FKBP38 Alleviates Osteoarthritis Progression by Inhibiting Chondrocyte Senescence

Abstract

Objective

Osteoarthritis (OA) is a prevalent age-related degenerative joint disease characterized by cartilage degeneration, joint pain, and reduced mobility, with aging as the primary risk factor. This study aimed to investigate the role and mechanism of FK506 binding protein 38 (FKBP38) in chondrocyte senescence and OA progression.

Methods

FKBP38 expression was detected in articular cartilage from natural aging and OA mouse models. Mice with FKBP38 conditional knockout (FKBP38-cKO) and inducible conditional knockout (FKBP38-iKO) were generated for these models. An adeno-associated virus (AAV) vector overexpressing FKBP38 was injected into wild-type mouse joints. Joint damage was assessed at 8 and 18 months for natural aging or 4 and 8 weeks after DMM surgery by histology.

Results

FKBP38 expression was downregulated in cartilage from both natural aging and OA mice. FKBP38 overexpression protected against H2O2-induced senescence in chondrocytes. Addition of rapamycin to inhibit mTORC1 signaling rescued the enhanced senescence and catabolism caused by FKBP38 knockdown in chondrocytes. Conditional deletion of FKBP38 in chondrocytes significantly accelerated senescence and aggravated both natural aging and OA progression by activating mTORC1 signaling, whereas overexpression of FKBP38 delayed these processes.

Conclusion

These results indicate that FKBP38 protects against chondrocyte senescence and cartilage degradation to alleviate OA progression by inhibiting mTORC1 signaling.

Introduction

Osteoarthritis (OA) is the most common form of arthritis, affecting millions worldwide, particularly among the elderly population.^1,2 This degenerative joint disease is characterized by cartilage degradation, subchondral bone remodeling, and synovial inflammation, ³ leading to significant joint pain, stiffness, and reduced mobility. ⁴ OA can arise due to a variety of factors, such as obesity, physical activity, genetic predispositions, past injuries, workplace conditions, and abnormalities in joint anatomy. According to global health reports, more than 527 million individuals are affected by OA. As the population ages, a rise in the prevalence of OA is anticipated. ⁵ Despite its high prevalence and substantial impact on quality of life, the molecular mechanisms underlying OA are not yet fully understood, ⁶ and current treatment strategies primarily focus on symptom relief rather than altering disease progression. ⁷ Therefore, studying the molecular mechanisms of OA and seeking effective targets for altering disease progression have potential clinical relevance.

Cellular senescence is increasingly acknowledged as a critical factor in the pathogenesis of arthritis, particularly OA. ⁸ Senescent cells accumulate in joint tissues, secreting pro-inflammatory cytokines, proteases, and growth factors that contribute to the degradation of articular cartilage and chronic inflammation. ⁹ Knee osteoarthritis (KOA) refers to a specific form of OA. There is currently no recognized definition for early-stage KOA, nor are there validated classification criteria for identifying candidates for inclusion in clinical trials. ¹⁰ The senescence-associated secretory phenotype (SASP) accelerates articular cartilage degradation, leading to reduced cushioning and mechanical function, which further contributes to the progression of KOA. Thus, early diagnosis is particularly important. However, KOA pain is a subjective and personal experience, making it challenging to understand patients’ experiences and assess their pain. Additionally, traditional diagnostic methods (such as radiological imaging and magnetic resonance imaging) are often uncertain for early-stage diagnosis.^11,12 Therefore, current research focuses on uncovering the molecular mechanisms underlying chondrocyte senescence and identifying therapeutic targets to mitigate or reverse senescence-induced tissue degeneration.^13,14

FK506-binding protein 38 (FKBP38), a member of the FK506 binding protein (FKBP) family, has been identified in various studies as a regulator of apoptosis and autophagy.^15,16 FKBP38 is believed to regulate cellular health by interacting with key signaling pathways, including the mechanistic target of rapamycin (mTOR) signaling pathway, which plays a critical role in cellular growth, senescence, and survival.^{17 -19} Recent studies have shown that FKBP38 modulates mitochondrial membrane permeability by interacting with Bcl-2 family proteins, thereby influencing cell survival and apoptosis. ²⁰ Moreover, FKBP38 has been implicated in various pathological conditions, including cancer and neurodegenerative diseases. ²¹ However, the specific link between FKBP38 and chondrocