding decentralization for the intravenous infusions becomes necessary, as long distance travel to the reference center becomes a burden, leading to interference in the maintenance of treatment. Families and health staff agree that decentralization improves the quality of life of patients and families. This study was supported by Biomarin, Genzyme, and Shire.

1040 - A Mongolian Child Case of a Family With Mucopolysacchoridosis Type II, Hunter Syndrome

Jane Collette Roberts¹, Simon A Jones¹, Sarah Phillippo¹, Clare Hamilton-Kay¹, and Jean Mercer¹

¹Manchester Centre for Genomic Medicine, Manchester, England

Objectives: To discuss adverse events potentially linked to the repeated use of topical anesthetic creams on port sites used for enzyme replacement therapy (ERT). Lysosomal storage disorders (LSDs) are a group of rare inherited metabolic disorders caused by a lysosomal enzyme deficiency. Some LSDs now have licensed ERT, which are administered as a weekly/biweekly infusion. As regular intravenous access is required, topical anesthetic creams are often used to reduce pain. Many of these children will need intravenous port insertion due to poor venous access, young age, or needle phobia. In Manchester, 2 types of local anesthetic creams are commonly used, Ametop Gel and Emla cream. For older children or for children who find the application of the cream upsetting, ethyl chloride spray can be used (Cryogesic). Methods: Through regular inspection, we have identified a growing problem with skin integrity on the port sites upon the repeated use of anesthetic creams, with dimpling, bruising, and thinning of the skin. The black septum of the port device can appear through the skin due to the dermis becoming thin and transparent, mimicking a bruise. Over the last 4 years, 7 of the 64 ports have been adversely affected. All 7 patients had been receiving weekly ERT. Results: In one case, the septum of the port had completely eroded through the skin on the chest wall as the usage of weekly Ametop Gel at home was inappropriate, resulting in a full thickness dermal burn. To date, 5 of the 7 ports have required removal/replacement following visualization of the septum and/or dimpling, scab formation. One child developed a Cryogesic burn, which healed uneventfully, and another port is under weekly review. Conclusion: Further data are required from other comparable centers to understand the rationale behind these adverse events to capture common reactions and provide recommendations to prevent future incidences and multiple port replacements in this vulnerable group of patients.

1042 - Induction of Immune Tolerance in Patients With Mucopolysaccharidosis Type I Initiating Enzyme Replacement Therapy With Aldurazyme

Roberto Giugliani¹, Petr V. Novikov², Susan Richards³, Gerald F. Cox³, and Yong Xue³

¹Department of Genetics UFRGS and INAGEMP, Medical Genetics Service/HCPA, Porto Alegre, Brazil

²Department of Clinical Genetics, Moscow Research Institute for Pediatrics and Children Surgery, Moscow, Russia

³Genzyme, a Sanofi company, Cambridge, MA, USA

Objectives: Mucopolysaccharidosis type I (MPS-I) studies in dogs have shown that antibodies to laronidase (Aldurazyme; Genzyme, Cambridge, Massachusetts) affect its biodistribution and ability to clear glycosaminoglycans (GAGs). In patients with MPS-I, the high antibody titers correlate with less urinary GAG reduction but not with clinical response. This study was designed to determine whether an immunosuppressive regimen that induced immune tolerance in dogs could be used in patients with MPS-I. Methods: This open-label clinical trial (NCT 00741338) in patients with severe MPS-I (≤5 years of age) included a tolerance induction period followed by an immune challenge period (ICP). The immunosuppressive regimen consisted of cyclosporine A, azathioprine, and low-dose weekly Aldurazyme (0.058 mg/kg). Following gradual discontinuation of immunosuppressants, patients received full-dose Aldurazyme (0.58 mg/kg) for a total of 24 weeks. Immune tolerance was defined as an anti-laronidase immunoglobulin G (IgG) antibody titer ≤1:3200 at the end of the ICP. A sequential adaptive design allowed for modification of the immune tolerance regimen in a second patient cohort if the initial regimen was unsuccessful (<2 of the 3 patients were immune tolerant). Safety evaluations focused on signs of infection or organ toxicity, blood pressure elevation, and bone marrow suppression. Results: None of the 3 patients in cohort 1 and 1 of the 3 patients in cohort 2 achieved immune tolerance. A second patient in cohort 2 maintained a low IgG titer after 17 weeks of full-dose Aldurazyme but discontinued the study due to infusion-associated reactions and was considered a treatment failure. Cyclosporine A levels varied and required frequent monitoring and dose titration. No deaths or other significant adverse events were reported. Conclusion: The results of the study are inconclusive. The risk, benefit, and feasibility of immune tolerance induction should be reconsidered in patients with MPS-I. This study was supported by the Genzyme/BioMarin Joint Venture.

1043 - Follow-Up Study of Developmental Quotient in the Patients With Mucopolysaccharidosis Type II Severe Form Under the Treatment of Enzyme Replacement Therapy and Hematopoietic Stem Cell Transplantation

Akemi Tanaka¹, Takashi Hamazaki¹, Torayuki Okuyama², Yasuyuki Suzuki³, Norio Sakai¹, Motomichi Kosuga², Michiko Shinpo¹, Hiromasa Yabe⁴, Mika Ishige⁵, Tomo Sawada⁶, Ryioji Kobayashi⁷, and Ken Tabuchi⁸

¹Osaka City University Graduate School of Medicine, Osaka, Japan

²National Center for Child Health and Development, Tokyo, Japan

³Gifu University Graduate School of Medicine, Gifu, Japan

⁴Tokai University School of Medicine, Tokyo, Japan

⁵Nippon University School of Medicine, Tokyo, Japan

⁶Izumi City Hospital, Gushikawa City, Japan

⁷Sapporo Kitanire Hospital, Sapporo, Japan

⁸Komagome Hospital, Tokyo, Japan

Objective: To analyze the course of developmental quotient (DQ) in patients with mucopolysaccharidosis type II (MPS-II) on either enzyme replacement therapy (ERT) or hematopoietic stem cell transplantation (HSCT) to evaluate the efficacy on brain function. Methods: We collected the DQ records of patients with MPS-II severe form who received HSCT and those who received ERT. Patients were divided into 2 clinical phenotypes according to the onset of developmental delay: type C (delay after 2 years of age) and type D (delay before 2 years of age). Numbers of patients in each group were 15 (HSCT, type C), 15 (HSCT, type D), 9 (ERT, type C), and 11 (ERT, type D). The observation periods were 5 years 5 months to 16 years 3 months and 3 years 6 months to 6 years in HSCT group and ERT group, respectively. The correlation between chronological age and developmental age was analyzed by scatter diagram in each group. Results: In patients ERT, deterioration of developmental age was observed after age 5 both in types C and D patients, which was similar to that of natural history. In patients receiving HSCT, the scatter diagram was almost same as patients receiving ERT. However, 3 of the 30 patients did not show deterioration even after age 5. The DQ values of these 3 patients before HSCT were 78 (C), 50 (C), and 75 (D), and none of them had either cortical atrophy or hydrocephalus. Conclusion: Hematopoietic stem cell transplantation is a beneficial treatment for the patients with MPS-II especially for those patients with brain involvement, especially when it was performed in early stage. Genotyping for the patients with good efficacy and further prospective studies should be performed.

1054 - Comparison of the In Vitro Efficacy of Idursulfase and Idursulfase β on Cultured Fibroblasts of Patients With Hunter Disease

Chihwa Kim¹, Jinwook Seo², Sumin Lee¹, Heechun Kwak¹, Yokyung Chung², and Dongkyu Jin³

¹Mogam Biotechnology Research Institute, Yongin, South Korea

²Green Cross Corporation, Yongin, South Korea

³Samsung Medical Center, Seoul, Korea

Introduction: Mucopolysaccharidosis type II (MPS-II, Hunter syndrome; OMIM 309900) is an X-linked lysosomal storage disease caused by a deficiency of iduronate 2-sulfatase (IDS) enzyme, leading to accumulation of glycosaminoglycans (GAGs). The 2 recombinant enzymes idursulfase (Shire Human Genetic Therapies, Lexington, Massachusetts) and idursulfase β (Green Cross Corp, Yongin, Korea), used in enzyme replacement therapy (ERT) of Hunter syndrome, are currently available in Korea. These 2 enzymes showed significant differences in various clinical parameters in a recent clinical trial (Orphanet J Rare Dis 2013;8:42). It was demonstrated these proteins have different formylglycine contents that importantly related the enzyme activity of sulfatase family enzymes (Glycocojugate J, in press). Methods: The efficacy of GAG degradation enzymes were compared by using skin fibroblasts of patients with Hunter syndrome who had already accumulated GAGs in lysosome. We measured the cellular uptake kinetics and degradation of GAG contents dose and time dependently in patient cells. Results: An immunocytochemistry analysis revealed both proteins were well incorporated in cultured cells and showed that idursulfase β is taken up faster than idursulfase. The enzyme activities of idursulfase and idursulfase β were 27.4 ± 0.31 and 45.4 ± 0.93 nmol/min/μg, respectively. Incorporated idursulfase β highly degraded the GAGs accumulated in cultured Hunter fibroblasts in a dose-dependent manner and showed statistically significant difference at a very low dose, especially. But we didn’t show time-dependent effect difference between them. Conclusion: Therefore, these results suggest that idursulfase β is an active protein like idursulfase which is used as enzyme replacement therapeutic drug for Hunter syndrome. Faster incorporation into the cells means that the residual time in blood stream is short after intravenous injection, and this fact can also be assumed to reduce the chance of an immune response.

1057 - The Challenges in Coordinating Clinical Trial Attendance for Patients Traveling From Abroad

Allison L. Warwick¹, Christine Lavery², Milligan Alan¹, Richfield Linda¹, Hughes A. Derralynn¹

¹Royal Free Hospital Foundation Trust, Hampstead, United Kingdom

²MPS, Buckinghamshire, United Kingdom

Introduction: Mucopolysaccharidosis type IVA is an autosomal recessive lysosomal storage disorder characterized by short stature, skeletal dysplasia, dental anomalies, and/or corneal clouding. Intelligence is not affected. Objectives: To meet the challenge of transporting patients safely to a trial center with minimal upheaval of daily life, making the transition as easy as possible. Planning the best way to safely transport patients from European mainland and Northern Ireland weekly for intravenous treatment was the biggest challenge. Methods/Results: Planning commenced with help from the MPS society, a registered UK charity providing professional support to individuals and families affected by MPS and related lysosomal storage disorders. The society also funds and promotes research for treatments and clinical trials. The society coordinated the travel, hotel accommodation, interpreters, airport transfers, and internal travel. Patients were provided with subsistence (ie, meals). This system generally works well. Exceptions arise when there are incidences of travel outside of the European Union or with patient’s resident within the Union but not holding the relevant passport. This involved delicate negotiation and planning with the relevant passport agency and their embassy. Our center coordinated transport to and from hotels on days of treatments/tests, worked alongside interpreters to be able to clearly communicate with the patient, scheduled events within the clinical trial months in advance of patient arrival and handled patients’ expenses. Conclusion: In summary, this demonstrates the importance of medical health professional working in concert with patients and patient support groups. Forward planning and coordination in these instances are vital to ensure an adequate numbers and continuing participation in clinical trials where the disease is rare.

1063 - Effects of Enzyme Replacement Therapy Started Late in a Murine Model of Mucopolysaccharidosis Type I

Gabriela Pasqualim¹, Guilherme Baldo^2,3, Talita G. de Carvalho¹, Angela M. V. Tavares⁴, Roberto Giugliani^5,6, and Ursula Matte^5,6

¹PPGBM, UFRGS, Gene Therapy Center, HCPA, Porto Alegre, Brazil

²Gene Therapy Center, HCPA, Porto Alegre, Brazil

³Department of Physiology, ICBS, UFRGS, Porto Alegre, Brazil

⁴Health Science Department, Uniritter—Laureate International Universities, Porto Alegre, Brazil

⁵PPGBM, UFRGS, Gene Therapy Center, Medical Genetics Service, HCPA, Porto Alegre, Brazil

⁶INAGEMP, Porto Alegre, Brazil

Introduction: Mucopolysaccharidosis type I (MPS-I) is a rare progressive disorder caused by deficiency of α-l-iduronidase (IDUA), which leads to storage of glycosaminoglycans (GAGs) heparan and dermatan sulfate. There is a consensus in the literature that early enzyme replacement therapy (ERT) leads to a better outcome, preventing or minimizing irreversible damage. Objective: To evaluate the effects of ERT when started late to reverse the disease manifestations in an MPS-I murine model because many patients worldwide are diagnosed late and do not receive immediate treatment. Methods: Mucopolysaccharidosis type I mice received treatment from 6 to 8 months of age (ERT 6-8 months) with 1.2 mg laronidase/kg every 2 weeks and were compared to 8-month-old wild-type (normal) and untreated animals (MPS-I). Results: Enzyme replacement therapy when started late was effective in reducing urinary and visceral GAG to normal levels. Although heart GAG levels and left ventricular (LV) shortening fraction were normalized, cardiac function was not completely improved. Although no significant improvements were found on aortic wall width, treatment was able to significantly reduce heart valve thickening. A high variability was found in behavior tests, with treated animals presenting intermediate results between normal and affected mice, without correlation with cerebral cortex GAG levels. Cathepsin D activity in cerebral cortex also did not correlate with behavior heterogeneity. All treated animals developed antienzyme antibodies, but no correlation was found with any parameters analyzed. However, intermediary results from locomotion parameters analyzed are in accordance with the intermediary levels of heart function, cathepsin D, activated glia, and reduction in TNF-α, and expression in the cerebral cortex. Conclusion: Even if started late, ERT can have beneficial effects on many aspects of the disease and should be considered whenever possible. Financial support: The study received financial support from FIPE-HCPA, FAPERGS, CAPES, and CNPq.

1064 - Factors Affecting Compliance With Enzyme Replacement Therapy With Idursulfase in Patients With Hunter Syndrome: Data From the Hunter Outcome Survey

Martha Solano¹, Isabelle Morin², and Christina Lampe³

¹Department of Neuropediatrics, Bogotá, Colombia

²Shire, Eysins, Switzerland

³Rare Disease Centre, Horst Schmidt Clinic, Wiesbaden, Germany

Objectives: Enzyme replacement therapy with idursulfase (Elaprase; Shire, Eysins, Switzerland) is used as a long-term treatment for patients with Hunter syndrome. Treatment consists of weekly 0.5 mg/kg intravenous infusions that are generally administered over 3 hours. Patients may sometimes miss scheduled infusions. This analysis investigated the frequency of, and reasons for, missed idursulfase infusions and stopping treatment. Methods: This analysis used data from the Hunter Outcome Survey (HOS), a global, multicenter, longitudinal, and observational registry sponsored by Shire that collects real-world information on the natural history of Hunter syndrome and the long-term effectiveness and safety of idursulfase. Results: As of January 2014, data on missed infusions and stopping treatment were available for 655 patients followed prospectively in HOS who had received at least 1 dose of idursulfase. The mean time from treatment start to last clinical evaluation recorded in HOS or treatment end was 47.9 months. In total, 1319 missed infusions were reported in 177 (27.0%) of the 655 patients. The most common reasons given were illness (for 26.8% of missed infusions), holiday/vacation (13.4%), and caregiver/family issues (7.2%). Unavailability of enzyme replacement therapy and cannulation difficulties were the reasons for 2.5% and 1.7% of missed infusions, respectively. Other reasons (25.4%) included family social problems, conflict with other medical procedures, insurance/reimbursement issues, and drug shipment or transport problems. The reasons for 23.0% of missed infusions were unknown or missing. At last evaluation, 50 (7.6%) of the 655 patients had stopped treatment; the most common reason given (36.0%) was the patients or their parents deciding to stop treatment. Conclusion: Analysis of data in HOS reveals that a variety of factors affect compliance with treatment; the most common reason for missing an infusion was illness. However, 73% of patients receiving idursulfase did not miss a single infusion during this analysis period, and few patients stopped treatment. Conflicts of Interest: Dr Solano has received travel support and honoraria from Shire, BioMarin, and Genzyme Corporation. Morin is a full-time employee of Shire. Dr Lampe has received travel support, speaker fees, and honoraria from Shire, BioMarin, and Genzyme Corporation and partial funding for medical advice.

1065 - Determination of Kinetic Parameters of Enzyme Deficiency in Diagnosis of Mucopolysaccharidosis Type IVA

Jaqueline Cé ¹, Ana C. Breier¹, Jamila Mezzalira¹, Vitória C. Moraes¹, and Janice C. Coelho¹

¹Departamento de Bioquímica, UFRGS, Porto Alegre, Brazil

Introduction: The mucopolysaccharidosis type IVA, called Morquio syndrome, is characterized biochemically by the accumulation of glycosaminoglycans keratan sulfate and condoitin-6-sulfate in lysosomes, caused by the deficiency of the N-acetylgalactosamine-6-sulfatase (GALNS) enzyme. Objectives: To determine the kinetic parameters Km and maximum velocity (Vmax) of GALNS in leukocytes of healthy individuals in order to improve the diagnosis of mucopolysaccharidosis type IVA. Methods: Leukocytes from 6 healthy individuals were isolated from 10 mL of heparinized blood (Skoog and Beck, 1956). N-Acetylgalactosamine-6-sulfatase activity was measured according to van Diggelen et al (1990) with 4-methylumbelliferyl-β-d-galactoside-6-sulfate (MU-βGal-6S) as artificial substrate. The curve of Michaelis-Menten (substrate curve) was obtained with MU-βGal-6S solutions at concentrations of 1 to 20 mmol/L. The linearity was observed, and new points of substrate concentration were established for the calculation of the Km and Vmax parameters using the Lineweaver and Burk plot. Results: The Km and Vmax of GALNS in leukocytes of healthy individuals were 7.16 mmol/L and 77.3 nmol/17 h/mg protein, respectively. Conclusion: The determination of the kinetic parameters of the enzyme N-acetylgalactosamine-6-sulfatase is of great importance for the improvement in fluorometric techniques for the diagnosis of Morquio syndrome and also for distinguishing healthy individuals affected and heterozygous.

1068 - Audiological Evaluation of Children With Hunter Syndrome Receiving Investigational Intrathecal Enzyme Replacement Therapy

Patricia Roush¹, and Joseph Muenzer¹

¹Department of Otolaryngology, Head & Neck Surgery, University of North Carolina, Chapel Hill, NC, USA

Objectives: To present audiological findings obtained from patients with Hunter syndrome (mucopolysaccharidosis type II [MPS-II]) who participated in a Shire-sponsored phase 1/2 study (NCT00920647) and its extension of intrathecal (IT) enzyme replacement therapy with an investigational formulation of idursulfase designed for IT administration (idursulfase-IT). Methods: Eleven boys with severe MPS-II, participating in the Shire-sponsored study (NCT00920647) over a 2-year period, underwent audiological evaluations at baseline, 6 months, and 12 months. These patients had evidence of cognitive impairment and adhered to a standard regimen of IV idursulfase; in addition, these patients received monthly 1-, 10-, or 30-mg doses of investigational idursulfase-IT. Results: Of the 11 patients, 6 were using hearing aids at enrollment and 1 additional patient started using hearing aids during the study. Due to behavioral and cognitive challenges, behavioral audiometry was difficult for these patients and middle ear pathology was frequent. Auditory brain stem responses (ABRs) were studied under general anesthesia using both click and tone-burst stimuli. In general, waves I, III, and V were identifiable and the overall quality of the waveforms allowed us to estimate behavioral thresholds for the majority of patients in both ears. In most cases, the I to V intervals were abnormally long, indicative of dysfunction in the auditory neural pathway. Treatment with monthly idursulfase-IT did not show consistent effects on waveform morphology or on associated peak latencies and intervals. Conclusion: Auditory brain stem response appears to be the best method for estimating the hearing threshold levels in children with MPS-II. Treatment with investigational idursulfase-IT produced no consistent change in ABR in this study. Conflicts of Interests: This study was funded by Shire (NCT00920647). Dr Roush has received consulting fees from Shire. She also serves on the advisory board for Phonak AG. Dr Muenzer has been a consultant to BioMarin Pharmaceutical, Shire HGT, Green Cross, and PTC Therapeutics and serves on advisory boards and speaker’s bureaus for Genzyme, BioMarin, and Shire. He is currently the principal investigator for phase I/II IT enzyme replacement clinical trials for MPS-II sponsored by Shire

1076 - Venous Access and Enzyme Replacement Therapy: Preserving Peripheral Venous Network

Anneliese Lopes Barth¹, Ester Nunes Platenik¹, Celma Dias Maciel¹, Rosangela dos Santos Ferreira¹, Paula Cristina Bento Lemos¹, Iliane de Paula Oliveira¹, Ana Carolina Esposito¹, and Dafne Gandelman Horovitz¹

¹IFF/FIOCRUZ, Rio de Janeiro, Brazil

Introduction and Objectives: Enzyme replacement therapy (ERT) is a long lasting treatment and has been changing the natural course of several diseases. It is administered by intravenous infusions, and frequent peripheral venous punctures are essential. Nursing staff is responsible for the technique and selection of the puncture sites. It demands knowledge of anatomy, physiology, and ability to perform the technique. As ERT means lifelong infusions, we choose not to place implantable venous access, since patients are young and many live in poor socioeconomic and hygienic conditions, leading to additional risks. Methods: This study was conducted in the outpatient day clinic and describes how patients’ venous network is being used and preserved. Results: A total of 31 patients have received ERT in our institution, with 20 MPS and 2 Pompe currently being followed, most under weekly infusions. Patients have been on ERT for 5 months from 9 years of age. Three patients began infusions when they were less than 1 year of age. At the time of venipuncture, the caliper of the vessels, condition of the venous network, pain awareness of the region, and flexibility to provide comfort to the patient are evaluated, in order to choose the best puncture site. Appropriate hydration is very important. A different puncture site is chosen in every infusion for each patient, and the rotation is important for venous network recovery. No patient needed implantable catheter. Our team administered around 3500 infusions; in 2013, and there were 757 ERT infusions, all using peripheral veins. In only 3 occasions, venous access was not possible and the patient had to come for infusion on a different day. Conclusion: We conclude that it is possible to preserve the venous network and avoid long-term venous access, even in small children. Highly motivated and trained staff may reduce risk and work with less technology. Conflicts of Interest: Continuing medical education provided by Biomarin, Genzyme, and Shire.

1079 - Safety and Pharmacodynamic Activity of Elosulfase α in Pediatric Patients Less Than 5 Years of Age With Morquio A Syndrome (Mucopolysaccharidosis type IVA)

Paul Harmatz¹, Simon Jones², Martin G. Bialer³, Rossella Parini⁴, Ken S. Martin⁵, Hui Wang⁵, and Adam Shaywitz⁵

¹Children’s Hospital Oakland, Oakland, CA, USA

²Manchester Centre for Genomic Medicine, St Mary’s hospital, CMFT, MAHSC, University of Manchester, Manchester, England

³North Shore LIJ Health System, Manhasset, NY, USA

⁴Az.Ospedaliera S. Gerardo, Monza, Italy

⁵BioMarin Pharmaceutical Inc, Novato, CA, USA

Introduction: Morquio A syndrome (MPS-IVA) is characterized by deficient N-acetylgalactosamine 6-sulfatase activity leading to excessive lysosomal storage of the glycosaminoglycan, keratan sulfate (KS). Patients have progressive, debilitating effects including skeletal dysplasia, impaired growth, cardiopulmonary complications, reduced endurance, and increased mortality. Objective: This study’s primary objective was evaluation of safety elosulfase α enzyme replacement therapy (ERT) in patients with MPS-IVA <5 years of age. Methods: Safety was monitored in 15 patients with MPS-IVA receiving 52 weeks of intravenous (IV) infusion therapy at 2 mg/kg/wk. Pharmacodynamic and growth were also assessed. Results: The mean (range) age was 3.1 (0.8-4.9) years at study entry. The majority (96.4%) of adverse events (AEs) were mild to moderate. Most commonly reported drug-related AEs were pyrexia (n = 6, 40.0%) and vomiting (n = 5, 33.3%). Of the 8 serious AEs, 1 was drug related (hypersensitivity). Of the 758 infusions, 6 (0.8%) administration led to AEs requiring interruption and medical intervention with IV antihistamines and/or IV steroids. All patients received subsequent infusions. There were no study discontinuations or deaths. Mean ±standard deviation (SD) baseline normalized urinary KS (uKS) was 35.9 ± 12.32 μg/mg creatinine, decreased by 46.4% ± 19.76% at 8 weeks and was sustained (43.1% ± 22.15%) at 52 weeks. Results were consistent with studies in older populations demonstrating pharmacodynamic effects of ERT on uKS. Standing heights were measured in patients >2 years and in 1 patient of 18 months old (n = 13); lengths were measured in all patients (n = 15). Standing heights (in cm) increased by (mean ± SD) 6.7% ±3.76% from baseline. Mean (±SD) baseline Z scores for height/length of patients (n = 15) were −1.6 ± 1.61 and remained below 50% at −1.9 (1.62) at 52 weeks. Anthropometric data will be compared to age-matched, untreated patients with MPS-IVA. Conclusion: Elosulfase α had a favorable safety profile and decreased uKS in <5-year-old children, similar to the data from older populations. Continued assessments over longer periods will evaluate the long-term benefit of ERT in this population. Conflicts of Interest: Authors Martin, Wang, and Shaywitz are employees and stockholders of BioMarin. All other authors are principal investigators for the clinical trial described in this abstract and sponsored by BioMarin. These authors may have provided consulting services, received research grants, participated in advisory board meetings, and/or received speaker honoraria and travel support from BioMarin Pharmaceutical Inc.

1080 - Enzyme Replacement Therapy Hypersensitivity and Desensitization

Luis Felipe Ensina¹, Alex E. de Lacerda¹, Carolina S. Aranda¹, Gustavo G. G. Da Fonseca², Ekaterini Goudouris², Fernanda P. Mariz², Evandro Prado², Marcia G. Ribeiro², Ines C. Camelo-Nunes¹, and Mariana Castells³

¹Universidade Federal De Sao Paulo, São Paulo, Brazil

²Universidade Federal Do Rio De Janeiro, Rio De Janeiro, Brazil

³Brigham and Womens Hospital, Boston, MA, USA

Objectives: To report the use of a new desensitization protocol in patients with enzyme replacement therapy (ERT) reactions. Methods: We describe 2 patients with mucopolysaccharidosis (MPS) type I and 1 patient with MPS-VI who developed mild to moderate hypersensitivity reactions during ERT successfully treated with a 3-bag, 12-step rapid desensitization protocol. Results: An 11-year-old female with MPS-I presented generalized urticaria and lip swelling during her fifth infusion with laronidase. The patient was treated and 1 hour later, the infusion was restarted. After 3 minutes, she experienced an episode of widespread hives and the infusion was stopped. A 6-year-old male patient with MPS-I who had started receiving ERT with laronidase at the age of 2 also presented generalized urticaria minutes after finishing his 24th infusion. During the following infusions, he had 11 episodes of generalized urticaria, some of them with angiedema and cough. Two desensitization protocols failed, and the treatment was stopped due to the severity of the last reaction. A 5-year-old male with MPS-VI under ERT with galsulfase presented a localized urticaria in upper limbs with tachycardia and tachypnea, during an infusion after being treated for 2 years. The patients with MPS-I had positive skin tests but not the patient with MPS-VI. Serum-specific immunoglobulin E was negative for laronidase. Because laronidase and galsulfase are considered first-line therapy, a 3-bag, 12-step laronidase desensitization protocol was elaborated based on previous chemotherapy protocols, and informed consent was obtained. The target dose was individually calculated and premedication prescribed according to the protocol. The desensitization was done in a hospital setting and no reaction occurred while the target doses were reached successfully. Conclusion: This new ERT desensitization protocol with 3 bags and 12 steps provided temporary clinical tolerance at full therapeutic doses and protected against severe reactions.

1082 - Experience of a Laboratory in Rio de Janeiro, Brazil, in the Follow-Up of Patients With Mucopolysaccharidosis Types I, II, and VI on Enzyme Replacement Therapy

Fernanda B. Scalco¹, Dafne G. Horovitz², Juan C. Llerena², Marcia G. Ribeiro³, Raquel Boy⁴, Anneliese L. Barth², Ana Carolina Esposito², and Maria Lucia C. Oliveira⁵

¹Laboratório de Erros Inatos do Metabolismo (LABEIM)/DBQ/IQ/UFRJ, Porto Alegre, Brazil

²Instituto Fernandes Figueira/Fiocruz, Rio de Janeiro, Brazil

³Instituto de Puericultura e Pediatria Martagão Gesteira/UFRJ, Rio de Janeiro, Brazil

⁴Hospital Universitário Pedro Ernesto/UERJ, Rio de Janeiro, Brazil

⁵Laboratório de Erros Inatos do Metabolismo (LABEIM)/DBQ/IQ/UFRJ, Porto Alegre, Brazil

Introduction and Objective: The laboratory of inborn errors of metabolism at the Universidade Federal do Rio de Janeiro (LABEIM) detected in the last 25 years 142 cases of mucopolysaccharidoses. Of these, 40 cases of mucopolysaccharidosis (MPS) II, 23 MPS-III, 22 MPS-IV, 20 MPS-VI, and 13 MPS-I were confirmed. In the remaining 24 patients, it was not possible to determine the MPS type. From 2004, the laboratory initiated follow-up of patients with MPS from Rio de Janeiro, Brazil, submitted to enzyme reposition therapy (ERT), by evaluation of urinary glycosaminoglycans (GAGs). This work aims to present our experience in biochemical monitoring of patients with MPS under ERT. Methods: Determination of GAGs was performed by spectrophotometric method utilizing dimethylmethylene blue; results were expressed as milligram/gram creatinine and compared with a standard curve by age. Results: A total of 33 patients under ERT were monitored. The GAGs of 20 patients (8 MPS-VI, 6 MPS-I, and 6 MPS-II) were evaluated periodically (initially once every week and then once every 2 or 3 months). In the remaining 13 patients, analyses were occasional. In all patients, GAGs reduction was observed and in many cases the values oscillated. The percentage of reduction was significant and varied between 48% and 93%. Conclusion: It was concluded that GAGs excretion in MPS reflected each patient’s response to the treatment; those with a more significant reduction in GAGs, reaching excretion values close to the normal ones for the age, presented a better clinical response.

1087 - Safety and Efficacy of Enzyme Replacement Therapy With Idursulfase β in Children With Hunter Syndrome Younger Than 6 Years of Age

Young Bae Sohn¹, Sung Yoon Cho², and Dong-Kyu Jin²

¹Department of Medical Genetics, Ajou University Hospital, Suwon, Republic of Korea

²Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea

Introdution: Idursulfase β (Hunterase) has been used for enzyme replacement therapy (ERT) of patients with mucopolysaccharidosis type II (MPS-II, Hunter syndrome) 6 years old or older since 2012 in Korea. Objective: To evaluate the safety and efficacy of idursulfase β in children younger than 6 years having Hunter syndrome receiving ERT. Methods: This study was a single-arm, open-label clinical trial. Idursulfase β (0.5 mg/kg/wk) was administered intravenously for 52 weeks. The primary end point for safety was adverse events (AEs). Secondary end points included vital signs, physical examination, electrocardiogram (ECG), laboratory tests, and anti-idursulfase antibodies. Efficacy was assessed as a secondary end point represented by changes in urinary glycosaminoglycan (GAG) at 53 weeks from baseline. In addition, growth indices and developmental milestones (Denver II test) were evaluated as exploratory variables. Results: Six children younger than 6 years with MPS-II (mean: 3.6 ± 0.8 years) were enrolled. All 6 patients experienced at least 1 AE. A total of 109 AEs were reported. The most frequent AE was infection (65), followed by gastrointestinal disorder (16) and respiratory disorders (9). A patient experienced 1 serious AE (hospitalization due to gastroenteritis) that was considered not to be treatment related. A total of 11 infusion-related adverse drug reactions (6 urticaria and 5 cough) were reported in 1 (16.7%) patient. There were no serious adverse drug reactions and no clinically significant changes in vital signs, physical examination, laboratory parameters, or ECG. Of the 6 patients, 4 (66.7%) showed anti-idursulfase antibodies and neutralizing antibodies on at least 1 occasion during the study. At 53 weeks, urinary GAG reduced by 20.62% ± 20.67% from baseline. Conclusion: This study indicates that idursulfase β showed similar safety and efficacy to those of previous results in 6 years or older patients with Hunter syndrome.

1088 - Desensitization and Slow Continuous Infusion in Enzyme Replacement of Patients With Hunter Syndrome Having Anaphylaxis to Idursulfase

Young Bae Sohn¹, Se Hyun Maeng², Jihyun Kim², Kangmo Ahn², Sung Yoon Cho², Han-Wook Yoo³, and Lock-Hock Ngu⁴

¹Department of Medical Genetics, Ajou University Hospital, Suwon, Republic of Korea

²Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea

³Department of Pediatrics, Asan Medical Center Children’s Hospital, University of Ulsan College of Medicine, Ulsan, South Korea

⁴Genetic Department, Kuala Lumpur Hospital, Kuala Lumpur, Malaysia

Introduction: Enzyme replacement therapy (ERT) is a treatment of choice in Hunter syndrome. Life-threatening anaphylaxis mediated by anti-idursulfase immunoglobulin E (IgE) antibody can occur during ERT. Here, we report 5 cases of infusion-related anaphylaxis to recombinant human idursulfase (Elaprase; Shire Human Genetic Therapies, Inc, Cambridge, Massachusetts). Methods: Five cases (3 Korean and 2 Malaysian) with Hunter syndrome that had experienced anaphylaxis during ERT were evaluated by retrospective review of medical records. The specific IgE antibody was detected by skin prick test and enzyme-linked immunosorbent assay. Results: The median age of the 5 patients was 13 years (8-14 years). In all, 3 patients were attenuated and 2 were severe phenotype. The first anaphylaxis was developed at 122nd (26-136th) infusion of idursulfase. The symptoms of anaphylaxis included generalized urticaria, facial edema, wheezing, dyspnea, and hypotension. Specific IgE antibody against idursulfase were detected in 2 cases. All patients received ERT by slow continuous infusion over 8 to 30 hours. After successful desensitization, the fatal anaphylaxis was not recurred and total infusion time could be shortened by 4 to 8 hours. Conclusion: Our experience indicates that life-threatening anaphylaxis mediated by anti-idursulfase IgE antibody can occur during ERT in patients with MPS-II. Desensitization and continuous slow infusion are useful in these cases.

1089 - Managing Infusion-Associated Reaction in Mucopolysaccharidosis at a Reference Center for Inborn Errors of Metabolism: Experience of 10 Years

Sandra O. Kyosen¹, Carolina S. Aranda¹, Sueli Canossa¹, Viviani Tiozzo¹, Patricia Feliciano¹, Maret M. Rand¹, Cecilia Micheletti¹, Tania A. V. A. Seches¹, Luis F. C. Ensina¹, Dirceu Solé¹, Vania D'Almeida¹, and Ana M. Martins¹

¹Universidade Federal de Sao Paulo, São Paulo, Brazil

Objectives: To report the experience on enzyme replacement therapy (ERT) for mucopolysaccharidosis (MPS) types I, II, and VI of a reference center for inborn errors of metabolism over a period of 10 years. Methods: Retrospective study of medical charts of patients with MPS-I, -II, and -VI who underwent ERT from 2004 to 2014. Results: Over the period of the study, a total of 62 patients with MPS underwent ERT at the Centro de Referência em Erros Inatos do Metabolismo of Universidade Federal de Sao Paulo, 27 (10F/17M) patients with MPS-I, 20 (1F/19M) patients with MPS-II, and 15 (5F/10M) patients with MPS-VI. The mean age at first infusion was 5 years 5 months for MPS-I, 6 years 11 months for MPS-II, and 8 years 01 months for MPS-VI. At the time of the study, the patients were under ERT for a median period of 4 years (range: 1 year 4 months to 7 years 6 months) for MPS-I, 1 year 10 months (range: <1 month to 7 years 10 months) for MPS-II, and 2 years 5 months (range: 7 months to 6 years) for MPS-VI. Twenty-six patients (11 MPS-I, 8 MPS-II, and 7 MPS-VI) presented infusion-associated reaction (IAR), most of them mild that were conducted following our service protocol, and all the patients recovered completely without any complication. The IAR presented by the patients were abdominal pain (n = 1), agitation (n = 1), headache (n = 1), tachycardia (n = 1), skin parlor (n = 2), nausea (n = 3), cough (n = 1), hives (n = 7), angioedema (n = 5), cutaneous rash (n = 4), wheezing (n = 3), and fever (n = 10). Only 4 patients had moderate IAR, and in 1 the ERT was permanently stopped. Two patients are receiving ERT through the desensitization protocol with 3 bags and 12 steps. Conclusion: Enzyme replacement therapy was well tolerated, 42% of patients had any IAR, most of them mild. Having a well-established protocol for IAR management allows a prompt assistance of the patient, minimizing their risks.

1094 - Impact of Enzyme Replacement Therapy and Hematopoietic Stem Cell Therapy on Growth in Patients With Hunter Syndrome

Shunji Tomatsu¹, Pravin Patel¹, Yasuyuki Suzuki², Akemi Tanaka³, Hiromasa Yabe⁴, Shunichi Kato⁴, Tsutomu Shimada¹, Robert W. Mason¹, Kenji E Orii⁵, and Tadao Orii²

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Gifu University, Gifu, Japan

³Osaka City University, Osaka, Japan

⁴Tokai University, Tokyo, Japan

Introduction: Patients with Hunter syndrome (mucopolysaccharidosis type II) present with skeletal dysplasia including short stature as well as central nervous system and visceral organ involvement. A previous study on Hunter syndrome indicated an impact on brain and heart involvement after hematopoietic stem cell therapy (HSCT) at an early stage but little impact after enzyme replacement therapy (ERT). Meanwhile, impact on growth in patients with Hunter syndrome treated with ERT and HSCT has not been compared until now. We recently developed baseline growth charts for untreated patients with Hunter syndrome to evaluate the natural history of growth of these patients compared to unaffected controls (Patel et al, 2014). Method: To assess the impact of ERT and HSCT on growth, clinical data were obtained from 44 Japanese male patients with MPS-II; 26 patients had been treated with ERT, 12 patients had been treated with HSCT, and 6 had been treated with both ERT and HSCT. Height and weight were compared to untreated patients and unaffected controls from the previous study. Results: We demonstrated (1) that patients with MPS-II, who had been treated with either ERT or HSCT, had increased height and weight when compared to untreated patients and (2) that HSCT and ERT were equally effective in restoring growth of patients with MPS-II. Conclusion: Hematopoietic stem cell therapy should be considered as one of the primary therapeutic options for early-stage treatment of MPS-II, as HSCT has also been reported to have a positive effect on brain and heart valve development.

1097 - Enzyme Replacement Therapy in Newborn Mucopolysaccharidosis IVA Mice: Early Treatment Rescues Bone Lesions

Shunji Tomatsu¹, Adriana M. Montaño², Hirotaka Oikawa³, Vu Chi Dung⁴, Amiko Hashimoto⁵, and Monica L. Gutérrez²

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²Saint Louis University, St Louis, MO, USA

³Singapore Institute for Clinical Sciences, Singapore, Singapore

⁴Vietnam National Hospital of Pediatrics, Hanoi, Vietnam

⁵Myojinshita Aoki Dermatology Clinic, Tokyo, Japan

Introduction: We treated mucopolysaccharidosis IVA (MPS-IVA) mice to assess the effects of long-term enzyme replacement therapy (ERT) initiated at birth, since adult mice treated by ERT showed little improvement in bone pathology (Tomatsu et al, 2008). To conduct ERT in newborn mice, we used recombinant human N-acetylgalactosamine-6-sulfate sulfatase (GALNS) produced in a Chinese hamster ovary cell line. Method: First, to observe the tissue distribution pattern, a dose of 250 units/g body weight was administered intravenously in MPS-IVA mice at day 2 or 3. The infused enzyme was primarily recovered in liver and spleen, with detectable activity in bone and brain. Second, newborn ERT was conducted after tissue distribution study. The first injection of newborn ERT was performed intravenously, the second to fourth weekly injections were intraperitoneal, and the remaining injections from 5th to 14th week were intravenous into the tail vein. Results: The MPS-IVA mice treated with GALNS showed clearance of lysosomal storage in liver, spleen, and sinus lining cells in bone marrow. The column structure of the growth plate was organized better than adult mice treated with ERT; however, hyaline and fibrous cartilage cells in femur, spine, ligaments, disks, synovium, and periosteum still had storage materials to some extent. Heart valves were refractory to the treatment. Levels of serum keratan sulfate were kept normal in newborn ERT mice. Conclusion: The enzyme, which enters the cartilage before the cartilage cell layer becomes mature, prevents disorganization of column structure. Early treatment from birth leads to partial remission of bone pathology in MPS-IVA mice.

1100 - Clinical Effectiveness of Idursulfase in Patients With Hunter Syndrome: 3-Year Data From the Hunter Outcome Survey

Joseph Muenzer¹, Roberto Giugliani², Maurizio Scarpa³, Kemi Tanaka⁴, Anna Tylki-Szymanska⁵, Isabelle Morin⁶, and Michael Beck⁷

¹Department of Pediatrics, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

²Department of Genetics/UFRGS and INAGEMP, Medical Genetics Service/HCPA, Porto Alegre, Brazil

³Rare Disease Centre, Horst Schmidt Clinic, Wiesbaden, Germany

⁴Department of Pediatrics, Osaka City University Graduate School of Medicine, Abeno-ku, Osaka, Japan

⁵Department of Metabolic Diseases, The Children’s Memorial Health Institute, Warsaw, Poland

⁶Shire, Eysins, Switzerland

⁷Department of Pediatrics, University Medical Center, Johannes Gutenberg University, Mainz, Germany

Introduction: The Hunter Outcome Survey (HOS) is a global, multicenter, longitudinal, and observational registry sponsored by Shire that has been collecting information on the natural history of Hunter syndrome and the long-term effectiveness and safety of idursulfase (Elaprase; Shire) since 2005. The long-term data now available in HOS were used to investigate the effectiveness of idursulfase in a real-world setting over 3 years. Methods: As of January 2014, 564 patients followed prospectively in HOS had received at least 1 idursulfase infusion, after exclusion of females, patients who had received a bone marrow transplant, and those enrolled in the TKT018/TKT024 clinical trials. Median age at first treatment was 6.5 years; median treatment duration was 43.4 months. Clinical measures recorded in HOS at annual time points over 3 years were compared with baseline values; the cohorts analyzed at each time point were not identical. Results: Median urinary glycosaminoglycan (uGAG) levels, distance walked in the 6-minute walk test, left ventricular mass index, pulmonary function (forced vital capacity), and liver size had improved after 3 years of treatment compared with baseline (median uGAG, −68.0% vs baseline after 3 years, n = 68). However, the number of patients for whom baseline and posttreatment data were available was low for some parameters, particularly at 3 years (year 1, n = 21–126; year 2, n = 12–88; and year 3, n = 9–68). Conclusion: These findings suggest that a positive trend in the clinical effectiveness of idursulfase was generally maintained over 3 years in these patients in a real-world setting, supporting the results of previous clinical studies. Hunter Outcome Survey data continue to enhance our understanding of Hunter syndrome and its management in everyday practice; ongoing efforts to improve data quality and completeness, such as the HOS Moving toward System Enhancement database update, will be crucial in maximizing the registry’s long-term potential.

1109 - Experience With Alternative Regimen of Administration of the Enzyme Replacement Therapy in Patients With Mucopolysaccharidoses I

Katarína Hlavatá¹, Anna Šalingová², Ján Chandoga³, and Anna Hlavatá¹

¹2nd Department of Pediatrics Comenius, University Medical School and Children’s University Hospital, Bratislava, Slovakia

²Deparment of Laboratory Medicine, Centre of Inherited metabolic Disease, University Children’s Hospital, Bratislava, Slovakia

³Institute of Medical Biology, Genetics and Clinical Genetics, Faculty of Medicine, Comenius University, Bratislava, Slovakia

Introduction: Mucopolysaccharidoses (MPSs) are a group of inherited lysosomal metabolic disorders, where the absence of the lysosomal enzyme leads to the accumulation of glycosaminoglycans in lysosomes of the cells in various tissues. According to the deficient enzyme and clinical manifestations, 8 types of MPSs were identified. Mucopolysaccharidosis I together with MPS-II and MPS-VI belong to the MPSs that are treatable by the administration of enzyme replacement therapy (ERT). Methods and Results: Enzyme laronidase (Aldurazyme; Genzyme, Cambridge, Massachusetts) is administered once a week in intravenous infusion. For an effective therapy, early diagnosis and regular administration of ERT are essential. Enzyme laronidase (Aldurazyme) is administered in a dose of 0.6 mg/kg once weekly in intravenous infusion. We report our experience in treating patients with MPS-I—Morbus Sheie where due to insufficient cooperation with the family we modified the regimen of the ERT administration. Based on the published results from a randomized multicenter international study investigating the optimization of dosage and safety of administration of laronidase in multiple dosing regimens (Giugliano et al. A dose-optimization trial of laronidase (Aldurazyme) in patients with mucopolysaccharidosis type I. Mol Genet Metab 2008), we changed the dosing regimen to 1.2 mg/kg every 2 weeks. Conclusion: According to our prior observation, this alternative ERT regimen seems to be therapeutically acceptable. Patients showed improvement in their clinical conditions and the laboratory parameters. However, the long-term effects of ERT in this alternative regimen are still unknown.

1111 - Desensitization to Galsulfase for the Treatment of Recurrent Infusion Association Reactions in a Child With Mucopolysaccharidosis Type VI

Saikat Santra¹, Srividya Sreekentam¹, Catherine A. Stewart¹, Rachel Gould¹, Anupam B. Chakrapani¹, and Suresh Vijay¹

¹Birmingham Children’s Hospital, Birmingham, United Kingdom

Introduction: Mucopolysaccharidosis type VI (Maroteaux-Lamy disease) is a severe multisystemic disease in which enzyme replacement therapy (ERT) with galsulfase or hematopoietic stem cell transplantation is the only recognized disease-altering treatment. The development of antibodies against infused enzymes is well described and may adversely affect the clinical response to ERT. We report a 10-year-old patient who developed recurrent severe infusion-associated reactions (IARs) after 5 years of ERT in whom ERT was only tolerated with steroid premedication. High titers of antigalsulfase immunoglobulin G antibodies were present, but in vitro studies suggested these were nonneutralizing. Clinical side effects of long-term steroid use developed. A desensitization protocol was successful in permitting infusions without the development of severe IARs and without the use of steroids. Methods: The standard dose of galsulfase (1 mg/kg/dose) was reduced by a factor of 100 (0.01 mg/kg/dose) and infused at the standard rates ensuring delivery of the total dose over no less than 4 hours in a hospital setting. The administered dose was doubled each week until the standard dose was reached after 8 weeks. No steroid premedication was given, but premedication with loratadine and paracetamol was given. Results: No IARs were observed during the period of desensitization. Occasional IARs have been observed following 1-year follow-up when the patient has returned to home infusions, but these have been much less frequent and severe. Steroid premedication has not been restarted. Conclusion: We conclude that this desensitization protocol, based on protocols used in other lysosomal disorders such as Pompe disease, appears to have been at least partly successful in this patient. Previous published studies reported success with reducing infusion rates to 20 hours but this is not always practical, especially when ERT is infused at home. In selected cases, desensitization may be a more practical solution. Conflicts of Interest: Dr Santra has received educational grants and is a principal investigator on clinical trials sponsored by Biomarin Pharmaceuticals Inc.

1114 - Idursulfase Treatment in 6 Female Patients With Hunter Syndrome: Data From the Hunter Outcome Survey

Anna Tylki-Szymańska¹, Maurizio Scarpa², Isabelle Morin³, and Roberto Giugliani⁴

¹Department of Metabolic Diseases, The Children’s Memorial Health Institute, Warsaw, Poland

²Rare Disease Centre, Horst Schmidt Clinic, Wiesbaden, Germany

³Shire, Eysins, Switzerland

⁴Department of Genetics/UFRGS and INAGEMP, Medical Genetics Service/HCPA, Porto Alegre, Brazil

Introduction: Hunter syndrome is X-linked and therefore extremely rare in females; little is known about the clinical manifestations or use of idursulfase (Elaprase; Shire) in female patients. This analysis investigated disease characteristics and the effectiveness and tolerability of idursulfase in females with Hunter syndrome. Methods: Data from females enrolled in the Hunter Outcome Survey (HOS) were analyzed. Hunter Outcome Survey is a Shire-sponsored, global, and observational registry of patients with Hunter syndrome. Results: As of January 2014, 10 of the 970 patients enrolled in HOS were female. They were aged between 4.3 and 24.2 years at last HOS visit. Of the 9 female patients for whom information was available, neurological manifestations (including cognitive problems), pulmonary manifestations (including upper airway infections), and cardiovascular manifestations (including heart murmur and valve disease) were present in 8, 6, and 5 individuals, respectively. Of the 10 female patients, 7 were followed prospectively, and 6 of them had received at least 1 idursulfase infusion. A total of 21 adverse events (AEs) were reported in 2 patients. In the first patient, 12 nonserious AEs were reported; 11 were mild in severity, and information on severity was missing for 1 patient. In the second patient, 9 AEs were reported, 4 of which were serious and resulted in hospitalization. All AEs were considered not to be infusion related. Of the 6 treated patients, 2 had more than 1 urinary glycosaminoglycan measurement available, including 1 within ±3 months of treatment start. Urinary glycosaminoglycans were initially elevated above the upper limit of normal but dropped to within the normal range following idursulfase treatment. Conclusion: Analysis of these data from females in HOS showed that clinical manifestations are similar to those seen in male patients and that idursulfase infusions were generally well tolerated. Further analysis in more patients is required to define the best management approaches in females with Hunter syndrome. Conflicts of Interest: Dr Scarpa has received grants, travel support, and honoraria from Shire, Genzyme Corporation, and BioMarin. Ms Morin is a full-time employee of Shire. Professor Giugliani has received travel grants from Shire, Genzyme, and BioMarin, research grants from Shire, Actelion Pharmaceuticals, BioMarin, Genzyme, and Synageva and honoraria for speaking engagements from Shire, Genzyme, BioMarin, and Synageva. Professor Tylki-Szymaska has received travel grants and speaker fees from Shire, Genzyme Corporation, BioMarin, and Synageva.

1115 - Infusion Management of Elosulfase α for Patients With Morquio A Syndrome

Clare B. Edano¹, Mary L. Malick¹, and Barbara K. Burton¹

¹Ann & Robert H. Lurie Children’s Hospital of Chicago, Chicago, IL, USA

Introduction: Morquio A syndrome is caused by a deficiency in N-acetylgalactosamine-6-sulfatase (GALNS), causing accumulation of glycosaminoglycans (GAGs). Patients have multisystemic impairment and debilitation. Elosulfase α (EA) is an enzyme replacement for GALNS, promoting GAG catabolism. We describe results of infusion-associated reaction (IAR) management in 7 patients. Methods: Seven patients participated in an early access program of EA and received weekly infusions of 2 mg/kg/wk for 18 to 31 weeks (median = 28 weeks). Patient’s age was 2 to 25 years (median 6 years). Results: Infusion compliance was high; only 8% were missed due to illness, surgery, or weather preventing travel. Patients were asked to consume a light meal and ∼30 minutes preinfusion were given nonsedating antihistamines. For patients with history of IARs or other risk factors (eg, allergies), sedating antihistamine was administered with additional agents (eg, H2 blocker, montelukast sodium, or steroids). Antipyretic drugs were optional. Of the 7 patients, 5 experienced IARs, defined as any adverse events occurring between onset of infusion and 1 day following end of infusion, regardless of whether related to treatment. All IARs were classified as mild and occurred in 10% of infusions administered, most of which were manageable with symptomatic treatment and/or infusion rate modification. No patients who had an AE during the infusion required infusion discontinuation. The most common IARs in these 5 patients were headache (3.3%), pallor (3.3%), emesis (3.3%), chest tightness (2.7%), hives (2.7%), altered heart rate (2.7%), nausea (2.1%), light headedness (1.1%), and anxiety (1.1%). All patients who experienced an IAR received and tolerated subsequent infusions. No patients discontinued treatment. Conclusion: Infusion-associated reactions from IV EA infusions were mild and successfully managed in the 5 of the 7 patients with Morquio A Syndrome receiving treatment who experienced them. Conflicts of Interest: Clare Edano: no conflicts of interest. Mary Malick: no conflicts of interest. Dr Barbara Burton is paid by the sponsor of the study, BioMarin Pharmaceutical Inc, for her services as a consultant and may make presentations about her research and clinical activities.

1117 - Meta-Analysis of Antibody Titers, Safety, and Treatment Outcomes in MPS-I Receiving Enzyme Replacement Therapy With Laronidase (Aldurazyme) in Clinical Studies

Yong Xu¹, Susan Richards¹, Shari Fallet¹, Asif Mahmood¹, and Gerald F. Cox¹

¹Genzyme, a Sanofi company, Cambridge, MA, USA

Introduction/Objectives: Most patients with mucopolysaccharidosis I (MPS-I) treated with laronidase (Aldurazyme; Genzyme, Cambridge, Massachusetts) in clinical trials have developed antilaronidase antibodies. Theoretically, antibodies might alter the biological effects of laronidase by inhibiting its activity, changing its turnover, limiting its uptake into target tissues, and/or causing an allergic reaction. The objective of this meta-analysis was to determine whether relationships exist between antilaronidase antibodies and clinical outcomes, hypersensitivity reactions, and urinary glycosaminoglycan (uGAG) reduction in patients with MPS-I receiving laronidase. Methods: Data from 73 patients enrolled in 4 clinical trials of laronidase were used for this meta-analysis. Patients received treatment with the labeled dose of laronidase (0.58 mg/kg/wk) for 26 to 208 weeks. Efficacy parameters included 6-minute walk test, percentage of predicted forced vital capacity, liver volume, range of motion, left ventricular mass, investigator global assessments, and uGAG levels, as appropriate, in individual studies. Safety and immunogenicity parameters included infusion-associated reactions (IARs), antilaronidase immunoglobulin (Ig) G antibodies (seroconversion and time to seroconversion, peak titer, and overall exposure to IgG antibodies over time), enzyme activity inhibition and enzyme cellular uptake inhibition assays, and hypersensitivity testing (ie, IgE, complement activation, and serum tryptase). Results: Based on the analysis of selected clinical outcome measures, there was no apparent correlation between antilaronidase IgG antibodies and efficacy outcomes. Likewise, there was no apparent relationship between antibodies and the occurrence of potential allergic reactions or IARs. There was, however, a statistically significant inverse correlation between uGAG reduction and antibody titer (P = .0001), consistent with individual study results. Conclusion: This meta-analysis describes the most comprehensive, systematic review of immunogenicity data from clinical studies of Aldurazyme (including long-term follow-up) and involves patients with all MPS-I phenotypes. Although the presence of antibodies correlated with impaired urinary GAG clearance, no impact on the clinical efficacy or safety of laronidase was observed. This study was funded by the Genzyme/BioMarin Joint Venture. Conflicts of interest: All authors are employees of Genzyme, a Sanofi company.

1118 - Limited Association Between Infusion Reactions and Anti-Idursulfase Antibodies Developed During Long-Term Idursulfase Enzyme Replacement Therapy in Patients With Mucopolysaccharidosis II Aged 5 to 35 Years

Paul Harmatz¹, Roberto Giugliani², Nancy J. Mendelsohn³, Ashok Vellodi⁴, Simon A. Jones⁵, Yune Kunes⁶, Kenneth Sciarappa⁶, Bonnie Bielefeld⁶, Ann J. Barbier⁶, Arian Pano⁶, and Christian J. Hendriksz⁷

¹Children’s Hospital Oakland, Oakland, CA, USA

²Department of Genetics/UFRGS, Medical Genetics Service/HCPA, and INAGEMP, Porto Alegre, Brazil

³Children’s Hospitals and Clinics of Minnesota, Minneapolis, MN, USA

⁴Metabolic Medicine Unit, Great Ormond Street Hospital for Children NHS Foundation Trust, London, United Kingdom

⁵St Mary’s Hospital, Manchester, United Kingdom

⁶Shire, Lexington, MA, USA

⁷7Salford Royal NHS Foundation Trust, Salford, United Kingdom

Introduction/Objectives: We conducted a 2-year study to examine the long-term immunogenicity and safety of idursulfase (NCT00882921). The primary and secondary objectives were to assess the impact of immunoglobulin G antibody status on safety (via infusion-related adverse events [IRAEs]) and efficacy (via urinary glycosaminoglycans [uGAGs]). Methods: Twenty-six patients with mucopolysaccharidosis II (MPS-II, Hunter syndrome) aged 5 to 35 years who had received intravenous idursulfase for ≥6 months prior to entry were enrolled. Results: Fifteen patients completed the study. In the genotype analysis, 11 patients had a missense mutation, 3 each had a nonsense or frameshift mutation, and 2 had a complete deletion/rearrangement. Genotype was unavailable for 5 patients and 2 patients were unclassifiable. Eleven patients had serum anti-idursulfase antibodies at baseline, and 2 additional patients had developed intermittent antibody seropositivity at week 13. Of the 26 patients, 9 (35%) had ≥1 sample positive for neutralizing antibodies during the study. Patients with missense mutations were less likely to develop antibodies than were those with other genotypes. At study entry, uGAG levels were low due to prior enzyme replacement therapy and did not change appreciably thereafter. Antibody-positive patients had higher uGAG levels at study entry and throughout the study than did antibody-negative patients at the same time points. Nine patients reported IRAEs. In this small data set, antibody-positive patients appeared to have a higher risk of developing an IRAE than did antibody-negative patients. This risk was not statistically significant and decreased after adjustment for age. Conclusion: In a mixed-age population with MPS-II having various genotypes, 50% of patients developed antibodies on treatment with idursulfase. The study shows higher levels of uGAGs in antibody-positive patients, but the association between IRAEs and antibodies is weak, confirming earlier studies. Conflicts of Interest: This study was funded by Shire (NCT00882921). Dr Harmatz has received travel, honorarium, and consulting fees from BioMarin, Shire, and Alexion and has undertaken contracted research for Alexion-Enobia, BioMarin, FerroKin-Shire, Sanofi-Genzyme, and Shire. He has also been the recipient of educational grants from BioMarin, Sanofi-Genzyme, and Shire. Dr Giugliani has received consulting fees from and has undertaken contracted research for Amicus, BioMarin, Sanofi-Genzyme, and Shire. In addition, he has received fees from Actelion, BioMarin, Sanofi-Genzyme, and Shire. Dr Mendelsohn has received consulting fees and travel stipends from and has undertaken contracted research for BioMarin, Sanofi-Genzyme, and Shire. Dr Vellodi has no conflicts of interest or disclosures. Dr Jones has received honoraria, travel grants, or research grants from Shire. Dr Hendriksz has received consulting fees from Actelion, BioMarin, GlaxoSmithKline, and Sanofi-Genzyme and has undertaken contracted research for Actelion, Amicus, BioMarin, GlaxoSmithKline, Sanofi-Genzyme, Shire, and Synageva. Dr Vijayaraghavan has received consulting fees from BioMarin, Sanofi-Genzyme, and Shire and has undertaken contracted research for Shire. Ms Bielefeld and Drs Kunes, Sciarappa, Barbier, and Pano are all employees of Shire.

1123 - The Clinical Effect of Enzyme Replacement Therapy on Carpal Tunnel Syndrome Prior to Bone Marrow Transplant in Patients With Hurler Syndrome

Ann E. Van Heest¹, Mitchell Wyffels¹, and Paul Orchard¹

¹University of Minnesota, Minneapolis, MN, USA

Introduction/Objective: In the past, carpal tunnel syndrome was present in up to 73% of children with Hurler syndrome. With Food and Drug Administration approval of enzyme replacement therapy for treatment of mucopolysaccharide storage diseases (MPSD), is there a change in the frequency of carpal tunnel syndrome? The purpose of this study is to evaluate the frequency of carpal tunnel syndrome in 1 patient group with MPSD type IH (Hurler syndrome) treated with enzyme replacement therapy prior to bone marrow transplant (BMT). Methods: Thirty-four patients with MPSD type 1H treated with enzyme replacement therapy prior to transplant were evaluated. All patients’ records were reviewed for nerve conduction studies and carpal tunnel surgical intervention. A comparison of the number of patients requiring surgery as well as the effectiveness of treatment as indicated by objective nerve conduction study assessment was evaluated. Nerve conduction velocity and latency were evaluated based upon comparative findings on the ipsilateral ulnar nerve. Results: At an average follow-up of 26.6 months, 7 (21%) of the 34 patients in the enzyme treatment group had undergone bilateral carpal tunnel release for the treatment of symptomatic carpal tunnel syndrome. Of the 7 patients treated with open carpal tunnel release, follow-up nerve studies were available in 5 patients. Average preoperative median nerve latency was 3.78 and average postoperative median nerve latency was 2.99. Conclusion: Enzyme replacement therapy at the time of BMT is effective at reducing the frequency of carpal tunnel syndrome in patients with Hurler syndrome. Although carpal tunnel syndrome is less common in children with MPSD type 1H after enzyme replacement prior to BMT, screening evaluations with nerve conduction velocity testing is still recommended. For children with MPSD type 1H, carpal tunnel release remains an effective treatment for improving median nerve conduction.

1126 - Investigational Intrathecal Enzyme Replacement Therapy for Children With Severe Form of Hunter Syndrome (Mucopolysaccharidosis II)

Joseph Muenzer¹, Christian J. Hendriksz², Margot B. Stein¹, Zheng Fan¹, Shauna Kearney², Johan Horton², Suresh Vijayaraghavan², Victor Perry¹, Saikat Santra², Guirish A. Solanki², Luying Pan³, Nan Wang³, Mary Ann Mascelli ³, Kenneth Sciarappa ³, and Ann J. Barbier³

¹University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

²Birmingham Children’s Hospital NHS Foundation Trust, Birmingham, United Kingdom

³Shire, Lexington, MA, USA

Introduction: There is no available effective treatment for cognitive impairment in mucopolysaccharidosis II (MPS-II). The safety of investigational human recombinant iduronate 2-sulfatase formulated for intrathecal administration (idursulfase-IT) via an intrathecal drug delivery device (IDDD) was examined in a phase I/II clinical trial and its extension both sponsored by Shire. Change in the concentration of glycosaminoglycans in cerebrospinal fluid (CSF) and change from baseline in standardized neurocognitive assessments were also assessed. Methods: Sixteen cognitively impaired children with MPS-II previously treated with weekly intravenous idursulfase (Elaprase; Shire, Lexington, Massachusetts) for ≥6 months were enrolled. Four patients per dose group received either no treatment or 10, 30, or 1 mg idursulfase-IT monthly for 6 months while continuing intravenous idursulfase 0.5 mg/kg weekly. Patients continued into an ongoing extension study, receiving either 10 or 30 mg monthly. Results: No serious adverse events related to idursulfase-IT were observed. The total time of exposure to idursulfase-IT was 18 to 53 months. Surgical revision/removal of the IDDD was required in 6 of the 12 patients in the first 6 months. Some doses were administered by lumbar puncture. The mean CSF glycosaminoglycan concentration was reduced by ˜90% in the 10- and 30-mg groups and ∼80% in the 1-mg group at month 6. Only 5 of the 16 patients were cognitively testable over time using the Differential Abilities Scale, 2nd version. Of these, 4 patients who were receiving 10 or 30 mg monthly showed signs of stabilization or a decreased rate of decline in cognitive scores over time. The remaining patient, who received 1 mg monthly for 6 months, had a decreased score and was switched to 10 mg in the extension study, after which his score stabilized. Conclusion: These data support further development of idursulfase-IT for the stabilization of cognitive function in moderately affected patients with MPS-II having severe phenotype. Conflicts of Interest: Dr Muenzer has received honoraria, educational, and travel grants from Janssen R&D and Shire and has participated in clinical trials with BioMarin Pharmaceutical and Shire. Dr Hendriksz has received honoraria, educational, and travel grants from Actelion Pharmaceuticals, BioMarin Pharmaceutical, GlaxoSmithKline, Shire, and Sanofi-Genzyme and has participated in clinical trials with Actelion Pharmaceuticals, Amicus Therapeutics, BioMarin Pharmaceutical, GlaxoSmithKline, Shire, Sanofi-Genzyme, and Synageva BioPharma. Dr Stein has received honoraria and travel grants from Shire. Dr Vijayaraghavan has received honoraria and travel grants from Shire and has participated in clinical trials with Shire. Dr Santra has received educational and travel grants from Shire and has participated in clinical trials with Shire and BioMarin Pharmaceutical. Dr Solanki has received honoraria and travel grants from and has participated in clinical trials with BioMarin Pharmaceutical and Shire. Drs Fan, Horton, and Perry and Ms Kearney have nothing to declare. Drs Mascelli, Pan, Sciarappa, and Barbier and Ms Wang are employees of Shire.

1132 - Combined Therapy With Genistein and Aldurazyme in an MPS-I Mouse Model

Marcelina H. Malinowska¹, Wioletta Kobiela¹, Joanna A. Jakobkiewicz-Banecka¹, Magdalena Gabig-Ciminska², Grazyna Peszynska-Sularz³, Jolanta Paradziej-Lukowicz³, and Grzegorz Wegrzyn¹

¹Department of Molecular Biology, University of Gdańsk, Gdańsk, Poland

²Laboratory of Molecular Biology (Affiliated With the University of Gdańsk), Instituite of Biochemistry, Warszawa, Poland

³Tri-City Experimental Animal House, Medical University of Gdańsk, Gdańsk, Poland

Introduction: Mucopolysaccharidosis type I (MPS-I) results from deficiency in α-l-iduronidase (IDUA) in lysosomes and subsequent accumulation of glycosaminoglycans (GAG). Clinical enzyme replacement therapy (ERT) with intravenous laronidase (Aldurazyme; Genzyme, Cambridge, Massachusetts) reverses some aspects of the disease but does not bring neurologic benefits because the blood–brain barrier blocks the enzyme from reaching the central nervous system. On the other hand, substrate reduction therapy with genistein improves neuropathology. We consider the possibility that a combination of ERT with SRT might provide some metabolic correction in the visceral organs as well as in the brain. Methods: In 3-month study, 8-week-old male and female MPS-I and wild-type mice received soy-free diet and 5 times a week genistein at dose 160 mg/kg/d as a suspension in 0.9% NaCl by oral gavage, weekly intrperitoneal injections of Aldurazyme at dose 100 U/kg, or combination of both. At the end point, mice were killed and tissues analyzed for GAG content. Results: After 3 months treatment, we observed that MPS-I mice responded to all of the tested therapies in a sex-dependent manner. Combination of ERT and SRT had a positive impact on liver and spleen size, however, did not have any greater therapeutic effects on liver and spleen GAG level than the enzyme replacement with Aldurazyme. Genistein-treated MPS-I mice had reduced GAG storage compared to untreated control but not to the level reached when the combined treatment or monotherapy with an enzyme was applied. None of the tested therapy had impact on GAG storage in the brain. Conclusion: Substrate reduction therapy with high dose of genistein combined with enzyme replacement therapy revealed beneficial effects on GAG storage in visceral organs but did not have impact on the brain.

1135 - Sibling Comparison Study of 10 Years of Enzyme Replacement Therapy for Mucopolysaccharidosis Type VI Starting at 3.5 Years and 8 Weeks of Age

Anita C. Inwood¹, Glen G. Gole², Geoffrey N. Askin³, Paul Pincus⁴, Jacqueline Cramb⁵, Christopher Whight⁶, John J. Hopwood⁷, and Jim J. McGill¹

¹Department of Metabolic Medicine, Royal Children’s Hospital, Brisbane, Australia

²University of Queensland Discipline of Paediatrics and Child Health, Royal Children’s Hospital, Brisbane, Australia

³Department of Orthopaedics, Mater Children’s Hospital, Brisbane, Australia

⁴Wesley Orthopaedic Clinic, Wesley Hospital, Brisbane, Australia

⁵Department of Physiotherapy, Royal Children’s Hospital, Brisbane, Australia

⁶Cardiology Department, Prince Charles Hospital, Brisbane, Australia

⁷LDRU, South Australian Health and Medical Research Institute, South Australia

Objective: To determine the advantages of early treatment with enzyme replacement therapy (ERT) using galsulfase (Naglazyme) in 2 siblings with mucopolysaccharidosis VI (MPS-VI). Previously published comparisons of the siblings were after 3.5 and 7 years of ERT. Methods: Galsulfase was given weekly at a dose of 1 mg/kg intravenously starting from 3.5 years and 8 weeks of age, respectively. The siblings were assessed after 10 years treatment. Results: Treatment has been well tolerated by both siblings with no infusion-associated reactions recorded. The younger sibling has preserved range of joint movement, normal liver and spleen size, and normal facial morphology and has only mild thickening of cardiac valves. He has developed mild scoliosis (23°), reduced height (crossed from the 90th to 3rd centile), and has mild to moderate corneal clouding. He has significant skeletal disease including avascular necrosis of the hips and has also required carpal tunnel surgery. The older sibling has maintained her initial marked improvement in joint range of movement and scoliosis mobility. She has softening of her facial features, stabilized mild cardiac valve pathology, and moderate corneal clouding. Her height is 11.7 cm below the first centile (after correcting for scoliosis). Rodding of her spine, which was considered necessary prior to initiating ERT, has now been deferred until completion of growth. She has required surgery for craniocervical compression and upper cervical instability, severe pes cavus, carpal tunnel syndrome, and genu valgum. Her kyphoscoliosis has slowly progressed. Conclusion: Early initiation of ERT prevents or slows the development of soft tissue features of MPS-VI. The greatest benefits occur with commencing ERT in the first few months of life. These benefits have become more evident over the 10 years of ERT. Even early initiation of ERT does not prevent skeletal disease in the severe phenotype of MPS-VI. Conflicts of Interest: BioMarin supplied the first 5 years of enzyme replacement therapy free of charge as part of a research trial. J. McGill and A. Inwood have received funding for travel and accommodation at educational meetings from BioMarin. Honorariums for presentations given by J. McGill and A. Inwood have been paid to the Royal Children’s Hospital. No other Author has a conflict of interest.

1140 - Delivering Enzyme Replacement Therapy for Mucopolysaccharidosis and Other Lysosomal Storage Disorders to the CNS Across the Blood–Brain Barrier

David John Begley¹

¹Institute of Pharmaceutical Science/Kings College London, London, United Kingdom

The restrictive nature of the blood–brain barrier (BBB) means that cellular machinery must be in place to deliver macromolecules to the brain. After intravenous infusion, most enzyme replacement therapy (ERT) does not reach the central nervous system as the mannose-6-phosphate receptor is downregulated at the BBB. Delivery of most macromolecules to the brain is achieved by systems of vesicular transcytosis, which are more complex than initially supposed, both in terms of structure and in terms of regulation. Brain endothelial cells exhibit relatively few endocytic vesicles compared to peripheral blood vessels but can still deliver macromolecules via 1 of the 3 main types of vesicles; the most numerous clathrin-coated vesicles containing adaptor protein complex 2, the smaller caveolae formed from lipid raft domains of the plasma membrane and the large fluid engulfing macropinocytotic vesicles. Both clathrin-coated vesicles, and, to a lesser extent, caveolae endocytose plasma membrane receptors and their specific ligands including insulin, transferrin and lipoproteins. This receptor-mediated transcytosis (RMT) delivers the ligands to the brain and enables their receptors to be recycled back to the plasma membrane. However, once endocytosed, the ligands and/or receptors must be directed toward the correct plasma membrane and avoid degradation in the late endosomes and lysosomes. How this is achieved has not been well studied, although there is an important role for Rab GTPases in targeting vesicles to their correct location and enabling exocytosis. This presentation will discuss what is currently known about RMT at the BBB and related cell types and how modified ERT may be able to cross the BBB and deliver enzyme to the brain.

1142 - Nursing and Enzyme Replacement Therapy

Sueli Canossa^1,2, Viviani T. Silva², Carolina S. Aranda², Marco A. Curiati², Carmen S. C. Mendes², Maret H. Rand², and Ana M. Martins²

¹Elza Nagy Canossa, Brazil

²Centro de Referência em Erros Inatos do Metabolismo, Universidade Federal de Sao Paulo, São Paulo, Brazil

Introduction/Objective:Mucopolysaccharidoses (MPSs) are a heterogeneous group of metabolic disorders caused by different enzymatic defects that increases glycosaminoglycan (GAG). Currently, there is treatment available for MPS-I, -II, and -VI through enzyme replacement therapy (ERT). The aim of this study is to report the nursing care in all steps involved in enzyme infusion for the treatment of MPS. Methods: To detail the nursing care to patient with MPS during routine infusions of different enzymes in Reference Center for Inborn Errors of Metabolism at Universidade Federal de Sao Paulo. Results: Patients with MPS-II (n= 13) and patients with MPS-VI (n = 7) were attended at infusion center weekly. Patients with MPS-I (n = 15) were assessed in different ways (11, weekly/4, and every other week). The following vital signs were assessed when the patient arrived at the center: temperature, heart rate, respiratory frequency, blood pressure, and oxygen saturation. Patients were questioned whether there is presence of infection and are using any medicine, including antibiotics. If the patient has a history of fever in the last 48 hours or in use of antibiotics in the first 72 hours, the infusion is suspended due to the higher risk of adverse reaction to the infusion of the enzyme in these situations. If the patient is able to receive the enzyme, venous access (VA) is installed (10 porth and 25 simple) and started the infusion as bulla. The signs are checked every 15 minutes during the first hour and then every hour. After the end of treatment, VA was washed with saline. The porth-a-cath is heparinized and simple VA is drawn, also emphasizing that nursing professionals should always pay attention to any slight, moderate, or severe reactions during infusion, which may require interruption of treatment. Conclusion: The nursing care to the patient with MPS during ERT requires training and experience to ensure patient’s safety and comfort.

1146 - Mucopolysaccharidoses: Cardiac Follow-Up and Effects of Enzyme Replacement Therapy

Erlane Marques Ribeiro¹, Ada Maria Farias Sousa Borges², Ida Vanessa Schwartz³, and Carlos Antônio Bruno da Silva⁴

¹Institute of Child, FMUSP, São Paulo, Brazil

²College of Medicine Estácio de Juazeiro-do-Norte, Estácio-FMJ, Juazeiro do Norte, Brazil

³Department of Genetics, Federal University of Rio Grande do Sul, Porto Alegre, Brazil

⁴Postgraduate Program in Health Sciences, Federal University of Rio Grande do Norte, Rio Grande do Norte, Brazil

Introduction/Objectives: Mucopolysaccharidoses (MPSs) are metabolic diseases whose progressive accumulation of glycosaminoglycans affects tissues of all organs, including the heart. The aim of this study was to describe the cardiac abnormalities of patients with MPS and report the experience of monitoring these cases. Methods: A cohort study of cases with MPS followed between 2002 and 2011. Data were obtained from information of medical records, interviews with patients and families, physical examination, and periodic cardiac evaluation with specific protocol. Results: We included 50 Brazilian patients (35 males and 15 female) with a median age of cardiac involvement of 4 years. Cardiac disease was present in all type of MPSs, although it occurred earlier and frequently in MPSs I, II, and VI than in MPSs III and IVA. Echocardiographic alterations were detected in 87% of cases, whereas 68% had abnormal auscultation and 8% presented with cardiovascular complaint. The most common findings were left valve lesion (78% mitral, 56% aortic, and 40% both) and left ventricular hypertrophy (15%). The most severe cardiac disease was cardiomyopathy. Enzyme replacement therapy could prevent (1 case), improve (1 case), and maintain (4 cases) the cardiac lesion. Conclusion: Cardiac involvement is present in most patients with MPS, although there are few clinical signs and symptoms. Left valve lesions and ventricular hypertrophy were the most characteristic cardiac finding in MPS. Enzyme replacement therapy may have a significant impact on progression of cardiac disease. Conflicts of Interest: Erlane Marques Ribeiro has received from BioMarin, Shire, and Genzyme travel expenses as part of continuous medical education, speakers honorarium, and grant as researcher for Hunter Outcome Survey. Ida Vanessa Schwartz has received from BioMarin, Shire, and Genzyme travel expenses as part of continuous medical education and grant as researcher for Hunter Outcome Survey. The other authors report no conflict of interest.

1148 - Phase 3 Study to Assess the Efficacy and Safety of Recombinant Human β-Glucuronidase in MPS-VII: A Novel Randomized, Placebo-Controlled, Blind-Start, and Single-Crossover Design and Analyses

Emil Kakkis¹, Alison Skrinar¹, and James Signorovitch²

¹Ultragenyx Pharmaceutical Inc, Novato, CA, USA

²Analysis Group, Inc, Boston, MA, USA

Background: Mucopolysaccharidosis type VII (MPS-VII, Sly syndrome), a lysosomal storage disorder caused by deficiency in β-glucuronidase (GUS), is multisystemic, chronically debilitating, and life threatening. Preliminary data from the ongoing open-label studies of recombinant human GUS (rhGUS) in 4 patients and prior successful enzyme replacement therapy (ERT) experience in MPS diseases comparable to MPS-VII support the continued development of ERT for MPS-VII. Objectives: A phase 3 study has been designed to accommodate the extreme rarity and clinical heterogeneity of MPS-VII, as the traditional randomized controlled study is inappropriate and infeasible. Methods and Results: The blind-start study design obscures when patients begin active treatment through the use of a placebo-crossover design to allow more objective assessments of clinical efficacy. The study would randomize 12 patients (aged 5-30) 1:1:1:1 to initiate double-blind active therapy at different time points from baseline, preceded by 0, 8, 16, or 24 weeks of placebo. All patients receive enzyme for 24 to 48 weeks; 75% of patients receive placebo for some time. Efficacy assessments are based on comparison of urinary GAG excretion and clinical end points from last pretreatment assessment to 24 weeks posttreatment in all patients. Placebo treatment data allow for additional supportive analyses. To address clinical heterogeneity, a multidomain responder index is intended to capture the aggregate effect across multiple clinical domains as a secondary end point. Safety reporting will be improved using a novel Adverse Physiology Related Group reporting intended to synthesize safety symptoms in a priori recognized multidomain symptom groups. Conclusion: The randomized, placebo-controlled, blind-start, and single-crossover study maximizes treatment outcome assessment in limited sample settings, reduces the impact of baseline randomization imbalance, and maintains objectivity in the placebo-controlled, double-blind assessments. Innovative use of safety and efficacy analyses may help studies in the small, heterogeneous populations. A phase 3 study is expected to start in 2014. Conflicts of Interest: EK and AS are employees of Ultragenyx Pharmaceutical Inc. JS is an employee of Analysis Group Inc, who has received consulting fees from Ultragenyx Pharmaceutical Inc.

1149 - Joint Amplitude in Children With Mucopolysaccharidose VI Undergoing Enzyme Replacement Therapy

Nicolette Celani Cavalcanti¹, Ana Carolina Esposito¹, Annaliese Barth¹, and Dafne Dain Gandelman Horovitz¹

¹Instituto Fernandes Figueira, Fiocruz, Rio de Janeiro, Brazil

Introduction and Objective: Contractures in mucopolysaccharidosis type VI (MPS-VI) are progressive and restrict movement and functionality in those affected by the disease. This study aimed to verify the degree of joint limitation and the evolution of range of motion (ROM) in patients with MPS-VI undergoing enzyme replacement therapy (ERT). Materials and Methods: A longitudinal study was carried out at Instituto Fernandes Figueira (IFF, Rio de Janeiro, Brazil) between July 2012, and March 2014, and 7 patients (aged 4-11 years) were included. Only 1 child was under regular physical therapy. Three or four goniometric assessments were performed using the mean values for analysis. Investigated movements were shoulder flexion; extension of elbows, wrists, hips, and knees; and dorsal flexion of feet. Results were computed as positive/negative results only for values that reached a minimum of 5° above or below the first assessment. Differences until 5° were considered as unchanged. The averages were recorded to check the existing lag and compared to normal ROM. Results: Discrepant loss of ROM, with variations from 7.4% to 46.7%, was registered in analyzed joints. Positive comparative results or unchanged ROM were obtained in 55.94% of cases, with emphasis on hips, wrists, and knees. The largest comparative losses of ROM were verified at the joints of feet, elbows, and shoulders. Conclusion: The evolution of ROM in patients undergoing ERT seems to be satisfactory in some of the studied joints; some joints, however, did not reach minimal results, dorsal flexion of feet being an example. Longitudinal studies involving more patients and MPS types, as well as longer follow-up, may provide more consistent data on this patient, which particularly affect the quality of life. Enzyme replacement therapy may help maintaining ROM, although the role of early physical therapy in enhancing ROM must be considered.

1151 - Hunter Disease: Experience With Enzyme Replacement Therapy in 5 Argentinian Patients

Norberto B. Guelbert^1,2, Adriana B. Becerra², Alicia N. Giner-Ayala², Ana M. Oller-Ramirez², Nidia Azar², Andrea Delgado², Dora Martinez², Sandra Antonozzi², and Guillermo A. Guelbert²

¹Jefe Servicio Enfermedades Metabolicas Hospital de Niños, Cordoba, Argentina

²Centro de Estudio de las Metabolopatías Congénitas (CEMECO), Hospital de Niños, Cátedra de Pediatría, Torrelodones, Spain

Introduction: The Hunter disease (HD) is an X-linked multisystemic lysosomal disease. The deficiency in iduronate sulfatase produces glycosaminoglycans (GAGs) that accumulates in tissues and organs resulting in a broad clinical spectrum with moderate to severe phenotypes. Enzyme replacement therapy (ERT) with recombinant human iduronate sulfatase attempts to correct the pathophysiology of HD reversing and preventing accumulation of GAGs. Objectives: (1) To communicate the relative prevalence of HD in Cemeco, Córdoba, and Argentina. (2) To show clinical, biochemistry, enzyme, and molecular experience in these patients. (3) To assess the effects of ERT with idursulfase in 5 patients. Methodology: We review the casuistry of Cemeco, covering a period of 32 years (1981-2013). The diagnoses were confirmed by assay of urinary GAGs, enzymatic assay in plasma, leukocytes and/or dried blood, and molecular studies in 6 cases. Results: Fifty-nine patients were diagnosed as having some form of mucopolysaccharidosis. Fifteen (25%) males were HD. The age at diagnosis ranged from 3 to 10 years. Genotype was identified in 6 patients with 5 different mutations, 3 of them were new. Two patients were found to have “novo mutation.” In its natural evolution, 9 patients died around the first decade of life, and 1 died at 2 years in association with congenital heart disease. Of the remaining 5 patients, 1 received bone marrow transplantation at 6 years without success. All started with ERT between 10 and 15 years, with no record of adverse effects, showing decrease in urinary GAGs and organomegaly and improvement in the quality of life. However, torpid evolution was due to erratic infusions. Two patients died of lung disease and another had sudden death. Conclusion: The HD has a high prevalence in our study. The ERT was beneficial in patients who received it, but late diagnosis and irregularity in infusions are factors of high morbidity and mortality. Early diagnosis and ERT represent a prerequisite for therapeutic success.

1161 - Enzyme Replacement With Laronidase for Patients With MPS-I: A Systematic Review and Meta-Analysis

Taciane Alegra¹, Alicia D. Dorneles², Dauana P. Eizerik¹, Osvaldo Artigalás¹, Tiago V. Pereira³, Andry F. Costa², and Ida V. D. Schwartz⁴

¹Post Graduation Program in Genetics and Molecular Biology, Rio Grande do Sul, Brazil

²Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

³Hospital Alemão Oswaldo Cruz, São Paulo, Brazil

⁴Genetics Department, Federal University of Rio grande do Sul, Porto Alegre, Brazil

Introduction: Mucopolysaccharidosis type I (MPS-I) is an autosomal recessive lysosomal storage disorder caused by deficiency in α-l-iduronidase. Patients with MPS-I present with multisystemic involvement and can be treated with enzyme replacement therapy (ERT) with laronidase in dose of 0.58 mg/kg/wk. Methods: To evaluate the efficacy and safety of ERT through systematic review of literature and meta-analysis. Studies comparing laronidase with other intervention were searched on Clinical Trials, Cochrane Library, MEDLINE, EMBASE, and LILACS databases up to February 18, 2014. Inclusion criteria were randomized controlled trials (RCTs) or—in absence of it—prospective case series with ≥5 patients that evaluate relevant outcomes. Results: We identified 345 articles, but only 10 met the inclusion criteria. In all, 1 RCT comparing idursulfase to placebo and 09 prospective case series were included in the study. It was possible to perform meta-analysis with some outcomes with the following results: reduction in liver size (mean change of 27.5% [confidence interval (CI) 95% −31.6 to −23.4]), normalization of liver size in 87% of patients, and reduction in urinary glycosaminoglycans (−68 µg/mg creatinine [CI 95% −74.6 to −61.4]); however, there were no significant difference in distance covered in the 6-minute walk test (mean change 17.16 m [CI 95% −5.9 to 40.2]). Other outcomes included in meta-analysis were adverse events related to treatment or infusion (63% and 47% of patients had at least 1 event, respectively) and development of immunoglobulin G antibodies to laronidase (71% of patients). Conclusion: Laronidase can bring some benefits to patients with MPS; however, the majority of the studies evaluated surrogate end points. Clinical heterogeneity and small size sample also limited the conclusions about the effect of ERT in MPS-I. Support: CNPq.

1162 - Intrathecal or Intravenous Recombinant Human α-l-Iduronidase Improves Brain Myelination in Canine MPS-I

Patricia I. Dickson¹, James M. Provenzale^2,3, Steven Chen², Igor Nestrasil⁴, Jennifer Yee¹, Shih-hsin Kan¹, Steven Q. Le¹, Jacqueline Jens⁵, Elizabeth Snella⁵, Miguel A. Guzman⁶, Charles Vite⁷, Elsa G. Shapiro⁴, and N. Matthew Ellinwood⁵

¹LA BioMed at Harbor-UCLA, Torrance, CA, USA

²Department of Radiology, Duke University, Durham, NC, USA

³Department of Radiology, Emory University, Atlanta, GA, USA

⁴Department of Pediatrics, University of Minnesota, Minneapolis, MN, USA

⁵Department of Animal Science, Iowa State University, Ames, IA, USA

⁶Department of Pathology, Saint Louis University, St Louis, MO, USA

⁷School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USA

Introduction: Children with mucopolysaccharidosis type I (MPS-I) show reduced fractional anisotropy (FA, a measure of white matter integrity) on diffusion tensor imaging (DTI) of the corpus callosum (CC) that correlates with diminished attention. Our studieson MPS-I dogs suggest that reduced volume and FA in the CC are caused by abnormal myelination. We therefore studied the impact of enzyme replacement therapy (ERT) with recombinant human α-l-iduronidase on abnormal myelination in the canine CC. Methods: The MPS-I dogs received intrathecal (IT) ERT 0.05 mg/kg every 3 months and/or intravenous (IV) ERT 0.58 to 2.0 mg/kg weekly. Untreated MPS-I and unaffected carriers were used as controls. Dogs underwent brain magnetic resonance imaging and DTI. Corpus callosum was evaluated using sandwich enzyme-linked immunosorbent assay for myelin basic protein (MBP), reverse transcription-polymerase chain reaction for myelin-related gene expression, lipidomics, and electron microscopy. Results: Mean whole CC volumes were lower in MPS-I dogs versus carriers (P = .02). Corpus callosum volume was preserved with IT ERT (P = .006 vs untreated MPS-I). Fractional anisotropy was reduced in MPS-I dogs versus carriers (P = .004). Myelin basic protein in CC of treated MPS-I, untreated MPS-I, and carrier dogs correlated with FA (r ² = .56, P = .01) and inversely correlated with radial diffusivity (r ² = .51, P = .02), demonstrating a relationship between CC myelination and DTI. We found decreased myelination in MPS-I dogs ≥6 weeks. Myelin composition was abnormal in MPS-I dogs. Neuroimaging findings, MBP, and myelin lipid composition in the CC was improved with administration of IT ERT, even if started at 4 months. Expression of myelin-related genes in CC improved in MPS-I dogs treated with IT and/or IV ERT beginning at ≤30 days. Conclusion: Reduced CC volume and FA in MPS-I dogs may be caused by abnormal myelination. Intrathecal and/or IV ERT improves abnormal myelination in the CC, especially if treatment begins early. Conflicts of Interest: The Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center and the Department of Pediatrics at Harbor-UCLA (but not the authors) receive royalties from the sale of recombinant human α-l-iduronidase (laronidase). PID, EGS, and NME receive research support from BioMarin and/or Genzyme, which manufacture and distribute laronidase.

1172 - Benefits of Early Enzyme Replacement Therapy

Patricia Pontes Cruz¹, Krysna Pires Lessa¹, Laercio Moreira Cardoso Junior², Emilia Katiane Embiruçu de Araújo Leão¹, and Angelina Xavier Acosta^3,4

¹State University of Bahia, Federal University of Bahia (UNEB), Salvador, Brazil

²Faculty Medicine of Bahia, Federal University of Bahia (UFBA), Salvador, Brazil

³Faculty Medicine of Bahia, Salvador, Brazil

⁴Medical Genetics Service HUPES/UFBA, Salvador, Brazil

Objective: To evaluate early treatment with enzyme replacement therapy (ERT) in 2 siblings with mucopolysaccharidosis (MPS) VI (MPS-VI) and identify possible influence of extrinsic factors on prognosis. Methodology: Case report of 2 siblings with biochemical diagnosis of the MPS-VI from Monte Santo - Bahia, and onset of the ERT in different ages. To compare the clinical assessment and the importance of early treatment. Results: The brothers are 12 and 5 years old and both use ERT with galsulfase (rhASB5) weekly, with no reports of adverse reactions to treatment. The older brother started treatment when he was 6 years old and with clinical manifestations of the disease and the youngest, when he was 6 months and asymptomatic. Nowadays, both have corneal clouding, claw hands, important limitations to the elevation, and extension of the upper limbs, pectus carinatum, and arched feet. The older brother has major kyphoscoliosis and difficulties in reading and writing, unlike the younger brother who achieves good academic performance. It was observed that, when starting treatment, the elder brother had height and body mass index equal to 0.947 m (p3) and 16.27 kg/m² (p50), repectively, similar values when compared to younger brother new with 3 years old, 0.96 m (p50) and 17.57 kg/m² (p50-98), respectively. The younger brother has a more limited extension of the lower limbs, which may be related to extrinsic factors. Both perform physical therapy weekly, and only the older brother practices physical activities such as riding bike daily. Conclusion: Both the patients have the same genetic mutation, but early diagnosis and treatment promote a better prognosis. The enzyme has low penetration into bone tissue and poorly vascularized structure; however, it is possible that regular physical activity, to ride bike, for example, may be to contribute to further reduction in joint limitations, especially in the lower limbs.

1176 - Evidence That Enzyme Replacement Therapy Decreases White Blood Cell GAG Storage in Patients With MPS-IVA

Guilherme Baldo¹, Fabiano Poswar², Andressa Ferhen², Rejane Gus Kessler², Fernanda Bender², and Roberto Giugliani²

¹Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

²Hospital de Clinicas de Porto Alegre, Porto Alegre, Rio Grande do Sul, Brazil

Objective: To evaluate the effect of enzyme replacement therapy (ERT) upon glycosaminoglycan (GAG) storage in white blood cells (WBCs) from peripheral blood of patients with MPS-IVA who participated in a phase III double-blind placebo-controlled randomized clinical trial (Strive, sponsored by BioMarin Pharmaceutical, Novato, California), comparing weekly infusion (ERT-W) versus every other week (ERT-EOW). Methods: Three groups of patients were evaluated. In the first group (n = 4), patients were treated weekly (ERT-W) with 2.0 mg/kg of recombinant human N-acetylgalactosamine-6-sulfatase (BMN110, approved by Food and Drug Administration [FDA] as Vimizin; BioMarin Pharmaceutical). The second group (n = 6) received the same dose every other week (ERT-EOW). In the third group (n = 6), patients were infused with placebo (PLA). White blood cells were collected after 6 months of treatment and stained with Giemsa. One hundred WBCs were evaluated for GAG granules by a blinded evaluator regarding treatment groups, and cells were classified as (1) cells with no visible GAG granules; (2) with less than 10 granules; or (3) with more than 10 granules. Results: Comparing PLA versus both treated groups altogether, ERT increased the number of cells without observed GAG storage (18% of cells in PLA vs 52% in ERT treated, P < .01), suggesting it was effective in clear GAG storage. When the treated groups were separated according to regimen, ERT-W patients had the biggest improvement (58%, P < .01 vs PLA), while ERT-EOW had intermediate levels of cells with no GAG (51%, P = .016 vs PLA, not different from ERT-W). Also, cells presenting more than 10 granules reduced in both treated groups (21% in PLA vs 9% in ERT-EOW and only 5% in ERT-W, P < .01 in both cases, without difference between treated groups). Conclusion: Our results support that Vimizin is effective to decrease WBC GAG storage in patients with MPS-IVA. Although both regimens lead to GAG storage decrease, weekly ERT (as approved by the Food and Drug Administration) showed slightly better performance than ERT-EOW.

1192 - Infusion Reactions Related to Enzyme Replacement Therapy in Pediatric Patients With Mucopolysaccharidoses I and II: Frequency and Management

Cláudia Vanzella¹, Andressa Federhen², Clarissa Gutierrez Carvalho³, Débora Cardoso Dantas⁴, Thabata Siqueira⁴, Taiane Vieira⁴, and Roberto Giugliani⁴

¹Post-Graduation Program in Biological Sciences: Biochemistry, UFRGS, Porto Alegre, Brazil

²Post-Graduation Program in Child in Adolescent Health, UFRGS, Porto Alegre, Brazil

³Neonatology Service, Hospital de Clínicas de Porto Alegre, UFRGS, Porto Alegre, Brazil

⁴Medical Genetics Service, Hospital de Clínicas de Porto Alegre, UFRGS, Porto Alegre, Brazil

Objectives: The aim of this study was to investigate the frequency of the most common infusion reactions in pediatric patients with mucopolysaccharidoses (MPS) I and II receiving weekly enzyme replacement therapy (ERT) with laronidase and idursulfase, respectively, as well as describing the management of those reactions. Methods: Descriptive and retrospective study including a sample of 13 patients with MPS-I and 33 with MPS-II. Results: In the MPS-I group, 7 (53%) patients showed no reaction during the infusion, whereas in the MPS-II group, 11 (36%) presented no infusion reaction. The median time for the first infusion reaction for MPS-I and MPS-II was observed at fifth (2nd to 16th) and seventh (1st to 37th) week of infusion, respectively. The main reactions observed in patients with MPS-I and MPS-II involved the skin such as erythema and cutaneous rash (23% and 30%, respectively); gastrointestinal symptoms such as nausea, vomiting, and diarrhea (23% and 21%, respectively); and fever (23% and 27%, respectively). Antihistamines and antipyretics were administered to treat these acute symptoms of ERT. In some patients, corticosteroids were administered to attenuate allergic reactions. Interestingly, 7 (21%) patients with MPS-II presented increase in blood pressure level, whereas patients with MPS-I did not show this finding. Conclusion: In this study, we observed that the period of the first infusion reaction was similar for both MPSs evaluated as well as the main signs and symptoms of infusion reactions. In this context, the continuous monitoring of patients receiving ERT is essential, especially at the beginning of treatment. The introduction of premedication prevented infusion-related events in many patients who previously experienced infusion reactions.

1195 - Enzyme Replacement Therapy With Double-Dose Laronidase Every Other Week is Safe and Effective: Case Reports and Glycosaminoglycan Excretion Patterns in 11 Patients With Mucopolysaccharidosis Type I

Carolina Moura de Souza¹, Dafne Horovitz², Ana Carolina Esposito², Maria Luicia Oliveira³, Fernanda Scalco³, Llerena Juan², Angelina Acosta⁴, Filippo Vairo¹, Laercio Moreira Cardoso Junior⁴, Emilia Katiane Empiruçu Leao⁴, AL Barth³, and Roberto Giugliani¹

¹Medical Genetics Service, Hospital de Clinicas de Porto Alegre, Porto Alegre, Brazil

²Instituto Nacional de Saúde da Mulher, da Criança e do Adolescente Fernandes Figueira, FIOCRUZ, Rio de Janeiro, Brazil

³Laboratório de Erros Inatos do Metabolismo, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

⁴Serviço de Genética Médica, Universidade Federal da Bahia, Salvador, Bahia, Brazil

Laronidase (Aldurazyme) is approved for enzyme replacement therapy (ERT) in mucopolysaccharidosis I (MPS-I) at the dose of 0.58 mg/kg once-weekly intravenous infusions. In a dose-optimization trial (Giugliani et al, Mol Genet Metab 2009), an alternative regimen of 1.2 mg/kg every other week was proven efficient and considered acceptable for specific patients. We aimed to evaluate and compare safety and efficacy of laronidase 1.2 mg/kg every 2 weeks versus the 0.58 mg/kg weekly dose in 2 patients with MPS-I. In all, 11 patients with MPS-I (3 males/5 females; 2 Hurler, 3 Hurler-Scheie, and 3 Scheie), aged 5 to 25 years, had their dosing regimen changed from 0.58 mg/kg weekly to 1.2 mg/kg every 2 weeks. All had been on ERT for over 1 year, responding well and had not presented adverse events. Preinfusion medication was administered to 50% of the patients. The follow-up protocol for MPS-I as recommended by MPS-I Registry was performed, and urinary glycosaminoglycan (GAG) levels were monitored. The length of the every other week infusion regimen ranged from 12 to 39 months (mean 23.2 months). Only the younger patient with Hurler syndrome presented adverse infusion-related events (4 hyperthermia episodes controlled with antipyretics). No significant differences between mean GAG excretion with 0.58 mg/kg weekly or 1.2 mg/kg every 2 weeks were observed. The double-dose every other week infusions did not change the disease progression or the urinary GAG excretion. All families were satisfied with such alternative for ERT, especially due to less school/work days missed and fewer venipunctures. We believe this may be an acceptable treatment for MPS-I. Longer dosing studies involving more patients must be encouraged, as this is a long-term therapy and longer interval between infusions could be a meaningful change in patients’ quality of life.

1204 - Evaluation of Biochemical Parameters From the Protocol of Nutritional Care of Patients With Mucopolysaccharidosis Undergoing Enzyme Replacement Therapy at CREIM—UNIFESP

Renata B. Oliveira¹, Beatriz J. Frangipani¹, Cintia M. Gonçalves¹, José A. O. Silva¹, Vaneisse C. L. Monteiro¹, Sandra O. Kyosen¹, and Ana Maria Martins¹

¹Centro de Referência em Erros Inatos do Metabolismo, Universidade Federal de Sao Paulo, São Paulo, Brazil

Introduction: During the follow-up of patients with mucopolysaccharidosis (MPS) on enzyme replacement therapy (ERT) at Centro de Referência em Erros Inatos do Metabolismo, Universidade Federal de Sao Paulo, an evaluation of semiquantitative food frequency was achieved by the dietitians. An inadequate intake of vegetables, fruits, fats, and sugars was observed. Based on these results, it was assumed that it would be necessary to do a quantitative assessment of dietary intake and nutritional assessment of relevant biochemical parameters. Objective: To assess the dietary intake and biochemical profile of patients with MPSs-I, -II, and -VI under ERT. Methodology: The dietary intake was assessed by records taken on every other day for 3 days. The biochemical parameters assessed were the serum concentrations of total proteins and fractions, iron, ferritin, transferrin, zinc, folic acid, glucose, total cholesterol and fractions, and triglycerides. Results: In the evaluation of food intake, no mismatches were found in the consumption of macronutrients in relation to the total calories; however, low calcium intake was observed in 88% of the patients and low iron, vitamin A, zinc, and magnesium in approximately 40% of them. In the serum lipid profile analysis, 24% will show a decrease in high-density lipoprotein and 12% an increase in low-density lipoprotein. No changes were found in serum concentrations of protein, iron, ferritin, glucose, zinc, and folic acid. Conclusion: The quantitative measurement of food intake in patients with MPS reinforces the need for nutritional counseling and expansion of biochemical parameters.

1206 - Effects of Discontinuing Enzyme Replacement Therapy in Mucopolysaccharidosis I Mice

Ana Paula Schneider¹, Gabriela Pasqualim¹, Fabiana Q. Mayer², Bárbara Z. Martinelli¹, Talita G. de Carvalho¹, Guilherme Baldo¹, Roberto Giugliani¹, and Ursula Matte¹

¹Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

²Fundação Estadual de Pesquisa Agropecuária, Porto Alegre, Brazil

Introduction/Objective: Enzyme replacement therapy (ERT) for mucopolysaccharidosis I (MPS-I) was approved more than a decade ago. Although efficient in correcting some aspects of the disease, patients need to obtain the enzyme with the public health system, often leading to treatment interruption. Therefore, we aimed to evaluate mice that were subjected to treatment interruption and reintroduction of ERT. Methods: Four groups of animals were analyzed. In the first group, MPS-I mice were treated with ERT (laronidase, 1.2 mg/kg every 2 weeks) from birth (ERT), with no interruption. A second group of mice had treatment interrupted from 2 to 4 months of age (ERT-int). These mice were compared to normal (Idua+/+) and untreated MPS-I mice, analyzing urinary and tissue glycosaminoglycans (GAGs), heart function, behavior, aortic distension, and antibody formation. All mice were killed at 6 months. Results: Urinary GAGs were reduced in both treated groups, including during treatment interruption. Liver, heart, and lung GAG levels were normalized. At 6 months, the ejection fraction values were similar to normal mice in both the treated groups. Behavior in the open field test was also normalized in treated groups. Aortic walls were significantly more distended in ERT-int group. Interestingly, treatment interruption did not lead to antibody formation after its reintroduction, suggesting that neonatal ERT induced an immune tolerance that was maintained even if the enzyme was reintroduced later in life. Conclusion: We suggest that treatment interruption may have deleterious effects on organs that, during the disease course, have structural changes, such as the aortas. Furthermore, urinary GAG levels may not accurately reflect disease status since it was not changed after a few weeks of interruption, and yet deleterious effects were found in some organs. Financial support: FAPERGS, FIPE-HCPA, and CNPq.

1208 - Rapid Improvement in Respiratory Parameters in a Patient With Mucopolysaccharidosis II After 6 Months of Enzyme Replacement Therapy

Filippo Vairo¹, Carolina Souza¹, Karyn Koladicz¹, Simone Fagondes², and Roberto Giugliani¹

¹Medical Genetics Service, Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

²Pneumology Department, Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

Mucopolysaccharidosis type II (MPS-II) is a multisystemic and progressively debilitating disorder; however, the rate of progression varies among the patients. Sleep disturbances are common disorders in patients with MPS-II, especially obstructive sleep apnea. Polysomnography (PSG) has been recommended for evaluation of patients with MPS and is included as a major outcome measure of the efficacy of enzyme replacement therapy (ERT). We report a case of a 13-year-old patient with MPS-II, genotype p.D497G, iduronate sulfatase in plasma 3.3 nmol/4 h/mL (NR: 122-463), and glycosaminoglycan analysis at the diagnosis of 495 μg/mg creatinine (NR: 44-106). He presented umbilical and inguinal hernia, carpal tunnel syndrome, hypoacusia, and mild pulmonary hypertension. The pretreatment PSG showed severe obstructive sleep apnea with apnea–hypopnea index (AHI) of 10.1 events/h of sleep, according to pediatric criteria. After 6 months of weekly ERT, the PSG demonstrated AHI of 0.4 event/h of sleep (0.2 of apnea events and 0.2 of hypopnea events), and the mean oxyhemoglobin saturation during sleep was 98%. There were no other clinical or surgical interventions besides ERT. Based on this experience, we recommend that any child with MPS-II, even without sleep complains, should undergo a sleep study since the ERT may rapidly improve respiratory parameters.

1209 - Intrathecal Delivery of Iduronidase Has Beneficial Effects on Cognitive Function in a Patient With Mucopolysaccharidosis Type I

Igor Nestrasil¹, Elsa Shapiro¹, Patricia Dickson², Agnes Chen², Edward Stehel³, Sarah McNeil³, Alia Ahmed¹, and Elizabeth Maher³

¹University of Minnesota, Minneapolis, MN, USA

²Los Angeles Biomedical Institute at Harbor-UCLA University of California – Harbor, Torrance, CA, USA

³University of Texas Southwestern Medical Center, Dallas, TX, USA

Introduction: Treatment with human α-l-iduronidase (rhIDU, laronidase) to replace the deficient enzyme in mucopolysaccharidosis type I (MPS-I) has significantly improved symptoms and quality of life. However, progressive cognitive decline has become a major problem, despite treatment with intravenous rhIDU. Intrathecal (IT) administration of rhIDU provides delivery of rhIDU directly to the central nervous system. We studied IT rhIDU in a single patient with MPS-I who had measureable decline in memory assessments for neurocognitive decline 18 months prior to treatment. Methods: A 23-year-old man with MPS-I (Hurler-Scheie syndrome) received IT rhIDU (1.74 mg) monthly for 3 months and every 3 months thereafter for 2 years. Serial cognitive function and structural brain magnetic resonance evaluations were conducted. Results: Borderline canal stenosis of the craniocervical ligamentous complex without complete block of cerebrospinal fluid (CSF) flow was found on pretreatment CSF flow study. After 24 months of treatment, there was a marked improvement in all cognitive function measures including intelligence quotient scores (4%-8%), visual memory scores (9%-15%), adaptive behavior scores (17%), and verbal learning scores (57% total and 104% delayed recall). Attention scores were stable. Brain MRI volumetrics revealed 2.7% increase in white matter volume and 2.1% decrease in gray matter, consistent with changes seen due to normal brain aging. Hippocampal volumes were significantly decreased (6%-7%), which correlated with improved memory outcomes (r = .6-.8). There were no adverse events. Conclusion: This patient with MPS-I showed significant improvement in cognitive function during the 2-year treatment with IT rhIDU. We speculate that the decrease in hippocampal volume might be due to reduction in glycosaminoglycan storage material in that structure. A phase I clinical trial is underway to determine the impact of IT rhIDU on cognitive function in patients with MPS-I.

1210 - Evaluation of Sleep Architecture and Respiratory Profile in Children With Mucopolysaccharidosis Type VI Before and After Enzyme Replacement Therapy

Juliana L. Oliveira¹, Júlia de Carvalho Lopes¹, Regina Terse Trindade Ramos², Juliana Leal Oliveira¹, and Angelina Xavier Acosta²

¹Bahia School of Medicine, UFBA, Salvador, BA, Brazil

²Department of Pediatrics, Bahia School of Medicine, UFBA, Salvador, BA, Brazil

Introduction: Mucopolysaccharidosis type VI (MPS-VI) is a lysosomal storage disease caused by deficiency in enzyme involved in the degradation of glycosaminoglycans (GAGs). Consequently, GAGs accumulate in several tissues, including the upper air way and tracheobronchial tree, which leads to the development of obstructive sleep apnea syndrome (OSAS). The enzyme replacement therapy (ERT) brought clinical and biochemical benefits for these patients, but its effects on sleep architecture and polysomnographic respiratory profile still need to be better studied. Objective: To evaluate the sleep architecture and polysomnographic respiratory profile of patients with MPS-VI before and after administration of ERT. Methods: This is an observational retrospective cohort study, based on data obtained from medical records, in which 14 patients with a diagnosis of MPS-VI were enrolled. Results: The mean age at MPS-VI diagnosis was 4.5 years, and the mean age at the start of ERT was 6.9 years. Obstructive sleep apnea syndrome was present in 100% of patients at baseline polysomnography, and 78.6% were classified as severe form. At the second polysomnography, the mean time on ERT was 1.9 ± 0.7 years. In this examination, 77.8% of patients met the criteria for OSAS. Patients also showed decreased latency to sleep and increased rapid eye movement latency, increased number of arousals, desaturation, and hypoxemia during sleep. Conclusion: We found no statistically significant improvement in polysomnographic indices after the institution of ERT. This may be partly due to the small sample size and the different elapsed time between the first and the second polysomnography.

1212 - Caregivers’ Perceptions of Enzyme Replacement Therapy With VIMIZIM (Elosulfase α) in Patients With Mucopolysaccharidosis IVA

Débora Maria Bastos Pereira¹, Larissa Silva¹, Karine Bertoldi¹, Clarissa Troller Habekost¹, Camila Matzenbacher Bittar¹, Andressa Federhen¹, and Roberto Giugliani¹

¹Hospital de Clinicas de Porto Alegre, Porto Alegre, USA

Introduction: Mucopolysaccharidosis IVA (MPS-IVA or Morquio A) is a progressive autosomal recessive disease caused by deficiency in the enzyme galactosamine-6-sulfate sulfatase (GALNS; also known N-acetylgalactosamine-6-sulfate sulfatase) encoded by the GALNS gene. Recently, enzyme replacement therapy (ERT) with VIMIZIM (elosulfase α; Biomarin Pharmaceutical, Novato, California) was approved in United States by Food and Drug Administration. Objectives: To investigate the perceptions of MPS-IVA caregivers in regard to the ERT through the use of a treatment evaluation questionnaire. Methods: A 6-question questionnaire was applied to caregivers of 16 clinical trial participants for the study of ERT in Morquio A. Patients were allocated into 3 different groups: drug every week, drug every other week alternated with placebo, or placebo every week. Questions included the caregivers’ perceptions about the ERT benefits, side effects, and allocation in the groups. Results: The median age of patients was 14 years (ranged from 5 to 35). In all, 50% of the caregivers believed their relatives were in the alternated drug/placebo group, 44% considered their relatives were in the placebo group, 0% thought their relative was receiving the drug weekly, and 6% didn’t answer the question. The main benefits appointed were the opportunity of receiving a treatment, the easy access to examinations and medical support, and the possibility of interaction with other patients. As important drawbacks, absence from school, frequent traveling, and staying away from home were the main ones. Although 75% of caregivers believed the benefits outweigh the detriments, 25% answered that the advantages partially outweigh the costs. Among the observed benefits, the caregivers reported improvement in height and weight gain, emotional stability improvement, and decrease in respiratory symptoms. In a scale from 0 to 10 (really bad to very good), 99% of caregivers evaluated the Research Center where the ERT was provided as grade 10. Conclusion: The majority of caregivers believe that the ERT has beneficial effects on the patients’ life and they were very satisfied in taking part of an international clinical trial.

1222 - Production of Active Recombinant Human Sulfatases Iduronate 2-sulfate and N-acetylgalactosamine-6-sulfate in Microorganisms

Alexander Rodríguez-López¹, Dennis Díaz¹, Laura Laura¹, Jefferson Moreno¹, Sergio Díaz¹, Natalia Pimentel¹, Ángela Mosquera¹, Carlos Soto¹, Olga Velásquez², Alejandra Hernández², Felice Leonardi², Ángela Espejo¹, Henry Córdoba¹, Oscar F. Sánchez², Carlos J. Alméciga-Díaz¹, and Luis A. Barrerra¹

¹Institute for the Study of Inborn Errors of Metabolism, Pontificia Universidad Javeriana, Bogotá DC, Colombia

²Department of Chemical Engineering, Universidad de Los Andes, Bogotá DC, Colombia

Objective: Lysosomal enzymes for enzyme replacement therapy are produced in mammalian cells. Here, we summarize our results for the production of human lysosomal sulfatases in Escherichia coli and Pichia pastoris. Methods: Escherichia coli and the methylotrophic yeast P pastoris were used as systems for the production of sulfatases iduronate 2-sulfate (IDS) and N-acetylgalactosamine-6-sulfate. The enzymes were produced at bench and bioreactor (up to 3 L) scales. Different conditions of temperature, pH, and dissolved oxygen were evaluated. In addition, presence or absence of native signal peptide was evaluated as well as cotransformation with sulfatase modifying factor 1. Results: Recombinant IDS was expressed in P Pastoris, although it was found mainly as intracellular aggregates. After solubilization of aggregates, enzyme activity values reached up to 30 U mg⁻¹. Also, the production was evaluated by using optimized and native IDS gene. The highest enzyme activity values were observed under conditions of limited oxygen and using the optimized IDS sequence (34-fold higher than those obtained using the native gene). On the other hand, results show that although a larger amount of human N-acetylgalactosamine-6-sulfate sulfatase (hGALNS) in E coli was obtained in the inclusion bodies, only a limited fraction of it was active. Removal of the signal peptide had a negative impact on GALNS activation and secretion, although it reduced the formation of inclusion bodies. Secretion of recombinant GALNS was favored up to 5 times under semicontinuous culture conditions. N-Acetylgalactosamine-6-sulfate sulfatase of 0.29 U mg⁻¹ was obtained from E coli. Finally, GALNS production was performed in P pastoris, and 25.34 U mg⁻¹ of purified GALNS without signal peptide were obtained. Conclusion: In summary, these results show the feasibility for the production of active recombinant IDS and GALNS enzyme in E coli and P pastoris, which could be used for the development of an enzyme replacement therapy for Hunter and Morquio A diseases.

8. Transplantation/Immunology

1016 - Outcomes After Hematopoietic Stem Cell Transplant for Children With I-Cell Disease

Troy Lund¹, Weston Miller¹, Sarah Cathey¹, and Paul Orchard¹

¹University of Minnesota, Minneapolis, MN, USA

Introduction: Mucolipidosis type II (ML-II) is a rare but severe lysosomal storage disorder affecting localization of enzymes to the lysosome, generally resulting in death before the 10th birthday. Hematopoietic stem cell transplant (HSCT) has been used to successfully treat some lysosomal storage diseases, although there have been only 2 case reports in the use of HSCT to treat ML-II. Methods: For the first time, we describe the combined international experience in the use of HSCT for ML-II in 22 patients. Transplant-related data and outcomes were obtained from the Center for International Blood & Marrow Transplant Research. Results: The median age of transplant was 9 months (range 2-20 months) with 14 children receiving umbilical cord blood and the 8 receiving bone marrow grafts. The majority of the conditioning regimens were myeloablative in intent. Ninety-five percent of the patients engrafted with both neutrophil and platelets. The overall survival was low with only 5 (27%) patients alive at last follow-up. Median survival after transplant was 29.7 months, and the most common cause of death posttransplant was cardiovascular complications, most likely due to disease progression. Importantly, survivors were globally delayed in development and often required complex medical support such as gastrostomy tubes for nutrition, had no ambulation, and required tracheostomy with mechanical ventilation. Conclusion: Although HSCT has demonstrated efficacy in treating some LSDs, the neurologic outcome and survival for patients with ML-II were poor and not clearly different from the natural history of the disease. New medical and cellular therapies should be sought perhaps through substrate reduction, enzyme replacement, or gene therapy.

1032 - Effectiveness of Hematopoietic Stem Cell Transplantation in Combination With Enzyme Replacement Therapy in Mucopolysaccharidosis Type I-Hurler

Norberto B. Guelbert¹, Adriana B. Becerra¹, Alicia N. Giner¹, Nidia Azar¹, Nadia A. Gomez¹, Sandra L. Antonozzi¹, Lourdes A. Peralta¹, Ana L. Basquiera², Guillermo A. Guelbert¹, and Adriana Berretta²

¹Servicio Enfermedades Metabólicas, Hospital de Niños de Cordoba, Córdoba, Argentina

²Servicio de Hematología y Oncología, Hospital Privado Centro Médico de Córdoba, Córdoba, Argentina

Introduction: Hurler syndrome is the most severe form of mucopolysaccharidosis I (MPS-I). Due to the enzyme replacement therapy (ERT), it does not cross the blood–brain barrier and hence does not prevent neurological complications. The hematopoietic stem cell transplant (HSCT) is the preferred and more effective therapy for this syndrome. Objective: To report our experience with the combination of HSCT–ERT as early treatment in MPS-IH. Case 1: Male at 8 months of age diagnosed with bone dysostosis (lumbar gibbus) and psychomotor retardation and elevated urinary glycosaminoglycans (GAGs) and α-iduronidase deficiency (0.093 nmol/h/mg protein). Genotyping: Heterozygous (p.P533R known mutation and p.N350fs previously unreported). He started ERT at 11 months (laronidase 0.58 mg/kg/wk) normalizing the excretion of GAGs. At 17 months, an HSCT (a 9/10 HLA-mismatched unrelated cord blood) was performed without complications. Two months after HSCT, the chimerism was 57.2% and dosages of α-iduronidase normalized (10.6 nmol/h/mg protein). The ERT was maintained for 3 months post-HSCT. Currently, the child is 4 years old, with normal brain magnetic resonance imaging, and mild to moderate mental retardation. Case 2: Girl diagnosed at 14 months with lumbar gibbus and bilateral hips luxation. Mild hydrocephalus. Background: Botulism at 2 months of age. Elevated urinary GAGs (560 mg/g creatinine) and α-iduronidase deficient (0 nmol/h/mg protein) Genotyping: heterozygous (p.W402X/p.P533R known mutations). She began with ERT at 15 months of age and GAGs were normalized; at 20 months, HSCT was performed (a 10/10 HLA-matched unrelated cord blood) and presented febrile neutropenia and reactivation of cytomegalovirus. Forty-five days after HSCT, the chimerism was 99.2% and normal values of α-iduronidase were obtained. The ERT was kept for 3 months post-HSCT. Currently, she is 2 years old and remains clinically stable. Conclusion: Hematopoietic stem cell transplant resulted in a successful strategy for getting normal enzyme levels in these patients. Early diagnosis and ERT helped good results at the time of the HSCT.

1041 - Outcome of Unrelated Hematopoietic Stem Cell Transplantation in Children With Hurler Syndrome in an Argentinean Public Pediatric Hospital

Raquel Staciuk¹, Hernan Eiroa¹, Carlos Figueroa¹, Mariana Roizen¹, Silvia Pizzi¹, Analia Julia¹, and Luisa Bay¹

¹Hospital de Pediatría “J.P. Garrahan”, Buenos Aires, Argentina

Introduction: Hurler syndrome is the severe form of mucopolysaccharidosis type I. The hematopoietic stem cell transplantation (HSCT) is the best treatment option to prevent the central nervous system (CNS) compromise. The HSCT is recommended for children younger than the age of 2 with no CNS compromise. Objective: Description of unrelated HSCT outcomes with Hurler syndrome. Method: Retrospective cohort. Patients with clinical features of Hurler syndrome and α-l-iduronidase enzyme activity <10% were included. All patients received enzyme replacement treatment since diagnoses till HSCT. The HSCT were done between April 2010 and May 2012. Outcome: The median age at diagnosis was 11.8 months (range, 8.1-17.7); median age at HSCT was 21.9 months (range, 20.5-26.6). The median time between diagnoses and HSCT is 9 months (range, 7-14). Sex: 2 boys and 2 girls. All of them received myeloablative conditioning Bu/Cy. Stem Cell Source: Cord blood (CB) 2, peripheral blood (PB) 2. Graft Versus Host Disease (GVHD) Prophylaxis: Tacrolimus given to all patients plus corticoids in CB and methotrexate in PS. Nucleated cell dose in CB > 8.5 × 107/kg and CD34 in PB > 5.5 × 106/kg. All of them achieved complete hematopietic reconstitution. The median time of follow-up was 19 months (range, 3-47). Complications: Hemolytic anemia, 1 patient; cytomegalovirus reactivation, 2 patients; Epstein-Barr virus, 1 patient; adenovirus, 1 patient; acute GVHD, 3 patients; and chronic GVHD (cGVHD), 3 patients, one of them with severe cGVHD. One patient showed graft failure with autologous reconstitution on day +98 posttransplant. The other 3 achieved complete chimerism and normal enzyme level. One patient died on day +577 posttransplant due to refractory GVHD-related sepsis. Conclusion: The unrelated HSCT is a possible treatment in our country. The main hazards are the delay in the search of an unrelated donor, the transplant-related morbimortality, and graft failure.

1051 - Immunological Abnormalities in a Family With Mucopolysaccharidosis Type II With a De Novo Missense Mutation in the Iduronate 2-sulfatase Gene

Leuridan C. Torres¹, Diogo C. Q. Soares², José F. Franco², and Chong Ae Kim²

¹Translational Research Laboratory, Instituto de Medicina Integral Prof. Fernando Figueira (IMIP), Recife, Brazil

²Medical Genetics Unit - HC-FMUSP, São Paulo, Brazil

Introduction: Mucopolysaccharidoses (MPSs) are a group of inherited metabolic disorders characterized by deficient activity of catabolic enzymes in the lysosomes and its consequent abnormal accumulation of deposits of glycosaminoglycans. The lysosomal dysfunction caused by these deposits is responsible for the clinical manifestations. Although the lysosome is essential for the functioning of the immune system, some authors suggest that patients with MPSs have immune abnormalities, similar to patients with primary immunodeficiencies. Objectives: To evaluate the main mechanisms involved in cellular immune response in a nonconsanguineous Brazilian family with 8 individuals affected by MPS type II. Methods: The immunophenotyping of T, B, and natural killer (NK) cells and of natural-killer group 2, member D (NKG2D) ligand expression was performed by flow cytometry in 8 patients with MPS type II. Additionally, immunoglobulin (Ig) G, IgM, and IgA total antibodies were measured. Results: The results showed that this family with MPS has a quantitative deficiency in NK and B cells. Normal values for TCD4+, TCD8+, and IgG, IgM, and IgA antibodies were observed. Conclusion: These results suggest that this family with MPS has a primary immunodeficiency, which may explain the occurrence of recurrent respiratory infections and indicate a greater predisposition to the development of cancer, becoming imperative periodic screening of these patients. Financial Support: FAPESP No. 2010/52694-8.

1099 - Long-Term Therapeutic Efficacy of Allogenic Bone Marrow Transplantation in a Patient With Mucopolysaccharidosis Type IVA

Shunji Tomatsu¹, Yasutsugu Chinen², Takeshi Higa², Yasuyuki Suzuki³, Tadao Orii³, and Nobuyuki Hyakuna³

¹Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA

²University of the Ryukyus, Okinawa, Japan

³Gifu University, Gifu, Japan

Introduction: Mucopolysaccharidosis IVA (MPS-IVA) is one of the lysosomal storage diseases. It is caused by the deficiency in N-acetylgalactosamine-6-sulfate sulfatase (GALNS). Deficiency in this enzyme leads to accumulation of the specific glycosaminoglycans keratan sulfate and chondroitin-6-sulfate. This accumulation has a direct impact on cartilage and bone development, resulting in systemic skeletal dysplasia. There is no curative therapy for this skeletal dysplasia. Method: This report describes long-term therapeutic efficacy in a 15-year-old boy with a severe form of MPS-IVA who received successful allogeneic bone marrow transplantation (BMT) from his human leukocyte antigen-identical carrier sister. Results: The level of the GALNS enzyme in the recipient’s lymphocytes reached almost half of normal level within 2 years after BMT. For the successive 9+ years post-BMT, GALNS activity in his lymphocytes maintained the same level as the donor’s, and the level of urinary uronic acid was reduced. Lumbar bone mineral density increased around 50% 1 year later post-BMT and was kept consistent. Radiographs showed that the figures of trochanter major and minor appeared, while the epiphyseal dysplasia in the femoral cap was almost unchanged. Loud snoring and apnea disappeared. Vital capacity increased to around 20% for the first 2 years and was maintained. Activity of daily life was improved in work/study efficacy, respiratory status, sleep, joint pain, and frequency of infection. Conclusion: Allogenic BMT in a patient with MPS-IVA shows improvement in the clinical manifestations, suggesting that BMT is one of the therapeutic options.

1102 - Progression of Hip Dysplasia in Patients With MucopolysaccharidosisI Hurler After Successful Hematopoietic Stem Cell Transplantation

Shauna A. Kearney¹, Robert N. Jobe¹, Eveline J. Langereis¹, Matthijs M. Den Os¹, Catherine Breen², Simon A. Jones², Jean Mercer², Paula M. Kelly³, Jim Kennedy³, Ann O’Maera⁴, Rick R. Van Rijn⁵, Ralph Sakkers³, Klane K. White³, and Frits A. Wijburg¹

¹Department of pediatric metabolic diseases, Emma Children’s Hospital, AMC, Amsterdam, the Netherlands

²Genetic Medicine, Central Manchester University Hospitals, St Mary’s Hospital, Manchester, United Kingdom

³Department of Orthopaedic Surgery, Our Lady’s Children’s Hospital, Dublin, Ireland

⁴National Centre for Inherited Metabolic Disorders, Children’s University Hospital, Dublin, Ireland

⁵Department of Radiology, AMC, the Netherlands

Introduction: Dysostosis multiplex contributes significantly to the morbidity of patients with Hurler syndrome (MPS-IH), even after a successful hematopoietic stem cell transplantation (HSCT). A characteristic form of hip dysplasia (HD), which often requires surgical intervention, is one of the more frequent signs. No detailed studies are available on the course of HD over time in patients with MPS-IH after HSCT. We seek to describe in detail the radiological aspects of progression of HD in these patients and identify risk factors and prognostic features. These data may be of prognostic value and might be used in the assessment of therapeutic efficacy on bone disease for new therapeutic strategies. Methods: Longitudinal data were obtained from digitally scored pelvic x-ray studies of patients with MPS-IH using OrthoGon software for parameters including but not limited to acetabular index (AI), migration index, Smith index, and neck-shaft angle. Scoring was done independently by 2 blinded observers. Additional information on genotype and transplantation conditions and outcome were obtained. Results: Between 50 and 70 patients with MPS-IH will be included. Currently, data on the first 11 patients (22 hips, 70 x-rays) are fully analyzed. Intra- and interobserver variation analysis showed ICCs ranging from 0.81 to 0.995 (mean 0.95). Acetabular index was, at the end of follow-up, in the range of severe HD in 16 hips, mild in 4, and in 2 hips no HD was observed. The AI showed an increasing deviation from the reference values over time. All patients had coxa valga with neck shaft angles up to 170°. Twenty hips were displaced laterally and/or superiorly. Conclusion: Progressive HD as well as coxa valga and hip displacement are highly prevalent in patients with MPS-IH after HSCT. The applied scoring method is highly reliable and reproducible. This study will also provide insight into risk factors and prognostic features. Conflicts of Interest: Supported by an unrestricted educational grant from Genzyme.

1128 - Hematopoietic Stem Cell Transplantation in a Patient With Mucopolysaccharidosis II at 14 Months of Age

Zoltán Nyul¹, Alexander Sólyom¹, Anita Stréhn², Katalin Komlósi³, Kinga Hadzsiev³, Gábor Benyó², Csaba Kassa², Krisztián Kállay², Béla Melegh³, and Gergely Kriván²

¹Pediatric Hospital, University of Pécs, Pécs, Hungary

²United St István and St László Hospital, Budapest, Hungary

³Department of Medical Genetics, University of Pécs, Pécs, Hungary

Introduction: Due to its uncertain effectiveness, hematopoietic stem cell transplantation (HSCT) is generally not indicated in patients with mucopolysaccharidosis II (MPS-II; Hunter). The reason for this lack of effectiveness when compared to patients with MPS-I (Hurler) is unknown. With the advent of enzyme replacement therapy (ERT) for MPS-II, the question of whether or not to subject a child to the dangers of HSCT has been even more skewed toward avoiding the procedure. The fact that ERT does not cross the blood–brain barrier, however, means that severely affected patients with Hunter syndrome having central nervous system (CNS) disease will progress in spite of therapy. The question remains, in cases where a diagnosis of MPS-II is made early, whether the chance of sustained therapeutic effect makes HSCT a reasonable option for parents and physicians to consider. Methods: The patient was diagnosed with MPS-II at 11 months of age, after our recent diagnosis in his 3-year-old brother. Enzyme replacement therapy was initiated in both patients. His brother demonstrated appreciable symptoms of CNS involvement. This offered a rare opportunity to anticipate the younger child’s disease course. The parents requested that both children be submitted for consideration for HSCT. Based on the available literature and data on HSCT in MPS-II, along with expert opinions, the younger brother was approved for transplantation. Results: Allogeneic HSCT transplant with a matched, unrelated donor was performed successfully, with initial good engraftment and near-normal iduronate 2-sulfatase activity. Unfortunately, 100 days after transplant donor chimerism started to decline, with a related decrease in enzyme levels as well. Conclusion: This case illustrates the difficulties encountered when considering HSCT as a therapeutic option in Hunter disease, particularly when a very early diagnosis is made and CNS involvement can be anticipated. Our patients are still receiving ERT and follow-up continues.

9. General Management

1009 - Adolescents With a Metabolic Disorder in an Adult Service: A Review of the Process of Transitional Care to Close the Gap and Promote a Safe Smooth Transition

Lorraine Thompson¹, Christian Hendriksz², Briony McNelly¹, and Carly Bleakley¹

¹Salford Royal Hospital, Manchester, England, United Kingdom

²Manchester University, Manchester, United Kingdom

Objectives: To understand the approach required to prepare young adults to take ownership of their own health in preparation for adulthood. Identify the gaps and address any reasonable changes to improve patient safety and the patient experience. Method: We looked at our cohort of patients and compared this with a previous audit 2 years earlier. We examined the documentation and will discuss recommendations for change. We looked at the role of the transitional team members to include the process to address capacity and legal implications as appropriate. We discuss case studies with the aid of patient stories. Findings: The number of patients in this study between April 2013 to March 2014 was 72 in total. The number of patients has more than doubled in comparison with 2011 to 2012. In all, 16% of these patients had a diagnosis of a learning disability. In all, 39% of patients had a lysosomal storage disorder and 61% had a general metabolic condition. In all, 8% completed transition passports. Conclusion: During 1:1 consultations with the nurse, there was an open discussion when the young adult would ask questions and engage in conversation about themselves. The transition passport was not well received, and the rate of return was 8%. This resulted in having incomplete records at the time of transition and took more time at the adult visit. The invitation to attend the adult hospital on the same day as the pediatric appointment was well received. This allows for patient records to be updated should an abrupt admission occur prior to adult hospital outpatient visit. A process has been established to enable capacity issues to be identified and ensure smooth transition for people with learning disabilities. In principle, the idea of patient held and completed records are good but in practice this will need to be driven by health care professionals.

1067 - Awake Intubation in an Adult Patient With Hunter Syndrome

Jane Collette Roberts¹, Larisa Mihoreanu², and Mohit Jain²

¹Manchester Centre for Genomic Medicine, Manchester, United Kingdom

²BioMarin Europe Ltd, London, United Kingdom

Objective: To describe awake intubation in an adult patient with mucopolysaccharidosis II (MPS-II) with obstructive airway disease and discuss the potential hazards of anesthetics in patients with MPS. The MPSs are a rare group of inherited lysosomal storage disorders caused by an enzyme deficiency. The associated widespread deposition of glycosaminoglycans results in macroglossia, supraglottic narrowing, tracheomalacia, cardiorespiratory disease, and skeletal problems. Airway problems under anesthesia include obstruction, difficult/failed intubation, and the need for emergency tracheostomy. This 18-year-old patient with MPS-II (Hunter syndrome) had disease complications including obstructive sleep apnoea (OSA). Computed tomography showed deviation and tracheal narrowing to 11 × 4 mm². Previous surgery had been abandoned after general anesthesia resulted in complete airway obstruction upon induction which did not resolve with airway maneuvers or laryngeal mask airway insertion. He subsequently had several episodes of upper airway obstruction requiring resuscitation; and therefore, tracheostomy was planned following awake fiberoptic intubation. Methods: Topical local anesthesia was supplemented by sedation using 2 midazolam boluses of 1 mg each and remifentanil target-controlled infusion (TCI) 1.0 to 3.0 ng/mL. One episode of desaturation resolved after a reduction in remifentanil TCI and nasal endotracheal intubation was performed using a 5.0-mm internal diameter Microcuff tube. Anesthesia was induced and a challenging tracheostomy was performed. Results and Conclusion: Many patients with MPS have OSA and obstruct quickly on induction of anesthesia. Intraoperative postobstructive pulmonary edema has also been reported. The standard age-adjusted formula for endotracheal tubes does not apply, and performing an emergency tracheostomy is hazardous due to the extreme posterior position of the trachea. Any anesthetic/sedative agent should be given judiciously to avoid the significant risk of airway obstruction. Every anesthetic should be tailored for patients with MPS, delivered by an experienced team with a wide range of airway equipment to avoid unforeseen airway catastrophes. Conflicts of Interest: Mr Iain Bruce and Jane Roberts have received honoraria and education grants from Shire/Biomarin and Genzyme.

1086 - Physiotherapeutic Treatment After Total Hip Arthroplasty in Patient With Type VI Mucopolysaccharidoses: A Case Report

Bárbara Bernardo R Silva¹, Maria Do Carmos Mb Duarte², Livia B Andrade², Marcelo S Kerstenetzky², and Kátia RRS Lacerda³

¹Associação Pernambucana de Mucopolissacaridoses, São Paulo, Brazil

²Instituto de Medicina Integral Prof. Fernando Figueira, Recife, Brazil

³Instituto de Desenvolvimento Educacional, Brazil

Objective: To describe the phases and the evolution of physiotherapy of a patient with mucopolysaccharidosis type VI (MPS-VI) who underwent total hip arthroplasty (THA). Method: A case report of a male patient with MPS-VI, 38-year-old, sedentary, and underwent 10 sessions of 55 minutes of physiotherapy. The pre- and postassessments were done by measuring the range of motion of the lower limbs and muscle strength through goniometry and the functional independence measure (FIM) test. The physical therapy aimed at improving the range of motion of the right leg as well as the muscle strength while decreasing pain reduction in the limb, aiming for a easy return to daily activities. The routine consisted of active-assisted stretching, application of taping, use of transcutaneous and functional electrical nerve stimulation, and resistance exercise with weight bearing as well as balance training and gait. Two months after THA, the patient underwent a 6-minute walk test. Results: This study demonstrated improvements in muscle strength and in range of motion ranging from 4 to 19, especially of hip flexion (before: 82 after 101). We obtained significant data of hip abduction, going from strength grade 3 to grade 5, recovery of balance and gait retraining (before THA the patient reported that he wasn't able to walk up to 20 m, with severe pain and imbalance). After 2 months, he was able to walk 388 m without interruption and without pain, only fatigue (borg 7), which can be explained by his compromised respiration due to the pathology. Greater functional independence was also noted; before, the total FIM was 102: modified dependency (assistance up to 25% of the tasks) and after treatment it rose to 118 (modified independence). Conclusion: Physiotherapy played an important role in the rehabilitation of patient studied with MPS-VI undergoing THA.

1112 - Cervical Spine Surgery Without Halo Orthosis Immobilization in Children With MPS Disorders

Saikat Santra¹, Guirish Solanki¹, and Suresh Vijay¹

¹Birmingham Children’s Hospital, Birmingham, United Kingdom

Introduction: Cervical spine instability (CSI) and cervical cord compression (CCC) occur frequently in the mucopolysaccharidoses, especially mucopolysaccharidoses type VI (MPS-VI, Maroteaux-Lamy disease) and type IV (MPS-IV, Morquio Disease). Standard surgical treatment involves cervical decompression and/or stabilization with a period of external fixation with an HO. Concomitant skeletal deformity can make the application of an HO difficult in some young children with MPS-IV and MPS-VI. We report our experience of performing combined cervical spinal decompression and stabilization using a custom-made brace for immobilization in 3 children with MPS disorders. Methods: Two children with MPS-IV (aged 7 and 10) and 1 with MPS-VI (aged 3) were identified as requiring surgery for CCC with CSI based on clinical and radiological findings. Skeletal deformity, including pectus carinatum, precluded the use of a HO, and the patients were individually measured for custom-made spinal brace jackets to provide postoperative immobilization. Recombinant human bone morphogenetic protein was also used in the 2 patients with MPS-IV to aid bone fusion. Results: Preoperative brace size measurements proved inaccurate in the immediate postoperative period due to surgical delay and postoperative swelling. Temporary immobilization with plaster braces was required until postoperative swelling had settled and patients were remeasured for individual plastic braces. Radiological studies (computed tomography) confirmed satisfactory postoperative alignment was maintained in all patients. Bone fusion was demonstrated within 8 weeks and was satisfactory by 12 weeks with no complications. The brace was well tolerated by the patients, the main concern being interference with mouth opening and requiring refashioning of the chin section. Conclusion: We conclude that where skeletal deformity precludes the application of an HO, noninvasive immobilization using a spinal brace jacket is an acceptable alternative. Care should be taken to ensure accurate measurements are taken to ensure a good fit. Temporary plaster bracing may be needed in the immediate postoperative period.

1138 - Levomepromazine as a Treatment for Nonepileptic Movement Disorder in Advanced Sanfilippo Disease (Mucopolysaccharidosis Type III)

Saikat Santra¹, Louise M. Simmons¹, and Evangeline Wassmer¹

¹Birmingham Children’s Hospital, Birmingham, United Kingdom

Introduction: Mucopolysaccharidosis type III (MPS-III) is a neurodegenerative lysosomal storage disorder that leads to cognitive decline as the disease advances. Along with this, patients have seizures; however, it is increasingly being appreciated that many patients additionally have a nonepileptic movement disorder (NEMD) that can be distressing. Medical treatment for these movements is unsatisfactory. Levomepromazine is a low-potency antipsychotic medication with effects on multiple receptors and is widely used in Europe for the treatment of anxiety, agitation, and nausea in palliative care. We report on our experience of using levomepromazine in the palliative care of patients with MPS-III. Methods: A total of 30 patients with MPS-III were treated at our hospital between 2004 and 2014, of whom 16 (53%) were being treated through the end stage of their disease and 13 (43%) died. Case records were retrospectively reviewed for evidence of NEMD which was judged to be present in 9 (56%) of those in end-stage disease however may have been underrecognized in historical patients. Where levomepromazine (Nozinan 25 mg tablets; Sanofi-Avensis, Paris, France) was considered suitable it was prescribed at a starting dose of 6.25 mg twice daily and increased according to response. Treatment efficacy was judged subjectively by carer report and objectively in some patients by the use of an ActiGraph (ActiGraph, Florida) to measure the frequency of upper limb movements. Results: Of the 9 patients with advanced MPS-III having NEMD, 8 (89%) received treatment with levomepromazine. Subjective improvement in NEMD severity and distress was reported in all 8 (100%) children. actigraphy demonstrated a reduced frequency of upper limb movements wherever performed. Levomepromazine was well tolerated with the most frequent side effect reported being sedation. No patient stopped treatment due to side effects. Conclusion: Levomepromazine appears to be a well-tolerated and effective medication for the management of distressing NEMD in advanced MPS-III.

1201 - A Case Report of an 8-year-old Hispanic Male With Likely Mucolipidosis Type III γ

Stephanie R. Cagle¹, and Li Hong²

¹Emory Healthcare, Decatur, GA, USA

²Emory University, Atlanta, GA, USA

Objective: To present the case of an 8-year-old Hispanic male with likely mucolipidosis type IIIγ (ML-IIIγ). Methods: Review of the medical chart, laboratory results, and interviews with the patient and his father. Results: Mucolipidosis type III is a rare autosomal recessive genetic disorder caused by deficient uridine diphosphate N-acetylglucosamine-1-phosphotransferase (UDP-GlcNAc-1-phosphotransferase) activity. This enzyme is required for the synthesis of mannose 6-phosphate (M6P) recognition markers on enzymes that are targeted to the lysosome. When UDP-GlcNAc-1-phosphotransferase enzyme activity is deficient, enzymes that require the M6P marker are incorrectly targeted and leave the cell. Thus, these lysosomal enzymes become elevated in the plasma of affected individuals. The UDP-GlcNAc-1-phosphotransferase consists of 3 subunits: α, β, and γ. The ML-III α/β is caused by mutations in N-acetylglucosamine-1-phosphate transferase, α and β subunits (GNPTAB) gene, whereas ML-IIIγ is caused by mutations in GNPTG gene. One cannot distinguish between the 2 types clinically or biochemically. Common symptoms include dysostosis multiplex, progressive joint stiffness, short stature, scoliosis, and cardiac valve disease. Here, we present the case of an 8-year-old Hispanic male who was referred for suspected mucopolysaccharidosis (MPS) due to x-rays identifying signs consistent with dysostosis multiplex. An MPS enzyme panel was normal with the exception of the 2 enzymes analyzed in plasma, which were markedly elevated. This led toward a diagnosis of ML-III. As ML-IIIα/β is more common than ML-IIIγ, GNPTAB gene sequencing was performed. These results were normal, indicating the likely diagnosis to be ML-IIIγ. Conclusion: At the time of abstract submission, GNPTG sequencing was pending. This diagnosis should be confirmed since this is the first case report of ML-IIIγ in a Hispanic individual.

10. Novel Therapies

1019 - Effects of Flavonoids on Expression of Genes Coding for Proteins Involved in Glycosaminoglycan Metabolism

Grzegorz Wegrzyn¹, Magdalena Gabig-Ciminska², Joanna Jakobkiewicz-Banecka¹, Marta Moskot², Anna Kloska², and Elwira Smolinska²

¹Department of Molecular Biology, University of Gdansk, Gdańsk, Poland

²Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warszawa, Poland

Introduction/Objectives: Flavonoids were previously found to modulate efficiency of synthesis of glycosaminoglycans (GAGs), compounds that are accumulated in cells of patients with mucopolysaccharidoses (MPSs). Therefore, flavonoids have been proposed as potential drugs for the use in substrate reduction therapy (SRT) for MPS disorders and other lysosomal storage diseases (LSDs). The aim of this work was to determine the effects of flavonoids, used alone or in combinations, on expression of genes coding for proteins involved in GAG metabolism. Methods: Cultures of wild-type (human dermal fibroblast [HDFa]) and MPS type II (Hunter disease) human fibroblasts were treated with flavonoids (genistein, kaempferol, daidzein, and mixtures of them), and transcriptomic signatures were determined by DNA microarray analyses, followed by quantitative real-time polymerase chain reaction (qRT-PCR). Results: Testing the effects of flavonoids on human fibroblast transcriptome, we found that genistein, kaempferol, and combination of these 2 compounds induced dose- and time-dependent remarkable alterations in transcript profiles of GAG metabolism genes. They included genes coding for enzymes involved in GAG biosynthesis as well as those required for GAG degradation. Interestingly, effects of the mixture of genistein and kaempferol were stronger than those revealed by any of these compound used alone. Forty-five genes were chosen for further verification in HDFa and MPS-I fibroblasts by using qRT-PCR. Interestingly, monitoring particular messenger RNA levels in HDFa, we found that genistein, kaempferol, and mixture of these compounds significantly stimulate expression of TFEB, a gene coding for the transcription factor, which was demonstrated previously to act as a master positive regulator of lysosomal biogenesis. Conclusion: Flavonoids affect expression of some genes coding for enzymes involved in metabolism of GAGs. Moreover, these compounds stimulate biogenesis of lysosomes by activation of TFEB expression. Effects of mixtures of different flavonoids act more efficiently than each compound used alone.

1021 - Higher Vector Dose is Required for the Reversal of Neurological Disorders of Mucopolysaccharidosis IIIB by Systemic rAAV9-hNAGLU Gene Delivery

Haiyan Fu¹, Aaron Meadows¹, F Jason Duncan¹, Bartholomew Naughton¹, Darren Murrey¹, K Reed Clark¹, Kim McBride¹, Kevin Flanigan¹, and Douglas McCarty¹

¹Center for Gene Therapy, Research Institute at Nationwide Children’s Hospital, Columbus, OH, USA

Introduction/Objectives: We have previously demonstrated the functional benefits of systemic recombinant adenoassociated viral 9 human α-N-acetylglucosaminidase (rAAV9-hNAGLU) gene delivery in young, presymptomatic mucopolysaccharidosis IIIB (MPS-IIIB) mice (4-6-week-old). However, MPS-IIIB is a cumulative disease, and the reversibility of pathology has been a major concern for translation. This is particularly relevant to the central nervous system because the majority of patients are diagnosed after severe neurological symptoms have developed. To expand the clinical relevance of this approach, this study investigated the therapeutic potential of systemic rAAV9-hNAGLU gene for treating advanced MPS-IIIB. Methods: We treated 3 cohorts of 4- to 6-month-old MPS-IIIB mice with different intravenous (IV) doses of rAAV9-CMV-hNAGLU vector in a single injection. The therapeutic effects were assessed by longevity, behavior, and tissue analyses. Results: At 1E13vg/kg, the vector treatment resulted in low levels of recombinant NAGLU (rNAGLU) expression in tissues and a limited increase in long-term survival but had no detectable impact on behavioral performance in the water maze assay. However, an IV injection of 2E13vg/kg or 1E14vg/kg-mediated efficient long-term restoration of NAGLU activity and the correction of lysosomal storage pathology throughout the central nervous system as well as in somatic tissues, leading to significant improvement in behavioral performance in the water maze and significantly extended survival. Conclusion: Mucopolysaccharidosis type IIIB is reversible to a certain extent if sufficient vector is administered, and treating advanced MPS-IIIB requires higher vector doses than treating the disease at earlier stages.

1022 - Therapeutic Benefits and the Correction of Broad Molecular Impairments in a Mouse Model of Mucopolysaccharidosis IIIA by Systemic hSGSH Gene Delivery Using an AAVrh74 Vector

Haiyan Fu¹, F. Jason Duncan¹, Bartholomew Naughton¹, Kimberly Zaraspe¹, Darren Murrey¹, Tierra Ware¹, Aaron Meadows¹, K. Reed Clark¹, Kim McBride¹, and Douglas McCarty¹

¹Center for Gene Therapy, Research Institute at Nationwide Children’s Hospital, Columbus, OH, USA

Objectives: This study was performed to assess the therapeutic potential of a systemic human N-sulfoglucosamine sulfohydrolase (hSGSH) gene delivery approach for treating mucopolysaccharidosis IIIA (MPS-IIIA), using a novel adenoassociated viral vector (AAVrh74) that has the ability to cross the blood–brain barrier (BBB). Methods: A self-complementary AAVrh74 (scAAVrh74) vector was developed to deliver the hSGSH gene. The scAAVrh74-hSGSH vector was injected intravenously into 4 to 6-week-old MPS-IIIA mice (5E12vg/kg). Behavior, longevity, and tissue analyses were performed to assess the therapeutic benefits. Results: The treatment resulted in global central nervous system (CNS) and widespread somatic restoration of SGSH activity, clearance of CNS and somatic tissue glycosaminoglycan storage, improved behavior performance, and significantly extended survival. A genome-wide gene expression array in MPS-IIIA mice detected broad molecular abnormalities with significant dysregulation (≥2-fold, FDR ≤ 10) of numerous genes and transcripts in the brain (314 transcripts) and blood (397 transcripts). Importantly, of the dysregulated blood transcripts, 22 are known to be enriched in the brain and linked to broad neuronal functions. More importantly, the scAAVrh74-hSGSH treatment also led to the correction of the majority of the transcriptional abnormalities in the brain (95.9%) and blood (97.7%), of which 182 and 290 transcripts were normalized in the brain and blood, respectively. Conclusion: A single systemic rAAVrh74 gene delivery was functionally beneficial, leading to a complete or near-complete correction of molecular pathology in MPS-IIIA mice. The blood transcriptional profiles may reflect the biopathological status of MPS-IIIA and respond well to effective treatments, offering the biomarker potential for disease progression and therapeutic assessments.

1048 - Gene Therapy in Mucopolysaccharidosis IIIA Mice at Later Stages of the Disease Using Systemic Self-Complementary Adenoassociated Viral 9 Treatment

Douglas M. McCarty¹, Kimberly Zaraspe¹, and Haiyan Fu¹

¹The Research Institute at Nationwide Children’s Hospital, Columbus, OH, USA

Inroduction: The reversibility of neuropathic of lysosomal storage diseases, including mucopolysaccharidosis IIIA (MPS-IIIA), is a major goal in therapeutic development due to typically late diagnoses and a large population of untreated patients. In this study, we used a self-complementary adenoassociated viral (scAAV) 9 vector expressing human N-sulfoglucosamine sulfohydrolase (SGSH) to test the efficacy of treatment at later stages of the disease. Methods: We treated MPS-IIIA mice at 1, 2, 3, 6, and 9 months of age, with an intravenous injection of scAAV9-U1a-hSGSH vector (5E12vg/kg). Results: The treatment led to restoration of SGSH activity and reduction in glycosaminoglycan (GAG) content to normal levels throughout the central nervous system (CNS) and somatic tissues in all treated groups. In mice treated at 2, 3, or 4 months of age, learning ability in the Morris water maze at 7.5 months of age was improved, and life span was normalized. In mice treated at 6 months of age, behavioral performance was impaired at 7.5 months but did not decline further when retested at 12 months of age, and life span was increased but not normalized. A group of mice treated at 9 months of age showed no improvement in life span, although the lysosomal storage pathology in the CNS was cleared. Conclusion: Mucopolysaccharidosis IIIA is functionally reversible over a range of ages. Although systemic scAAV9-SGSH gene delivery in very advanced MPS-IIIA can correct GAG storage in the CNS and periphery, it may not have significant functional benefit, likely due to severe chronic tissue damage that is no longer reversible. The study suggests that there is a potential for intervention in MPS-IIIA at intermediate stages of the disease using systemic gene therapy and extends the clinical relevance of our systemic scAAV9-hSGSH gene delivery approach.

1071 - Improvement in Protein Folding as a Possible Treatment of Mucopolysaccharidosis Type IIIB

Olga L. M. Meijer¹, Frits Wijburg¹, and Naomi van Vlies¹

¹Department of pediatric metabolic diseases, Academic Medical Center, Amsterdam, the Netherlands

Introduction/Objective: Mucopolysaccharidosis type IIIB (MPS-IIIB or Sanfilippo syndrome type B) is caused by a deficiency in the lysosomal enzyme N-acetyl-α-glucosaminidase (NAGLU), leading to lysosomal accumulation of heparan sulfate. Mucopolysaccharidosis type IIIB is characterized by severe progressive neurocognitive deterioration and to date, no disease-modifying treatment is available for this devastating condition. Most enzyme deficiencies in patients with MPS-IIIB are caused by missense mutations that presumably lead to misfolding of the protein and subsequent degradation. In other lysosomal storage disorders, chaperone therapy has been shown to ameliorate the enzyme deficiency in in vitro experiments. Chaperones are small molecules able to stabilize the misfolded proteins, thereby increasing their residual enzyme activity and improving disease outcome. It is assumed that a residual enzyme activity of >10% of normal levels may ameliorate the course of the disease in patients with MPS-IIIB. The aim of this study was to identify mutations in the NAGLU gene that may benefit from chaperone therapy. Methods: First, the NAGLU activity assay was optimized to accurately measure very low enzyme activities (as detected in patients with MPS-III). Next, folding sensitive mutations were identified by culturing fibroblasts of patients with MPS-IIIB at 30°C and 37°C for 14 days and subsequent analysis of NAGLU activity. Results: After optimization of the assay, we identified several folding sensitive mutations. An increase in enzymatic activity >10% of reference values was seen in 7 of the 8 cell lines incubated at 30°C. Conclusion: This study shows that improved protein folding leads to higher enzyme activity in fibroblasts of patients with MPS-IIIB, demonstrating the feasibility of chaperone therapy for MPS-IIIB. Currently, these cell lines are used to identify small molecules that enhance protein folding and might serve as therapy for MPS-IIIB in the future.

1108 - In Vitro Evaluation of Adenoassociated and Lentiviral Vectors for Morquio A

Carlos J. Almeciga¹, Angelica M. Herreño¹, Hector M. Barbosa¹, Juliana Herrera¹, Rocio Cuaspa¹, Carlos J. Alméciga-Diaz¹, and Luis A. Barrera¹

¹Institute for the Study of Inborn Errors of Metabolism, Pontificia Universidad Javeriana, Bogotá, Colombia

Objective: Mucopolysaccharidosis IVA (MPS-IVA) is a lysosomal storage disease produced by the deficiency in N-acetylgalactosamine-6-sulfate sulfatase (GALNS), which degrades keratan and chondroitin-6-sulfate. Gene therapy is among the possible treatments options for this disease. Recent reports have demonstrated the efficiency of adenoassociated viral (AAV) and lentiviral vectors for the delivery of GALNS gene, allowing the induction of high expression levels. To continue the evaluation of these vectors, in this study, we explored the correlation between GALNS activity, transduction efficacy, gene expression, keratan sulfate levels, and total hexosaminidase activity. Methods: Human embryonic kidney 293 (HEK293) cells and Morquio A skin fibroblast were transduced with AAV and lentiviral vectors, with or without sulfatase modifying factor 1 (SUMF1). N-Acetylgalactosamine-6-sulfate sulfatase and total hexosaminidase activity were assayed in cell lysates using a fluorogenic substrate. Keratan levels were measured in Morquio A fibroblasts lysates using Dot-Blot with a monoclonal antikeratan antibody. Transduction efficacy and gene expression were assayed by real-time polymerase chain reaction. Results: N-Acetylgalactosamine-6-sulfate sulfatase activity was detected in HEK293 cells transduced with AAV and lentiviral vectors. For AAV vectors, SUMF1 coexpression allowed a marked increase in GALNS activity, while with lentiviral vectors an increase in activity was not observed at higher vectors concentrations or SUMF1 coexpression. Transduction of Morquio A fibroblasts allowed GALNS activity ranging from 20% to 50% of wild-type levels. Noteworthy, these enzyme activity levels had a significant impact on keratan sulfate and total hesoxaminidase levels. Conclusion: These results showed that enzyme activity levels below 50% of wild-type levels can have a significant impact on biochemical markers such as keratan sulfate levels and impairment of secondary biomarkers. Although in vivo experiments are still necessary, these results will support the future endeavors for Morquio A gene therapy.

1122 - PEGylated Cationic Nanoemulsions as a Gene Transfer System to Mucopolysaccharidosis Type I Murine Model

Michelle Fraga¹, Dirnete Diel¹, Talita G. De Carvalho², Fernanda Bruxel¹, Ursula Matte², and Helder F. Teixeira¹

¹Pharmaceutical Sciences Graduate Program of UFRGS and Gene Therapy Center - ERC - HCPA, Brazil

²Genetics and Molecular Biology Graduate Program of UFRGS and Gene Therapy Center -ERC – HCPA, Brazil

Introduction: Mucopolysaccharidosis I (MPS-I) is an autosomal disease caused by α-l-iduronidase (IDUA) deficiency, leading to intracellular accumulation of dermatan and heparan sulfate in different tissues. Objective: This study aimed at evaluating the application of cationic nanoemulsions complexed with a plasmid containing the gene that encodes for IDUA (pIDUA) by adsorption or by encapsulation as a gene transfer system in the MPS-I murine model. Methods: Nanoemulsions consisting of an oil core of medium chain triglycerides stabilized by the cationic lipid 1,2-dioleoyl-3-trimethylammonium-propane and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (NE) and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine conjugated polyethylene glycol (DSPE-PEG; neutral endopeptidase [NEP]) phospholipids were prepared by high-pressure homogenization. Formulations were obtained by either adsorption (NEA and NEPA) or encapsulation (NEE and NEPE) of preformed pIDUA/cationic lipid complexes at +4/− charge ratio. Release of pIDUA from all complexes was evaluated after incubation with culture medium with FBS. The NEPA and NEPE complexes were administered through intravenous injection in the tail vein of MPS-I knockout mice using 30 µg of pIDUA. Animals were killed 48 hours after injection. Liver, lung, kidney, and spleen were isolated and flash frozen in liquid nitrogen for biochemical and gene expression analysis. Results: The pIDUA complexation and stability against DNAse I degradation were demonstrated by agarose gel assay. The physicochemical properties and stability of complexes in the presence of serum proteins were mainly influenced by the presence of DSPE-PEG; and therefore, in vivo studies were performed only with NEPA and NEPE. Following intravenous treatment in MPS-I knockout mice, complexes caused a significant increase in IDUA activity (fluorescence assay; P < .05, compared to untreated MPS-I, analysis of variance, and Tukey post hoc) and expression (reverse transcription-quantitative polymerase chain reaction) in different organs, especially in the lungs for NEPA and in the liver for NEPE. Conclusion: Such preclinical results demonstrate that these nanocomplexes represent a potential therapeutic system for the treatment of MPS-I.

1130 - Myeloid-Driven Stem Cell Gene Therapy for Mucopolysaccharidosis IIIA

Brian W. Bigger¹, Ana Sergijenko¹, Stuart Ellison¹, Alexander Langford-Smith¹, Ai yin Liao¹, Claire Pickford¹, Fiona Wilkinson¹, Kia Langford-Smith¹, Catherine Merry¹, Simon Jones², and Rob Wynn³

¹University of Manchester, Manchester, United Kingdom

²St Marys Hospital, London, United Kingdom

³Royal Manchester Children’s Hospital, Manchester, United Kingdom

Introduction: Mucopolysaccharidosis (MPS) type IIIA (MPS-IIIA) is a pediatric lysosomal storage disease caused by mutations in N-sulfoglucosamine sulfohydrolase (SGSH). N-Sulfoglucosamine sulfohydrolase deficiency results in heparan sulfate storage and a severe progressive neurodegenerative disease. Enzyme replacement therapy is potentially feasible but fails because enzyme cannot cross the blood–brain barrier. Hematopoietic stem cell transplantation (HSCT) circumvents this via monocyte trafficking and engraftment in the brain as microglia but is ineffectual for MPS-IIIA which has no treatment. To increase enzyme in HSCT, we designed a lentiviral gene therapy vector overexpressing SGSH specifically in bone marrow monocytes using a myeloid-specific promoter (CD11b) to drive transgene expression (LV-CD11b-coSGSH). We previously demonstrated that lentiviral-mediated gene therapy to augment the SGSH enzyme in transplanted MPS-IIIA hematopoietic stem cells is curative in MPS-IIIA mice, correcting MPS-IIIA behavior, increasing SGSH to 500% of normal in bone marrow and 11% of normal in brain, and normalizing glycosaminoglycan storage and neuroinflammation. Methods: We are currently optimizing stem cell gene therapy for patients with MPS-IIIA to prove its safety and efficacy in human bone marrow. The colony-forming units assay was used to investigate transduction efficiency, gene expression, lineage skewing, and toxicity of our SGSH lentiviral vector in human HSCs. Quantitative polymerase chain reaction was used to evaluate vector copy number and the SGSH activity assay to determine enzyme expression levels. Results: We have successfully optimized transduction of CD34+ human HSCs with lentiviral vector encoding green fluorescent protein (GFP) to 70% or more with consistency and demonstrate no evidence of lineage skewing or toxicity of SGSH vector in human HSCs. Furthermore, SGSH expression levels were improved by 900% in transduced human HSCs. Conclusion: Stem cell gene therapy is a promising prospective treatment for MPS-IIIA. Once safety and efficacy experiments are complete, good manufacturing practice-grade lentiviral vector will be manufactured for a phase I/II clinical trial.

1131 - The Effect of Nonsteroidal Anti-Inflammatory Drugs on Cellular Glycosaminoglycan Level

Joanna A. Jakobkiewicz-Banecka¹, Marta Moskot², Pawel Mozolewski², Grzegorz Wegrzyn³, and Magdalena Gabig-Ciminska²

¹Department of Molecular Biology, University of Gdańsk, Gdańsk, Poland

²Laboratory of Molecular Biology (affiliated with the University of Gdańsk), Instituite of Biochemistry, Warszawa, Poland

³Department of Molecular Biology, University of Gdańsk, Gdańsk, Poland

Objectives: Research on the implementation of the nonenzymatic substrate reduction therapy (SRT) using glycosaminoglycan (GAG) metabolism modulators such as nonsteroidal anti-inflammatory drugs (NSAIDs) to treat mucopolysaccharidoses (MPSs) with neurological symptoms is the concept of this research. We intend to validate the extent of action of acetaminophen, indomethacin, and nimesulide, agents with proved and documented effective blood–brain barrier penetration properties, and to learn interactions at the molecular level in terms of expression modulation of GAG metabolism genes by these substances. Methods: Cytotoxic and antiproliferative activities of selected NSAIDs (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide tests) followed by kinetics of GAG synthesis (35S and 3H incorporation) and total GAGs quantification (fluorescence microscopy) plus gene expression profiling by means of HumanHT-12 v4 Expression BeadChip and quantitative real-time polymerase chain reaction (qRT-PCR) custom panel in the presence of tested compounds versus control with the use of a model biological material in form of human dermal fibroblasts (HDFa) and MPS cell lines constitute our study plan. Results: No remarkable cytotoxicity and antiproliferation features of acetaminophen, indomethacin, and nimesulide were observed in the range of tested conditions. Moreover, we found that the latter 2 significantly inhibited GAG synthesis in both HDFa and MPS fibroblasts treated with NSAIDs when compared to untreated cells. Further tests, including total GAGs quantification by means of fluorescence microscopy as well as gene expression profiling via DNA microarrays and qRT-PCR are currently conducted and will be reported. Conclusion: The action of the tested NSAIDs (especially indomethacin and nimesulide), in term of their use as potential drugs for SRT, exhibits at the moment a promising strategy and realistic chance for treatment of some metabolic disorders, especially those with damage of central nervous system.

1144 - Delivery of α-N-acetyl-glucosaminidase Insulin-Like Growth Factor 2 Fusion Protein via Choroid Plexus-Directed Gene Therapy in Mucopolysaccharidosis IIIB Mice

Shih-hsin Kan¹, Steven Q. Le¹, Marie Reine Haddad², Eun-Young Choi², Anthony Donsate², Stephan G. Kaler², and Patricia I. Dickson²

¹Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, Torrance, CA, USA

²Eunice Kennedy Shriver National Institute of Child Health and Development at NIH, Bethesda, MD, USA

Introduction: Mucopolysaccharidosis type IIIB (MPS-IIIB; Sanfilippo B) is an inherited neurodegenerative disorder for which no effective treatment is currently available. The cause of MPS-IIIB is deficiency in the lysosomal enzyme, α-N-acetyl-glucosaminidase (NAGLU), and resultant storage of heparan sulfate. Recombinantly produced NAGLU shows inadequate mannose 6-phosphorylation (M6P), which limits cellular uptake. We found that a modified human NAGLU fused to the receptor-binding motif of insulin-like growth factor 2 (hNAGLU-IGF2) can enhance entry into MPS-IIIB fibroblasts via M6P/IGF2 receptor-mediated endocytosis. In this study, we used a recombinant adenoassociated virus, serotype 5 (AAV5) vector expressing rhNAGLU-IGF2 that targets the choroid plexus epithelia to deliver the missing enzyme to the cerebrospinal fluid (CSF) of MPS-IIIB mice. Methods: The rhNAGLU-IGF2 complementary DNA was cloned into the AAV vector plasmid and recombinant AAV5 vector was generated by triple transfection method. The expression of the recombinant protein was confirmed by NAGLU activity assay and Western blot. A pilot in vivo study was performed in MPS-IIIB mice by injecting 5x10E10 vector genomes (vgs) of rAAV5-rhNAGLU-IGF2 to the lateral ventricles of adult mice and 5x10E9 vg in neonatal mice. Results: Immunohistochemistry and enzyme activity were studied 2 weeks after viral injection. The NAGLU activity reached twice the normal level. β-Hexosaminidase activity, which is abnormally elevated in MPS-IIIB, was significantly reduced in the AAV5-treated mice. Tissue evaluations showed NAGLU-IGF2 expression in the choroid plexus epithelium. The NAGLU-IGF2 was also detected in brain parenchyma, even contralateral to the injection, indicating delivery from the CSF. Testing to evaluate the efficacy of the AAV5 gene therapy to correct the lysosomal storage in brain tissues is in progress. Conclusion: Our results suggest that the combination of M6P/IGF2 receptor-mediated endocytosis and choroid plexus-targeted viral gene therapy may overcome the major obstacles for enzyme replacement therapy for MPS-IIIB and enable permanent, efficient distribution of NAGLU throughout the brain.

1157 - New Treatment Strategies for Mucolipidoses II and III: A Study Focusing on Premature Degradation of GNPTAB and GNPTG Messenger RNA

Ida Vanessa Doederlein Schwartz¹, Renata V. Velho², Fernanda Sperb-Ludwig³, and Ursula S. Matte⁴

¹Department of Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

²PGP in Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

³PGP in Healthy Sciences, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil

⁴Gene Therapy Center of Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

Introduction: Mucolipidosis II and III (ML-II/III) are rare autosomal recessive disorders caused by defects in the N-acetylglucosamine-1-phosphotransferase (GlcNAc-1-phosphotransferase) complex, which is composed of 3 subunits, α, β, and γ. Mutations in the gene encoding the α and β-subunits (N-acetylglucosamine-1-phosphate transferase, α and β subunits [GNPTAB]) lead to ML-II α/β, or to the clinically milder condition, ML-III α/β. Mucolipidosis IIIγ arises from mutations in the GNPTG gene encoding the γ subunit of GlcNAc-1-phosphotransferase. To date, the only available specific treatment for these disorders is bone marrow transplantation but with conflicting results. The objective of this work is to evaluate whether the messenger RNA (mRNA) transcribed from GNPTAB and GNPTG genes in patients with ML II/III is target of premature degradation and, therefore, not easily suitable to the readthrough associated with aminoglycosides. Methodology: Cells from 7 patients with ML-II/III, with previously defined genotype, were cultured for 24 hours with or without geneticin or chloramphenicol. After this period, culture medium and cells were collected and used for enzyme assay. Furthermore, RNA was extracted from the cells. The lysosomal hydrolases, β-galactosidase, β-glucuronidase, and α-mannosidase were measured by fluorometric technique. Results: Regarding β-galactosidase and α-mannosidase, no statistical difference was found between treated and untreated cells both in the culture medium and in the fibroblasts. However, regarding β-glucuronidase, treated cells showed a decrease in its activity only in the culture medium (n = 4 of the7 patients). Discussion/Conclusion: These results show a subtle biochemical improvement in cells from some patients with ML-II and -III associated with the use of aminoglycosides, which could indicate that the mRNA of GNPTAB and GNPTG genes is target of premature decay. At this moment, we are working to quantify mRNA in these patients and to evaluate the effect of NMD inhibitors. Support: CNPq, FAPERGS.

1159 - Studies on the Intracellular Handling of DL-Hex DGJ, a Potential Chaperone for the Therapy of GM1 Gangliosidosis and Morquio B Disease

Eduard Paschke¹, Bernhard Blank-Landeshammer¹, Thomas Kaiser¹, Guenter Fauler², Tanja M. Wrodnigg³, Arnold E Stuetz³, and Werner Windischhofer¹

¹Department of Pediatrics, Medical University of Graz, Graz, Australia

²Clinical Institute of Medical and Chemical Laboratory Diagnostics, Medical University of Graz, Graz, Australia

³Glycogroup, Institute for Organic Chemistry, Technical University of Graz, Graz, Australia

Introduction: Two lysosomal storage disorders, Morquio B disease (MBD) and GM1 gangliosidosis (GM1), are caused by defects in galactosidase β1 (GLB1), the gene coding for lysosomal β-galactosidase (β-gal). In GM1 fibroblasts, the activity against synthetic substrates can be raised by N-acyl derivatives of deoxygalactonojirimycin (DGJ). This mutation-specific effect is thought to stabilize misfolded enzyme precursors by binding of chaperones to the catalytic site and by improving their transport to the lysosomes. We recently characterized novel N-acyl derivatives of DGJ acting as competitive inhibitors, normalizing the subcellular distribution, processing of β-gal precursors, and enhancing the activity of synthetic substrates in sensitive GLB1 mutants.^1,2 The metabolic fate of chaperones and their effects on the turnover of natural substrates (eg, GM1 ganglioside) is unknown. Methods: Time- and concentration-dependent uptake of methyl 6-{[N2-(dansyl)-N6-(1,5-dideoxy-d-galactitol-1,5-diyl)-l-lysyl]amino} hexanoate (DLHex-DGJ)1 into normal and GM1 fibroblasts was studied by detection of a dansyl fragment with high-resolution tandem mass spectrometry in negative ion mode and compared with the formation of mature enzyme by Western blotting as well as the activation of enzyme activity. Results: Only small portions of the total substance load present in culture media were actually taken up into cells. Intracellular concentrations reached a maximum after 12 hours and did hardly increase thereafter. Increase in precursor maturation as well as activity in contrast was considerably delayed and increased steadily until 72 hours of chaperone exposure. Conclusion: The desynchronized time course of chaperone uptake and intracellular effects are not explained by current concepts of ER stabilization and improved transport of enzyme precursors into the lysosomal compartment. Further data, for example, on subcellular handling are required to understand the effects on chaperone-sensitive enzyme mutants.

References

1 Fantur K Hofer D Schitter G . DLHex-DGJ, a novel derivative of 1-deoxygalactonojirimycin with pharmacological chaperone activity in human G(M1)-gangliosidosis fibroblasts. Mol Genet Metab 2010;100(3):262–268. a-0 2 Fantur KM Wrodnigg TM Stütz AE . Fluorous iminoalditols act as effective pharmacological chaperones against gene products from GLB₁ alleles causing GM1-gangliosidosis and Morquio B disease. J Inherit Metab Dis 2012;35(3):495–503. a-1

1160 - Ataluren as a Potential New Treatment for Nonsense Mutation Mucopolysaccharidosis Type 1

Robert J. Spiegel¹, David M. Bedwell², Kim M. Keeling², Allen Reha¹, Dan Wang², Marla Weetall¹, and Ellen M. Welch¹

¹PTC Therapeutics Inc, South Plainfield, NJ, USA

²Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL, USA

Introduction: A nonsense mutation in the α-l-iduronidase (IDUA) gene is the cause of disease in 60% to 80% of mucopolysaccharidosis type I (MPS-I) cases. The IDUA gene encodes α-l-iduronidase, deficiency of which causes progressive glycosaminoglycan (GAG) accumulation and the MPS-I phenotype, including multiple somatic and neurological defects. Ataluren, an oral investigational drug, suppresses nonsense mutations by enabling ribosomal readthrough of premature stop codons and production of full-length, functional protein. Effects of ataluren in nonsense mutation MPS-I (nmMPS I) were assessed in 2 preclinical models. Methods: Effects of ataluren on α-l-iduronidase activity were determined in (1) an Idua-W402X knock-in mouse model carrying a nonsense mutation corresponding to the IDUA-W402X mutation in humans. After 14 days of treatment with a range of ataluren concentrations, mice were killed and brain, liver, heart, lung, spleen, and kidney tissue were collected and assessed for GAG levels and (2) fibroblasts isolated from Idua-W402X mouse embryo littermates. After treatment with a range of ataluren concentrations, GAG levels were assessed. Results: Statistically significant GAG-level reductions in ataluren-treated versus untreated Idua-W402X mice were observed in the brain, liver, heart, lung, and spleen but not in the kidney. Partial restoration to wild-type GAG levels was observed. As in preclinical models of other nonsense mutation diseases, the ataluren concentration–response relationship was bell shaped. Similar results were seen in the in vitro model of nmMPS1. Conclusion: These nonclinical proof-of-mechanism studies support further evaluation of ataluren as a treatment of nmMPS1 and other lysosomal storage diseases caused by nonsense mutations. Even low levels of restored α-l-iduronidase function can alleviate the MPS-I phenotype. Given that ataluren is administered systemically, crosses the blood–brain barrier, and penetrates other tissues relevant to the disease, there is potential for ataluren treatment to attenuate the cardiac and neurological defects associated with nmMPS1, alone or in combination with enzyme replacement therapy or hematopoietic stem cell transplantation. Conflicts of Interest: RJS, AR, MW, and EMW are employees of PTC Therapeutics, Inc, and hold financial interests in the company.

1164 - Development of an Adenoassociated Viral Vector for Mucopolysaccharidosis IIIC

Claire O’Leary¹, Andre Antunes², Helen Parker¹, Els Henckaerts², Michael Linden², Fiona Wilkinson¹, Alexey V. Pshezhetsky³, and Brian Bigger¹

¹University of Manchester, Manchester, United Kingdom

²Kings College London, London, United Kingdom

³University of Montreal, Montreal, Canada

Introduction: Mucopolysaccharidoses (MPS) type IIIC is an autosomal recessive neurodegenerative lysosomal storage disorder caused by the lack of the heparan sulfate (HS)-degrading enzyme heparan sulfate acetyl-CoA:α-glucosaminide N-acetyltransferase (HGSNAT). Inherited deficiency in HGSNAT leads to storage of HS and results in central nervous system disturbance including developmental delays, behavioral difficulties, sleep disturbances, and dementia. The biggest challenge in developing therapies for MPS is to achieve efficient delivery across the blood–brain barrier and into the central nervous system. Gene therapy has great potential for treating MPS-IIIC. The adenoassociated viral (AAV) vector system has been used in a number of studies for neurological correction including an ongoing clinical trial for the related disease MPS-IIIA; therefore, intracranial injection of AAV has the potential to restore brain enzyme levels and correct neurological input. Methods: An AAV vector was generated using the Rh10 serotype containing green fluorescent protein (GFP) controlled by either a cytomegalovirus or a chicken β actin (CAG) promoter. Stereotaxic injection into the striatum was performed using coordinates from a mouse atlas. Mice were killed at 1-week and 3-week postinjection, and GFP expression was analyzed. Results: Improved GFP expression was observed in animals that had received the GFP virus containing the CAG promoter at the 3-week time point. Conclusion: We have now generated an AAV vector containing HGSNAT including the CAG promoter using the Rh10 serotype for therapy of MPS-IIIC. Efficacy of intracranial AAV-HGSNAT will be presented at this meeting.

1165 - Long-Term Efficacy Following Intra-CSF Administration of AAV9-Sulfamidase in the Treatment of Mucopolysaccharidosis IIIA

Sara Marcó^1,2, Albert Ribera^1,2, García Miquel^1,2, Villacampa Pilar^1,2, Motas Sandra^1,2, Molas Maria^1,2, Roca Carles^1,2, Melià Cristian^1,2, Ayuso Eduard^1,2, León Xavier^1,2, Maggioni Luca^1,2, Añor Sonia³, Andaluz Ana³, Ruberte Jesús⁴, Haurigot Virginia^1,2, and Bosch Fatima^1,2

¹CBATEG - Universitat Autònoma de Barcelona, Bellaterra, Spain

²Department of Biochemistry and Molecular Biology, UAB, Bellaterra, Spain

³Animal Medicine and Surgery, School of Veterinary Medicine, UAB, Bellaterra, Spain

⁴CBATEG and Animal Health and Anatomy, School of Veterinary Medicine, UAB, Bellaterra, Spain

Introduction/Objectives: Mucopolysaccharidosis type IIIA (MPS-IIIA) or Sanfilippo A syndrome is an autosomic recessive lysosomal storage disease caused by deficiency in sulfamidase, a sulfatase involved in the stepwise degradation of the glycosaminoglycan (GAG) heparan sulfate (HS). Because of enzyme deficiency, HS accumulates in the lysosomes of cells, causing cell dysfunction and, eventually, cell death, in tissues and organs of the whole body, but affecting predominantly the central nervous system (CNS). We previously demonstrated in MPS-IIIA mice that intracisternal delivery to the cerebrospinal fluid (CSF) of sulfamidase-encoding adenoassociated viral 9 (AAV9) vectors mediated whole-body disease correction through transgene expression throughout CNS and liver as soon as 4 months after vector administration. The aim of this study was to evaluate the long-term efficacy of this gene therapy approach. Methods: Adenoassociated viral 9 vectors encoding for the sulfamidase gene were administered via cisterna magna to adult MPS-IIIA mice to evaluate the therapeutic long-term (>10 months follow-up) efficacy of the therapy on CNS and somatic pathology through biochemical, histopathological, and functional measurements. We also administered vectors encoding for the canine sulfamidase to adult healthy Beagle dogs to evaluate safety and to monitor long-term expression of the transgene in a large animal model. Results: This study provides evidence for the long-term biochemical, histological, and behavioral correction of the disease phenotype following AAV9-based sulfamidase gene transfer to MPS-IIIA mice. Moreover, in healthy Beagle dogs, a single intra-CSF administration of AAV9 vectors encoding for canine sulfamidase at the therapeutic dose resulted in a long-term (>18 months) stable increase in sulfamidase activity in the CSF, in the absence of any safety concerns. Conclusion: Overall, these results demonstrate the long-term efficacy and safety of intra-CSF AAV9 sulfamidase gene transfer and support the clinical translation of this approach for the treatment of MPS-IIIA. Conflict of Interest: Eduard Ayuso and Fatima Bosch are coinventors on a patent application for the use of AAV vectors for the treatment of MPS-IIIA.

1178 - Development of a Gene Therapy Approach to Treat Mucopolysaccharidosis Type IIIB

Albert Ribera¹, Sara Marcó¹, Miquel Garcia¹, Sandra Motas¹, Pilar Villacampa¹, Carles Roca¹, Xavier León¹, Luca Maggioni¹, Victor Sánches¹, Sergio Muñoz¹, Jesús Ruberte¹, Virginia Haurigot¹, and Fatima Bosch¹

¹Universitat Autònoma de Barcelona, Barcelona, Spain

Introduction/Objectives: Mucopolysaccharidosis type IIIB (MPS-IIIB) is an autosomal recessive lysosomal storage disease caused by the α-N-acetylglucosaminidase enzyme deficiency, involved in the stepwise degradation of the glycosaminoglycan (GAG) heparan sulfate (HS). Accumulation of undegraded HS leads to lysosomal pathology, which in turn results in severe progressive neurodegeneration as well as somatic disease affecting several organs. Patients die between the first and second decades of life. Since there is no effective cure for this disease, new therapeutic approaches are needed. The aim of this study was to develop a new gene therapy-based approach to counteract central nervous system (CNS) and somatic manifestations in the MPS-IIIB mouse model. Methods: Viral vectors coding for the α-N-acetyl-glucosaminidase (NAGLU) protein were developed and administered to adult MPS-IIIB mice, and the effects of the therapy on CNS and somatic pathology were assessed through biochemical, histopathological, and functional measurements. Results: Three months after vector administration, MPS-IIIB-treated mice showed increased NAGLU activity levels in CNS, liver, and serum, which led to a correction of CNS and somatic lysosomal GAG accumulation. The severe neuroinflammation characteristic of MPS-IIIB was also corrected. Moreover, the gene therapy-based treatment succeeded in correcting behavioral deficits and dramatically improved survival. Studies of gene expression profiling further confirmed the therapeutic potential of the approach. Conclusion: This study demonstrates that our novel gene therapy approach simultaneously corrects CNS and somatic MPS-IIIB disease following a single vector administration.

1184 - BBB Crossing in Lysosomal Storage Disorders: A Nanoparticle-Based Approach

Laura Rigon¹, Marika Salvalaio¹, Giovanni Tosi², Daniela Belletti², Francesca D’Avanzo¹, Barbara Ruozi², Maria Angela Vandelli², Flavio Forni², Maurizio Scarpa¹, and Rosella Tomanin¹

¹University of Padova, Padova, Italy

²University of Modena and Reggio Emilia, Modena, Italy

Introduction: Enzyme replacement therapy (ERT) is the most common therapeutic strategy applied to several lysosomal storage disorders including mucopolysaccharidosis type I (MPS-I) and II (MPS-II). Both diseases are characterized by a totally or partially defective activity of lysosomal enzymes involved in the catabolism of the glycosaminoglycans (GAGs), which therefore heavily accumulate within cellular compartment and in the extracellular matrix. Although presenting several forms of clinical severity and disease progression, both pathologies affect most of the organ systems, and about two-thirds of the patients show neurological impairment. Enzyme replacement therapy, applied to both diseases in the last years, has produced some clinical improvements, but it cannot treat the central nervous system impairment due to its inability to cross the blood–brain barrier (BBB). Methods: We produced polymeric nanoparticles (poly(lactic-co-glycolic acid) nanoparticles [PLGA-NPs]) modified with 7 amino acid glycopeptides (g7), able to drive NPs across the BBB in rodents. Before going into functional and efficacy study, we studied the ability of these biodegradable and biocompatible PLGA-NPs in carrying across the BBB the fluorescein isothiocyanate-tagged albumin (FITC-albumin), as a model drug with a high molecular weight, similar to that of the enzymes used in ERT. In vivo experiments, on both wild-type (Wt) and knockout (Ko) mouse models for MPS-I and MPS-II, were performed by intravenously injecting g7-NPs loaded with FICT-albumin, together with a plethora of control samples. Results: Results clearly showed that g7-NPs are able to cross the BBB in all treated mice (Wt and Ko) and to deliver FITC-albumin to the brain; interestingly, we found qualitative and semiquantitative evidences of a higher grade of brain accumulation of g7-NPs loaded with albumin in Ko-brains with respect to Wt ones. Conclusion: These results lay the basis for a possible successful set of pilot experiments on the ability of enzyme-loaded g7-NPs to deliver sufficient amount of the drug to the brain district, hopefully exerting a corrective effect on the neurological manifestations.

1191 - Treatment of Mucopolysaccharidosis I Mice With Microencapsulated Cells Overexpressing IDUA Implanted in the Omentum or Subcutaneous Tissue

Talita G. de Carvalho¹, Barbara Z. Martinelli¹, Valeska L. Lagranha¹, Giuseppe A. Testa¹, Guilherme Baldo¹, Nelson Kretzmann Filho¹, Ursula Matte¹, and Roberto Giugliani¹

¹Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

Objective: The aim of this study was to evaluate the effect of treatment in mucopolysaccharidosis I (MPS-I) mice treated with microencapsulated cells overexpressing α-l-iduronidase (IDUA) in 2 different sites of implant. Methods: Recombinant cells overexpressing IDUA were encapsulated in sodium alginate and implanted in the omentum (n = 10) or subcutaneous (n = 8) tissue of 4-month-old MPS-I mice. Three animals from each group were killed 24 hours later. The remaining animals were killed after 2 months (omentum group) or 4 months (subcutaneous group) of treatment. Control groups consisted of untreated MPS-I and normal mice of same age. Urine and blood samples were collected during treatment. After killing, microcapsules were recovered and organs (liver, kidney, and heart) were collected for IDUA activity assay, glycosaminoglycan (GAG) measurement, and histological analysis. Results: Both the omentum and the subcutaneous groups showed an increase in IDUA activity in the liver, kidney, and heart after 24 hours of the implant. At the end of treatment, an increase in IDUA activity was only observed in the heart for the omentum group, while in the subcutaneous group, IDUA activity was higher in liver, kidney, and heart. Serum IDUA activity increased at 7 and 15 days of treatment for the omentum group and at 15, 30, and 45 days for the subcutaneous group. Regarding GAGs levels, a decrease in urinary GAG was observed after 7 days in the omentum group. In the subcutaneous group, no difference was found. Tissue GAGs levels remained elevated. Conclusion: We observed an increase in IDUA activity in evaluated tissues in both groups. However, it was not sufficient to reduce tissue GAG levels, possibly due to immune response against the biomaterial or the enzyme produced. Support: FIPE-HCPA, FAPERGS, CAPES, and CNPq.

11. Related Diseases

1007 - Pedigree Analysis in Patients With Fabry Disease: Evaluating Changes in Referral and Diagnosis Over Successive Generations

Christine Lavery¹, Derralynn Hughes², Uma Ramaswami², Chris Hendriksz³, and Tarek Hiwot⁴

¹Society of Mucopolysaccharide Diseases, MPS House, Amersham, United Kingdom

²Royal Free Hospital, London, United Kingdom

³Salford Royal Foundation Trust, Manchester, United Kingdom

⁴University Hospital, Birmingham, United Kingdom

Fabry disease is a progressive X-linked lysosomal storage disease that can affect multiple generations of the same family. Understanding of the natural history and management of Fabry disease in males and females have improved substantially in the recent decades. It is of interest to determine whether this progress is reflected in changes in the number of patients diagnosed in a single family, patient experience of learning they may be at risk of Fabry disease, and subsequent diagnosis. To investigate these, 3 large Fabry cohort families have shared their family trees as they know it. Patient records and death certificates are being used to identify alive and family members who died with confirmed or suspected Fabry disease based on patterns of inheritance. Early results suggest in our first family cohort that there are 4 generations of females with Fabry disease before it affected a male in the direct line. Changes in life expectancy will also be evaluated by reviewing death certificates available since 1837. In each arm of the family, members will be asked about the impact the Fabry disease has had on their lives, the way they learnt about Fabry disease, and the support they received during testing and diagnosis. Findings from this study will aid the development of best practice guidelines for managing the diagnosis of Fabry disease in extended family members.

1059 - Biochemical Characterization of a Sample of Brazilian Patients With Mucolipidosis II/III and a Purpose of Diagnostic Protocol

Taciane Alegra¹, Maira Burin², and Ida V. D. Schwartz³

¹Post Graduation Program in Genetics and Molecular Biology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil

²Medical Genetics Service, Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

³Genetics Department, Federal University of Rio Grande do Sul, Porto Alegre, Brazil

Introduction: Mucolipidoses (MLs) II and III are rare lysosomal diseases secondary to N-acetylglucosamine phosphotransferase (GlcNac-phosphotransferase) deficiency, leading to increased activity of lysosomal hydrolases in plasma, reduced activity in fibroblasts, and normal activity in leukocytes. First step in diagnosis is clinical suspicion; the definite involves identification of the deficiency in the GlcNAc-phosphotransferase activity, available only in rare centers of research. Thus, the GlcNac activity is measured indirectly, by assessing many lysosomal enzymes in leukocytes, fibroblasts, and plasma. However, there is no consensus to what enzymes should be investigated, and a panel is randomly researched in different places, with weak evidence that gives basis to this practice. Objective: To characterize lysosomal hydrolases activity in ML II/III, in order to propose a diagnostic protocol. Methods: Cross-sectional study, including patients with clinical and biochemical diagnosis of ML II or III. We analyzed enzymes investigated at least in 4 patients, measured in plasma and fibroblasts, electing to the protocol those enzymes with the largest differences from the reference values and lower costs. Mean difference in activities between MLs II and III were compared using t test. Results: A total of 37 patients were included (type II = 24 and III = 13), all with lysosomal enzymes evaluated in plasma and 15 in fibroblasts. Among enzymes in plasma, there was a mean increased activity in the following enzymes: α-mannosidase, α-l-iduronidase, α-N-acetylgalactosaminidase, α-N-acetylglucosaminidase, hexosaminidase, iduronate sulfatase, and β-glucuronidase; only chitotriosidase was normal. Among enzymes evaluated on fibroblasts, there was diminished activity: neuraminidase, α-l-iduronidase, α-mannosidase, β-galactosidase, esfingomielinidase, β-glucuronidase, hexosaminidase, iduronate sulfatase, and α-N-acetylglucosaminidase; only β-glucosidase was normal. Discussion/Conclusion: Our data suggest some differences in biochemical phenotype of MLs II and III. Taking into consideration the cost of the enzyme assay, number of patients evaluated in our sample, the biggest difference in normal values, and the possibility of performing the same test on different samples, the following were chosen: arylsulfatase A, α-mannosidase, α-iduronidase, and hexosaminidase.

1085 - Epigenetic Alterations in Niemann-Pick Type C Models: Neuronal Gene Repression Mediated by the c-Abl/HDAC2 Pathway

Pablo Contreras¹, Marcelo González¹, Alejandra Alvarez¹, and Silvana Zanlungo¹

¹Universidad Católica de Chile, Santiago, Chile

Introduction: Niemann-Pick type C (NPC) disease is a neurodegenerative lysosomal cholesterol storage disorder resulting from loss-of-function mutations in either the NPC1 or the NPC2 genes. Recently, histone deacetylases (HDAC) inhibitors have emerged as possible cholesterol lowering drugs for NPC treatment due to the expression induction of several genes involved in cholesterol metabolism and neuronal function. Previously, our laboratory has shown that c-Abl activity is increased in NPC and Alzheimer disease (AD) models and stabilizes HDAC2 levels in AD models. Our principal objective was to evaluate whether c-Abl activity induces upregulation of HDAC2 and in this way, the inhibition of neuronal genes expression in NPC models. Methods: We used different NPC models: (1) pharmacological models: primary cultures of hippocampal neurons (7DIV), Hepa 1-6, and neuronal HT22 cells were treated with U18666A (U18) and (2) genetic models: NPC1 null fibroblasts and NPC1 null mice. We treated the cells and animals with the c-Abl inhibitor, imatinib, and evaluated (1) HDAC2 levels by immunoblot and immunofluorescence, (2) the recruitment of HDAC2 in the promoter of neuronal genes (GluR1, NR2a, synaptotagmin I, and synaptophysin) by chromatin immunoprecipitation assay, (3) the expression of these neuronal genes by real-time polymerase chain reaction, and (4) cholesterol levels by filipin staining. Results: We found increased HDAC2 levels in both U18-treated primary hippocampal neurons and the cerebellum and brain of NPC1 null mice. Treatment with imatinib (1) induced a decrease in HDAC2 levels, (2) prevented HDAC2 recruitment on neuronal gene promoters, and (3) reduced neuronal gene repression. Interestingly, c-Abl inhibitor reduced cholesterol accumulation in Hepa 1-6 and neuronal HT22 U18-treated cells and in the fibroblast NPC1 genetic model. Conclusion: c-Abl induces an increase in HDAC2 levels promoting the repression of neuronal genes. Moreover, c-Abl inhibition reduces cholesterol accumulation. With these novel data, we suggest that c-Abl/HDAC2 pathway is a possible target for NPC treatment.

1120 - Genetic Characterization of A359D, the Most Frequent SMPD1 Mutation, Causing Niemann-Pick Type B Disease in Chilean Patients

Paulina Mabe¹, M. Acuña², P. Martínez², M. Lagos², M. Gonzalez³, J. F. Miquel², J. L. Santos², E. Schuchman⁴, and S. Zangulo²

¹Hospital Exequiel González Cortés, Santiago de Chile, Santiago, Chile

²Facultad de Medicina, Pontificia Universidad Católica de Chile, Santiago, Chile

³INTA, Universidad de Chile, Santiago, Chile

⁴Mount Sinai School of Medicine, New York, NY, USA

Background/Aims: Niemann-Pick disease type B (NPDB) is a recessive hereditary disorder caused by deficiency in acid sphingomyelinase (ASM) due to mutations in the sphingomyelin phosphodiesterase 1 (SMPD1) gene. The A359D mutation has been described only in Chilean patients. Our goal was to characterize the frequency of the A359D mutation in the healthy Chilean population. Additionally, we included the first clinical and genetic characterization of A359D homozygous patients. We also wanted to determine whether this mutation originated from a common ancient founder and its effect on ASM activity. Methods: We analyzed the frequency of the A359D mutation in 1691 genomic DNA samples from healthy individuals by Taqman allelic discrimination. We included the clinical data of 13 A359D homozygous patients. In 6 of them, the haplotype was determined using different genetic markers. Effect of A359D on ASM activity was determined in cells transfected with wild-type and A359D cDNAs constructions and in fibroblasts of patients. Results: The frequency of the A359D mutation was 1/105.7 and the theoretical prevalence of NPDB in Chile, due to this mutation, is 1/44.960. All 13 patients analyzed have moderate to severe NPDB phenotype, increase hepatic transaminases, and normal cognition development. Six of them showed a conserved haplotype and shared a 280-kb region around the SMPD1 gene, indicating that the mutation originated from a common ancient ancestor. Cells expressing the A359D ASM protein showed a 4.2% acid sphingomyelinase activity. Similar activity was found in fibroblasts of patients, confirming this variant has a functional effect and is responsible for NPDB disease. Conclusion: The A359D mutation is frequent in the healthy Chilean population and has a common ancient founder. Homozygous patients have a moderate to severe NPDB phenotype. This mutation reduces ASM activity considerably. Conflicts of Interest: P. Mabe: meetings and courses supported by Genzyme, Shire, and BioMarin. Conferences supported by Genzyme and BioMarin. Clinical trials supported by Genzyme.

1134 - Mitochondrial Dysfunction and Oxidative Stress: A Pathogenic Mechanism for Niemann-Pick Type C Disease

Elisa I. Balboa¹, Tamara A. Marin¹, Juan F. Castro¹, Alejandra R. Alvarez², and Silvana Zanlungo¹

¹Departamento de Gastroenterología, Facultad de Medicina, Pontificia Universidad Católica de Chile, Santiago, Chile

²Biología Celular y Molecular, Facultad de Cs Biológicas Pontificia Universidad Católica de Chile, Santiago, Chile

Introduction: Niemann-Pick type C (NPC) disease is a neurovisceral lipid storage disorder involving cholesterol accumulation in lysosomes and impaired cholesterol homeostasis. The pathogenic mechanism linking the accumulation of intracellular cholesterol with cell death in NPC disease is currently unknown. Oxidative stress has been observed in tissues from NPC mice and in NPC cellular models. Recent evidence strongly suggests that mitochondrial cholesterol accumulation and dysfunction play an important role in NPC pathogenesis. One of the proteins involved in cholesterol transport from lysosomes to mitochondria is lysosomal metastatic lymph node 64 (MLN64). Objectives: To evaluate the involvement of MLN64 in mitochondrial dysfunction and cholesterol accumulation in vivo and in vitro and to analyze whether antioxidant therapies can ameliorate the mitochondrial dysfunction and neurodegeneration in NPC cells and mice, respectively. Methods: In NPC models and in cells where MLN64 was downregulated/overexpressed, we evaluated expression of MLN64 and mitochondrial fusion/fission proteins by Western blot, oxidative stress, and mitochondrial membrane potential (MMP) using fluorescent probes and mitochondrial cholesterol content by high-performance liquid chromatography. Niemann-Pick type C cells and mice were treated with piracetam, vitamin E, and GSHEE and mitochondrial function, survival, coordination, and locomotor function were evaluated. Results: An increase in MLN64 expression was associated with mitochondrial dysfunction in NPC cells and oxidative damage in livers from NPC mice. Livers from mice overexpressing MLN64 showed mitochondrial dysfunction, increased mitochondrial cholesterol, and oxidative stress. Treatment with MLN64-siRNA restored MMP and decreased mitochondrial superoxide production in NPC cells. Vitamin E delayed the loss of weight, improved coordination and locomotor function, and increased the survival of NPC mice. Conclusion: Increased mitochondrial cholesterol accumulation mediated by MLN64 overexpression could be one of the pathogenic mechanisms mediating mitochondrial dysfunction and increased oxidative stress in NPC disease. Treatment with vitamin E can delay neurodegeneration in NPC mice, suggesting that this dietary supplementation could be useful for the treatment of patients with NPC.

1163 - Phenotype Versus Genotype: Are Skin, Hair, and Eyes of Patients With Mucolipidosis II/III Lighter Than Expected?

Taciane Alegra¹, Fernanda S. Ludwig², Ana V. Bau³, Maria C. Bortolini¹, Caio C. S. Cerqueira⁴, and Ida V. D. Schwartz⁵

¹Post Graduation Program Genetics and Molecular Biology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil

²Gene Therapy Center, Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil

³Federal University of Health Sciences of Porto Alegre, Porto Alegre, Brazil

⁴Centro Nacional Patagônico (Cenpat/Conicet), Chubut, Argentina

⁵Genetics Department, Federal University of Rio Grande do Sul, Porto Alegre, Brazil

Introduction: Mucolipidoses (ML) II and III are lysosomal storage disorders due to N-deficiency in acetylglucosamine phosphotransferase (GlcNAc-phosphotransferase) , the enzyme responsible for correct targeting of hydrolases to the lysosomes. There is empiric evidence that patients with ML-II/III have eyes, skin, and hair lighter than expected. Our hypothesis is that melanogenesis is altered in (at least) a subset of patients with ML-II/III due to the disruption of vesicular targeting and melanosomes function. Objectives: To evaluate the degree of pigmentation of skin, hair, and eyes in a sample of patients with ML-II/III seen at a Brazilian reference center for LSD. Methods: The study comprises multiples strategies, but this report deals with the phenotype–genotype association between the degree of pigmentation and the single-nucleotide polymorphisms (SNPs) previously known to be strongly associated with pigmentation in humans. Eighteen patients (type II n = 9, type III α/β n = 6, and type III γ = 3), and their parents, were evaluated in relation to phenotype characteristics of skin, hair, and eyes using the Fitzpatrick and the Red-Green-Blue scales and the visual classification as well. The following SNPs were analyzed: rs1126809 (TYR gene), rs16891982 (SLC45A2 gene), rs1426654 (SLC24A5 gene), and rs1129038 (HERC2 gene). Results/Discussion: Single-nucleotide polymorphism rs1126809 was not concordant with skin color in 1 of the 18 patient (ML II) and for eye color in 2 of the 18 patients (ML II = 1); the nonconcordant patients were lighter than expected. For rs16891982, 2 of the 18 patients (ML II = 1; ML III α/β = 1) had lighter skin and 2 of the 18 had darker skin color than expected (ML II = 1). Differences between ML-II and ML-III or between ML-IIIα/β and ML-IIIγ were not found with regard to the evaluated outcomes. Conclusion: Although the sample is small and other genes can also influence the phenotype, our data suggest there is a subset of patients with ML-II/III who may present defects in melanogenesis. Support: CNPq/FAPERGS

1171 - Poor Response to Early Enzyme Replacement Therapy in an Argentinean Patient With Infantile Pompe Disease: It Is All About Antibodies?

Analia M. Cabrera¹, Humberto E. Fain¹, Hernan Amartino², Daniela Roldan¹, Ronald Coteluzzi¹, Maria R. Aldao¹, and Viviana M. Buiras¹

¹Hospital de Niños V.J.Vilela, Rosario, Argentina

²Hospital Universitario Austral, Pilar, Argentina

Objective: To describe the clinical outcome and response to alglucosidase α treatment in a patient with infantile Pompe disease with unusual genotype. Method: CS, male first child of a nonconsanguineous couple. At birth, he had a mild cardiomegaly, with normal cardiac function. In his first month of life, his weight gain was insufficient and he developed hypotonia with progressive respiratory difficulties. At hospital admission, he was severely hypotonic but alert and had a mild hepatomegaly, with a mild elevation in aspartate aminotransferase and alanine transaminase. Enzymatic test confirmed Pompe disease: α-glucosidase (GAA) 3.71 nmol/h mg (6.61-34.14 nmol/h mg) and Rel. NGA/IGAA: 409.6. The patient started enzyme replacement therapy (ERT) with 20 mg/kg/dose of alglucosidase α (Myozyme; Genzyme, Cambridge, Massachusetts) during his second month of life. Results: The patient required invasive ventilation in his first week of treatment and is still requiring it 16 months later. The cardiomegaly did not improve, and his gross motor development evaluated (Alberta Motor Scale) at the beginning of the treatment and after 16 months is poor. We received the extracted GAA DNA sequencing, and 2 heterozygous GAA mutations were detected: c.236_246del and c.377G>A. These mutations were described only in 1 patient who died at age 10 months before ERT. Cross-reactive immunological material (CRIM) status was not investigated due to difficulties in shipping fibroblasts samples. We are not able to predict the CRIM status by genotype in this patient. The antibody status titers after 12 months of treatment were 6400, but the inhibition of enzyme activity test was negative. Conclusion: Although further investigation is required, the c.236_246del/c.377G>A genotype seems to be associated with severe phenotype and bad response to ERT in spite of the fact it was started very early. We emphasize the importance of obtaining CRIM status in every patient with Pompe disease in order to provide immunomodulatory treatment when necessary.

1180 - Enzyme Replacement Therapy in Children and Adolescents With α-Mannosidosis: An 18-Month Follow-Up

Line Borgwardt¹, Christine I. Dali¹, Jens Fogh², Jan-Eric Månsson³, Klaus Juul Olsen⁴, Hans Christian beck⁵, Kim G Nielsen⁶, Lars Holme Nielsen⁷, Steen Oestergaard Olsen⁷, Hilde Monica Stensland⁸, Nilssen Oivind⁸, Anne-Marie Thuesen⁹, Thea Pearl¹⁰, Ulla Haugsted¹⁰, Flemming Wibrand¹, Paul Saftig¹¹, Judith Blanz¹¹, Simon Jones¹², Anna Tylki-Szymanska¹³, Nathalie Guffon.Fouiloux¹³, and Michael Beck¹⁴

¹Department of Clinical Genetics, Copenhagen University Hospital, Rigshospitalet, Denmark

²Zymenex A/S (Chiesi Group), Hilleroed, Denmark

³Department of Psychiatry and Neurochemistry, Sahlgrenska University Hospital, Mölndal, Sweden

⁴Larix, CRO, Ballerup, Denmark

⁵Department of Clinical Biochemistry and Pharmocology, Odense University Hospital, Denmark

⁶Department of Paediatrics and Adolescent Medicine, Rigshospitalet, Copenhagen, Denmark

⁷Department of Otorhinolaryngology, University Hospital, Rigshospitalet, Copenhagen, Denmark

⁸Department of Clinical Medicine, Medical Genetics, University of Tromsø, Tromsø, Norway

⁹Psykolog 2, Virum, Denmark

¹⁰Department of Occupational Therapy and Physiotherapy, Rigshospitalet, Copenhagen, Denmark

¹¹Biochemisches Institut, Christian-Albrechts-Universität Kiel, Germany

¹²Genetic Medicine, St Mary’s Hospital, University of Manchester, United Kingdom

¹³Department of Metabolic Diseases, The Children's Memorial Institute Poland, Warszawa, Poland

¹⁴Hopital Eduard Herriot, Service de Pédiatre, Lyon, France

¹⁵Villa Metabolica Universitäts-Kinderklinik Mainz, Germany

Introduction: α-Mannosidosis is a rare lysosomal storage disorder caused by deficiency in α-mannosidase. The clinical picture is varied and includes growth impairment, motor disturbances, intellectual disabilities, facial characteristics, and hearing impairment consequent to accumulation of uncatabolized oligosaccharides. A recombinant human α-mannosidase enzyme (rhLAMAN) has been developed for weekly intravenous enzyme replacement therapy. We present the preliminary data after 18 months of treatment. Methods: A total of 10 patients (7-17 years of age) were treated with rhLAMAN for 18 months (9 completed) in a single-arm, phase I-II trial. Efficacy was assessed by evaluation of motor function (6-minute walk test [6MWT], 3-min stair climb test [3MSCT], and Bruininks-Oseretsky test of motor proficiency second edition) and cognitive function (Leiter-R), measurement of oligosaccharides in serum, urine, and cerebrospinal fluid (CSF), and neurodegeneration biomarkers in CSF. Results: Oligosaccharides: S-, U-, and CSF-oligosaccharides decreased by 89.9% (P < .001), 23.8% (P = .108), and 10.7% (P = .107), respectively. The CSF biomarkers: CSF-NFLp, CSF-GFAp, and CSF-τ protein decreased by 29.8% (P = .005), 41.2% (P < .001), and 9.5% (P = .104), respectively. Motor function: improvements were observed in 3MSCT (average= +39 steps, P = .004) and in 6MWT (+71 m, P = .009). Cognitive function: improvement in the total equivalence age of 6 months was observed during the 18 months in Leiter-R test (P = .022). Conclusion: These preliminary data show a relevant improvement across several clinical and biochemical end points after 18 months of treatment with rhLAMAN in patients with α-Mannosidosis. A 12-month, multicenter, double-blinded, randomized, and placebo-controlled phase 3 trial is ongoing to confirm efficacy and safety of rhLAMAN.

1188 - Gangliosides and Neurodegeneration: A New Inborn Error of Glycosphingolipid Metabolism Presenting as Complicated Hereditary Spastic Paraplegia

Charles M. Lourenço¹, Giovanni Stevanin², Stephan Zuchner³, and Wilson Marques Jr¹

¹Neurogenetics Unit, Clinics Hospital of Ribeirao Preto, University of Sao Paulo, São Paulo, Brazil

²Centre de Recherche de l’Institut du Cerveau et de la Moelle epiniere, Paris, France

³John P. Hussman Institute for Human Genomics, Miami, FL, USA

Introduction: Hereditary spastic paraplegias (HSPs) comprise a complex and heterogeneous group of neurological disorders. Although majority of cases of HSPs are due to genes involved in axonal growth or vesicular trafficking, there are genes involved in complex metabolic pathways that can cause HSP. Objective: To report a new hereditary metabolic cause of HSP in a Brazilian family caused by enzyme deficiency in β-1,4-N-acetyl-galactosaminyl transferase 1 (B4GALNT1), involved in ganglioside biosynthesis. Methods: After excluding the traditional inborn errors of metabolism (IEMs) associated with HSPs and molecular analysis of spastic paraplegia (SPG) 11 and SPG15 genes, whole exome sequencing was performed. All sequencing results were analyzed by the Genomes Management Application (GEM.app). Results: Mutations in the B4GALNT1 gene (in the SPG26 locus) were identified in all affected patients in the family; parents were heterozygous carriers of the mutation. Patients affected by this disease have early-onset spastic paresis, mild intellectual disability, cerebellar ataxia, strabismus, and some can develop psychiatric disturbance. Male hypogonadism was also noticed. Brain magnetic resonance imaging showed nonspecific white matter changes in older patients. Conclusion: Although there are many IEMs involved in the ganglioside catabolism presenting as neurodegenerative disorders, this enzyme deficiency is the second human disorder identified in the pathway of ganglioside biosynthesis, suggesting that other human diseases can be caused by metabolic errors leading to glycosphingolipid synthesis defect.

1229 - Farber Disease: Differential Diagnosis for Early Contractures and Arthritis

Alexander Sólyom¹, Nesrin Karabul², Ivan Galanin³, Calogera Simonaro⁴, and Edward Schuchman⁴

¹Pediatric Rheumatology, Pediatric Hospital, University of Pécs, Pécs, Hungary

²Villa Metabolica, Children’s Hospital, University Medical Center, Mainz, Germany

³Plexcera Therapeutics LLC, New York, NY, USA

⁴Mount Sinai School of Medicine, New York, NY, USA

Introduction: Farber disease is an ultrarare lysosomal storage disease (LSD) resulting from the inherited deficiency in acid ceramidase and the accumulation of ceramide. Ceramide is a proinflammatory and proapoptotic lipid implicated in the pathogenesis of cartilage disorders. Farber has a heterogeneous presentation ranging from a severe phenotype with respiratory and central nervous system (CNS) involvement with an average life expectancy of <2 years, to a moderate phenotype typically including joint swelling, subcutaneous nodules, contractures, and pain. Awareness of Farber disease is limited due to its rarity, and moderate cases might be initially considered to be juvenile idiopathic arthritis (JIA) or another LSD such as mucopolysaccharidosis (MPS). Methods: To test the hypothesis that moderate Farber disease has been diagnosed as JIA in practice, we conducted a literature search for moderate Farber disease case studies, defined as reaching >2 years of age without organomegaly or CNS involvement. We have additionally developed a targeted clinical questionnaire, and diagnostic code-based patient selection method to better assess the prevalence of Farber disease among children with polyarticular joint disease. Results: Of the 84 unique articles and 35 Farber disease case studies, 40% described patients with moderate disease (36% initially diagnosed with JIA). Conclusion: Moderate Farber cases may be diagnosed as JIA or an attenuated form of MPS due to primary involvement of the joints and connective tissue. Differential diagnosis can be made by accounting for the comparatively early-onset, progressive symmetric arthritis, presence of subcutaneous nodules, and an unusual, hoarse cry or voice in patients with Farber disease. Acid ceramidase enzyme therapy (recombinant human acid ceramidase) is currently under development and is expected to enter clinical trials in 2015. Screening of the population of children with symmetric joint contractures and/or arthritis for other symptoms of Farber disease will hopefully reveal patients who then can benefit from disease-specific care and treatment.

Author Index

Abé-Sandes K

7

Abed SN

5

Aboulnasr AAL

37

Acosta A

7, 22, 73

Acosta AX

7, 25, 72, 75

Acosta EB

12

Acosta JC

26

Acosta MA

46

Acuña M

91

Adintori E

36

Aglan MS

31

Aguiar O

1

Ahmed A

10, 75

Ahn K

61

Al-Sayed M

42

Alan M

57

Alcantara MA

45, 46

Aldao MR

93

Alegra T

45, 48, 71, 90, 92

Almeciga CJ

40, 84

Almeciga-Diaz CJ

40, 84

Alméciga-Díaz CJ

17, 76

Alvarez A

91

Alvarez AMC

46

Alvarez AR

92

Alves AF

28

Amartino H

93

Amorim T

7

Andaluz A

88

Andrade LB

11, 80

Añor S

88

Antonozzi S

70

Antonozzi SL

54, 77

Antunes A

88

Antunes C

38

Aoyagi-Scharber M

36

Aranda CS

16, 21, 27, 60, 62, 69

Arash L

20

Ardila YA

26

Ardila YA

25

Artigalás O

71

Askin GN

68

Atwood R

39

Auray-Blais C

29, 37

Ausseil J

3

Ayala A

32

Ayala P

43

Ayuso E

88

Ayyad A

5

Azar N

54, 70, 77

Babaykina M

9

Balboa EI

92

Baldo G

4, 15, 57, 72, 74, 89

Baraqoni N

5

Barbier AJ

31, 66, 67

Barbosa HM

84

Barbosa PO

6

Barrera LA

17, 18, 26, 84

Barrerra LA

76

Barreto GE

40

Barros-Angueira F

46

Barth A

70

Barth AL

17, 23, 24, 55, 59, 60, 73

Basquiera AL

77

Bau AV

92

Bay L

77

Bazarragchaa M

12

Becerra AB

11, 54, 70, 77

Beck HC

93

Beck M

19, 63, 93

Bedwell DM

87

Begley DJ

68

Behúlová D

35

Bell L

51

Bellesso S

2

Belleti D

89

Bender F

7, 35, 72

Benmansour A

38

Benyó G

79

Berretta A

77

Bertoldi K

76

Bessems GJHJM

18

Bezerra PGM

11

Bhagwat S

36

Bialer MG

59

Bielefeld B

66

Bigger BW

3, 22, 85, 88

Bittar CM

27, 76

Blank-Landeshammer B

87

Blanz J

93

Bleakley C

79

Bochernitsan A

7

Bochernitsan AN

8

Bonatto D

38

Borbolato G

38

Borges AMFS

23, 69

Borgwardt L

93

Borri ML

27

Bortolini MC

92

Bosch F

88, 89

Boy R

7, 60

Braga MC

35

Braulke T

45

Braunlin E

53

Breen C

79

Breier AC

38, 58

Brion K

46

Brown J

36

Bruce IA

22

Brusius-Facchin AC

8, 35

Bruxel F

84

Bugaeva EV

14

Buiras VM

93

Bulacios S

11

Bullens S

36

Bullock H

20

Bunting S

36

Burin M

7, 35, 90

Burin MG

7

Burton BK

14, 31, 65

Cabral MB

21

Cabrera AM

93

Caciotti A

39, 42

Cagle SR

81

Caillaud C

38

Camelo-Nunes IC

60

Campij P

11

Canossa S

16, 21, 62, 69

Carbarcas L

25, 26

Carvalho CG

73

Carvalho EDF

6

Carvalho KM

6

Carvalho MDF

6

Carvalho TG

4, 74

Castells M

60

Castro JF

92

Cateluzzi R

93

Cathey S

77

Cavalcanti NC

70

Cé J

58

Cerqueira CCS

92

Cerqueira WOS

22

Chakrapani AB

64

Chandoga J

35, 63

Chen A

75

Chen S

71

Chernavina E

9

Chinen Y

78

Cho SY

6, 41, 54, 61

Choi EY

86

Choi Y

3

Chung Y

56

Church HJ

22, 42

Cismondi AI

11

Civallero G

35

Clark KR

82, 83

Clatterbuck C

5

Cleary M

20

Coelho JC

38, 58

Coll MJ

42

Contreras P

91

Córdoba H

76

Costa AAP

17

Costa AF

71

Costa AP

24

Costa R

2

Costa-Carvalho BT

16

Cox GF

56, 65

Cramb J

68

Crawford B

36

Cruz CU

47

Cruz PP

72

Cruz RW

21

Cuaspa R

84

Curiati MA

16, 21, 27, 69

D'Almeida V

35

D'Avanzo

89

D’Almeida V

62

D’Almeida V

3, 16

D’Almeida V

1

da Fonseca GGG

60

da Rocha NS

51

Dali CI

93

Dani C

38

Dantas DC

73

Darin J

36

Davidson K

39, 42

Davis JM

31

de Carvalho TG

57, 84, 89

de Lacerda AE

60

De Pace R

45

DeAngelis VA

12

Decker C

14

Delaney K

9, 10, 20

Delgado A

54, 70

Deps TD

27

Derralynn HÁ

57

Devos AS

18

Díaz D

76

Díaz S

76

Dickson P

36, 75

Dickson PI

71, 86

Diel D

84

Doljoo Z

12

Donsate A

86

Dorneles AD

71

Dridi L

2, 3

Du C

39

Duarte MCMB

11, 80

Duncan FJ

82, 83

Dung VC

62

Dvoráková L

35

Echeverri O

25, 26

Edano CB

65

Eichler S

39

Eiroa H

77

Eizerik DP

71

Ekanayake J

42

El Bougdady N

31

Ellinwood NM

71

Ellison S

85

Ensina LF

60

Ensina LFC

62

Esko J

36

España M

32

Espejo A

76

Espinosa E

25

Esposito AC

17, 23, 24, 55, 59, 60, 70, 73

Eufrazino C

8, 28

Facchin AC

41

Facchin ACB

42

Faghfoury H

28

Fagondes S

74

Fagondes SC

27

Fain HE

93

Fallet S

5, 65

Fan Z

67

Fateen EM

31, 37

Fauler G

87

Federhen A

7, 27, 73, 76

Feio RHF

23, 52

Feliciano P

16, 27, 62

Ferhen A

72

Fernandes M

4

Ferreira NY

3

Ferreira RS

59

Fietz MJ

42, 46

Figueroa C

77

Filho HSM

51

Filho NK

89

Flanigan K

82

Fogh J

93

Forni F

89

Fouad M

31

Fraga M

84

França EC

27

Francis-Lyon P

39

Franco JF

78

Frangipani BJ

74

Freitas NE

21

Frohbergh M

12

Frusciante M

38

Fu H

82, 83

Fuji T

34

Fukushi M

34

Funchal CS

38

Futatsumori H

34

Gabig-Ciminska M

67, 82, 85

Galanin I

94

Galvis J

49

García F

44, 47

Garcia M

88, 89

Garcia R

43

Garcia-Ortiz JE

30

Garlobo L

12

Garzón DA

18

Gavrilov DK

34

Ge Y

12

Gensen CP

12

Gevorkyan A

9

Giese AK

38

Gieselmann V

36

Giner AN

54, 77

Giner-Ayala NA

70

Giraldo G

43

Giugliani L

15, 24

Giugliani R

4, 7, 8, 14, 15, 19, 24, 27, 32, 34, 35, 41, 44, 48, 53, 56, 57, 63, 64, 66, 72, 73, 74, 76, 89

Gole GG

68

Gomes ILS

22

Gomez L

11

Gomez NA

54, 77

Gonçalves CM

21, 74

Gonzales J

40

Gonzalez J

49

Gonzalez M

91

González M

91

Gonzalez-Del Angel A

45, 46

Gort L

42

Goudouris E

60

Gould R

16, 64

Grechanina EY

14

Grechanina YB

14

Grigoryeya L

3

Guarany NR

51, 52

Guelbert GA

54, 70, 77

Guelbert NB

11, 14, 54, 70, 77

Guevara JM

18, 25, 26

Guffon N

14, 53

Guffon.Fouiloux N

93

Guio JCA

21, 43

Gulati S

43

Gupta N

43

Gurjão MM

8

Guterrez ML

62

Gutierrez ML

18

Guzman MA

71

Habekost CT

24, 76

Haddad MR

86

Hadzsiev K

79

Hájková Z

3

Halac IN

11

Hamartz P

14, 20

Hamazaki T

56

Hamilton-Kay C

55

Hansiková H

3

Harmatz P

39, 53, 59, 66

Hartmann M

20

Hashimoto A

62

Haslett P

9, 10, 20

Haugsted U

93

Haurigot V

88, 89

He X

12

Heales S

29

Hedge M

42

Heest AEV

66

Henckaerts E

88

Hendriksz C

14, 51, 53, 79, 90

Hendriksz CJ

31, 66, 67

Herman R

36

Hernández A

76

Hernandez-Amariz MF

39

Herreno AM

84

Herrera J

84

Hidalgo PK

11

Higa T

78

Hiwot T

90

Hlavatá A

35, 63

Hlavatá K

35, 63

Holder II

5

Hong L

81

Hoogeveen-Westerveld M

43

Hopwood JJ

68

Horovitz D

7, 23, 73

Horovitz DDG

55, 70

Horovitz DG

24, 59, 60

Horton J

67

Hoz CMP

12

Hrebícek M

2, 3

Hughes D

90

Huh R

13, 41

Hulková H

2, 3

Hyakuna N

78

Ibrahim MM

31

Ichinkhorloo P

12

Iee J

41

Inwood AC

68

Ishige M

56

Jain M

19, 50, 51, 80

Jakobkiewicz-Banecka J

82, 85

Jakobkiewicz-Banecka JÁ

67

Jay S

12

Jens J

71

Jesina P

10

Jesuíno KCT

7

Jin D

56

Jin DK

6, 13, 54, 61

Jobe RN

50, 79

John AB

27

Jones AS

55

Jones J

22

Jones S

26, 53, 59, 85, 93

Jones SA

14, 20, 66, 79

Juan L

73

Juarez-Osuna JÁ

30

Julia A

77

Junior LMC

72, 73

Jurecka A

26

Kabra M

43

Kaiser T

87

Kakkis E

70

Kaler SG

86

Kállay K

79

Kan SH

71, 86

Karabul N

12, 19, 94

Kassa C

79

Kassahn K

46

Kato S

62

Kaur P

43

Kearney S

67

Kearney SA

50, 79

Keeling KM

87

Kelly K

33

Kelly PM

79

Kennedy J

79

Kerstenetzky MS

11, 80

Kessler RG

72

Ketteridge D

53

Khan S

36, 42

Kim C

56

Kim CA

48, 78

Kim CAK

7

Kim J

61

Kim OH

13

Kitajima JP

48

Kliemann LM

15

Kloska A

82

Ko AR

6, 13, 41, 54

Kobayashi R

56

Kobiela W

67

Kok F

48

Koladicz K

74

Kollmann K

36

Komlósi K

79

Kornfeld S

48

Kosuga M

56

Kovac V

10

Kriván G

79

Kroos MA

43

Kubashi F

41

Kubaski F

8, 13, 32, 33, 42

Kunes Y

66

Kwak H

56

Kwun Y

13, 41

Kyosen SO

16, 62, 74

Kyu D

41

Lacerda KRRS

80

Lacerda L

42

Lacey JM

34

Ladino L

8

Lago-Lestón R

46

Lagos M

91

Lagranha VL

4, 89

LaMarr WA

33

Lampe C

19, 51, 53, 58

Langereis EJ

22, 79

Langford-Smith A

3, 85

Langford-Smith K

85

Laranjeira F

42

Larsen MP

6

Laura L

76

Lavery C

16, 50, 51, 57, 90

Lavoie P

29, 37

Lawrence R

36

Le S

36

Le SQ

71, 86

Leão EKEA

22, 25, 72, 73

Leão-Teles E

53

Lee J

13

Lee S

56

Lee SY

13

Lefèbvre JF

48

Leistner-Segal S

7, 8, 35, 41, 42, 48

Lemos LR

21

Lemos PCB

59

León X

88, 89

Leonardi F

76

Lessa KP

72

Liao AY

85

Lin P

53

Lin SP

14

Linda R

57

Linden M

88

Llerena JC

24, 60

Lopes JC

75

Louenço CM

94

Lourenço CM

7, 34, 45

Ludwig NF

45, 47, 48

Lund T

29, 77

Luz KP

23

Lynch M

6

Mabe P

91

Machado FS

38

Maciel CD

55, 59

Mackenzie WG

13, 17, 32, 33

Maeng SH

61

Magera MJ

34

Maggioni L

88, 89

Maher E

75

Mahmood A

65

Malick ML

65

Malinowska MH

67

Mallozi MC

16

Mãnsson JE

93

Marcó S

88

Marin TA

92

Marinho J

38

Mariz FP

60

Markmann S

36

Marques Jr W

94

Marques JS

52

Marques-Lourenco C

44

Martin KS

59

Martinelli BZ

4, 38, 74, 89

Martinez D

70

Martínez P

91

Martins AM

1, 14, 16, 21, 27, 35, 62, 69, 74

Martins C

2, 3, 48

Mascelli MA

67

Mason RW

13, 17, 32, 33, 34, 62

Matern D

34

Matte U

4, 7, 15, 38, 57, 74, 84, 86, 89

Matte US

47

Maurer RL

15

Mayer FQ

4, 74

McBride K

82, 83

McCarty D

82, 83

McGill JJ

68

McNeil S

75

McNelly B

79

Meadows A

82, 83

Mealiffe M

39

Medeiros NS

38

Medeiros PFV

8, 28

Meijer OLM

84

Melegh B

79

Melia C

88

Mello AS

38

Melo HA

8

Mendelsohn NJ

31, 66

Mendes CSC

16, 27, 69

Mendes VB

49

Mendoza-Ruavalcaba SC

30

Meng F

12

Mengel E

19, 20

Mengel KE

14

Mercer J

22, 55, 79

Merry C

85

Mezzalira J

58

Micheletti C

62

Mihoreanu L

50, 80

Miller N

39, 42

Miller W

29, 77

Miquel JF

91

Mishra P

43

Mitchell J

14

Molas M

88

Moncayo MA

18

Montaño AM

17, 32, 33, 62

Monteiro KM

4

Monteiro VCL

74

Montoya JC

44, 47

Mooney S

39, 42

Moraes VC

58

Moreira AA

28

Moreira GA

16

Moreno J

76

Moreno LJ

44, 47, 49

Morin I

6, 58, 63, 64

Moro E

2

Morrone A

39, 42

Moskot M

82, 85

Mosquera A

76

Motas S

88, 89

Mozolewski P

85

Muenzer J

31, 59, 63, 67

Muñoz S

89

Munoz T

28

Murrey D

82, 83

Nagieva KF

14

Nair N

20

Namazova-Baranova L

9

Napier-Ionascu N

20

Napy GC

8

Nascimento C

1

Naughton B

82, 83

Nepomuceno FG

28

Nestrasil I

9, 10, 71,75

Ngu LH

61

Nielsen KG

93

Nielsen LH

93

Novikov PV

56

Nyul Z

79

O'Leary C

88

O’Maera A

79

Ochoa E

8

Oglesbee D

34

Oguma T

34

Ohmi K

3

Oikawa H

62

Oivind N

93

Okuyama T

56

Olaye A

51

Oldham HM

13

Oliveira ACB

27

Oliveira F

3

Oliveira IP

59

Oliveira J

75

Oliveira JL

75

Oliveira ML

73

Oliveira MLC

60

Oliveira RB

74

Oliver D

50

Oller-Ramirez AM

70

Olsen KJ

93

Olsen SO

93

Orchard P

29, 66, 77

Orii KE

18, 32, 62

Orii T

13, 17, 18, 32, 33, 34, 62, 78

Oron TR

39

Ortega AL

28

Os MMD

79

Oussoren E

18

Pachajoa H

39

Pacheco N

32

Pajares S

42

Pal AR

22

Pan L

31, 67

Paneque AL

12

Pano A

31, 66

Paredes-Garmero EJ

1

Parini R

14, 59

Parker H

88

Paschke E

44, 87

Pasquali M

36

Pasqualim G

57, 74

Patel P

13, 17, 18, 33, 62

Patti CL

16

Paul K

44

PearlT

93

Peralta LA

77

Pereira DMB

24, 76

Pereira POB

52

Pereira TV

71

Pereira VG

3, 35

Perry V

67

Peszynska-Sularz G

67

Peszynska-Sularz J

67

Philippo S

55

Pickford C

85

Pijnappel PWWM

43

Pimentel N

76

Piña-Aguilar RE

40

Pincus P

68

Piscia-Nichols C

53

Pizzi S

77

Platenik EM

55, 59

Plug I

18, 43

Pohl S

45

Polgreen L

29

Polkhoo K

12

Pollard L

42

Poloni JF

38

Pordeus IA

27

Poswar F

72

Poupetová H

35

Prado E

60

Prieto JC

43

Prospero RG

19

Provenzale JM

71

Pshezhetsky AV

2, 3, 48, 88

Pulido NF

25, 26

Pulles TAW

6

Purificação A

7

Pyragius T

46

Quartel A

53

Queiroz MT

3, 35

Radwan A

31

Rafaelli CL

7

Raiman J

28

Ramaswami U

90

Ramos RTT

75

Rand MH

16, 27, 69

Rand MM

62

Raymond KM

34

Reha A

87

Reis MA

52

Ribas G

35

Ribeiro EM

69

Ribeiro EM

23

Ribeiro EM

7, 23, 69

Ribeiro I

42

Ribeiro MG

7, 51, 60

Ribera A

88, 89

Richards S

56, 65

Riello AP

17

Rigon L

89

Rijn RRV

79

Rinaldo P

34

Roberts JC

55, 80

Robledo HH

11

Roca C

88, 89

Rocha D

52

Rocha KC

1

Rocha V

52

Rodriguez EA

40

Rodríguez-López A

76

Roizen M

77

Roldan D

93

Rolfs A

38

Roush P

59

Roychowdhury M

43

Rozdzynska-Swiatkowska A

26

Ruberte J

88, 89

Rudser K

10

Ruijter GJ

18, 43

Ruíz-Botero F

39

Ruozi B

89

Ryles A

39

Saftig P

93

Saif MA

22

Sakai N

56

Sakkers R

79

Salazar DA

40

Salazar LV

19

Šalingová A

63

Salvalaio M

2, 89

Sánchez A

44, 47, 49

Sánchez OF

76

Sánchez V

89

Santana JS

25

Santillán-Hernández Y

40

Santos H

52

Santos JL

91

Santos SL

8

Santra S

42, 64, 67, 80, 81

Sapra S

43

Satizabal JM

44, 47, 49

Sawada T

56

Scalco F

73

Scalco FB

60

Scarpa M

63, 64, 89

Schneider AP

74

Schuchman E

91, 94

Schuchman EH

12

Schwartz IV

69

Schwartz IVD

41, 45, 47, 48, 49, 51, 52, 71, 86, 90, 92

Schwarz E

36

Sciarappa K

66, 67

Seches TAVA

62

Semotok J

28

Seo J

56

Sepúlveda N

8

Sergijenko A

85

Shaffer TH

13

Shapiro E

9, 10, 20, 75

Shapiro EG

71

Shastri SS

43

Shaywitz A

59

Shibata Y

34

Shimada T

13, 17, 18, 32, 33, 34, 62

Shinpo M

56

Signorovitch J

70

Sihn YB

6

Silva BBR

11, 80

Silva CAB

69

Silva DS

17, 24, 25

Silva JAO

74

Silva L

76

Silva LCS

7, 23

Silva TO

28

Silva VT

69

Silva-Jose TD

30

Simmons LM

81

Simonaro C

94

Simonaro CM

12

Siqueira T

73

Skrinar A

70

Slasor P

14

Smolinska E

82

Snella E

71

Soares DCQ

78

Sohn YB

13, 41, 54, 61

Solanki G

42, 80

Solanki GA

67

Solano M

19, 21, 58

Sole D

62

Solé D

16

Sólyom A

12, 19, 79, 94

Soto C

76

Souza C

74

Souza CFM

15

Souza CM

73

Souza ICN

23, 52

Sperb-Ludwig F

45, 47, 48, 49, 86, 92

Spiegel RJ

87

Sreekentam S

64

Staciuk R

77

Stehel E

75

Stein MB

67

Steiner C

7

Stensland HM

93

Stevanin G

94

Stewart CA

64

Stewart FJ

26

Stréhn A

79

Stuetz A

87

Sukhanova N

9

Suzuki Y

17, 18, 32, 33, 34, 56, 62, 78

Svobodová E

3

Tabuchi K

56

Tanaka A

56, 62

Tanaka K

63

Tanyalcin MT

30

Tapiero SM

21

Tavares AMV

57

Teixeira HF

84

Tesarová M

3

Testa GA

89

Thacker MM

17

Thelen M

36

Theroux M

17

Thomas B

36

Thompson L

79

Thuesen AM

93

Tilky-Szymanska A

26

Tiozzo V

16, 62

Tomanin R

2, 89

Tomatsu S

13, 17, 18, 32, 33, 34, 62, 78

Toralles MB

7

Torres DA

23

Torres LC

78

Tortorelli S

34

Tosi G

89

Tufik S

16

Tumurkhuu M

12

Tylee KL

22, 42

Tylki-Szymanska A

63, 64, 93

Uribe A

32, 49

Vaca JJ

18

Vairo F

73, 74

Valadares E

7

Valadares ER

27

Valayannopoulos V

14

van den Hout HJMP

18

van der Ploeg AT

18, 43

van Meel E

48

van Vlies N

84

Vandelli MA

89

Vanderver A

31

Vanz AP

52

Vanzella C

24, 73

Vargas C

35

Vashakmadze N

9

Velasco H

49

Velasco HM

21

Velásquez O

76

Velho RV

45, 47, 48, 86

Vellodi A

14, 66

Vera-Loaiza A

40

Verma G

43

Viana GM

1

Vieira DKR

55

Vieira SMV

15

Vieira T

73

Vieira TA

27

Vijay S

42, 64, 80

Vijayaraghavan S

67

Villacampa P

88, 89

Vincelette J

36

Vite C

71

Vollebregt A

43

Wang D

87

Wang H

59

Wang N

31, 67

Wang R

42

Ware T

83

Warwick AL

57

Wassmer E

81

Webster K

36

Weetall M

87

Wegrzyn G

67, 82, 85

Welch EM

87

Whight C

68

White KK

79

Whitley C

9, 10, 20

Wibrand F

93

Wijberg FA

22

Wijburg F

14

Wijburg FA

79

Wijburn F

84

Wilke M

52

Wilkie E

16

Wilkinson F

85, 88

Wilkinson FL

3

Windischhofer W

87

Windischofer W

44

Wink MR

4

Wohlenberg M

38

Wraith J

53

Wrodnigg TM

87

Wyffels M

66

Wynn R

85

Wynn RF

22

Xu Y

65

Xue Y

56

Yabe H

56, 62

Yamaguchi S

32, 33, 34

Yamamoto JUS

35

Yang K

14

Yasuda E

13, 17, 18, 32, 33

Yee J

71

Yoo HW

61

Yund B

10

Zancan I

2

Zangulo S

91

Zanlungo S

91, 92

Zaraspe K

83

Zawadzki KA

39

Zuchner S

94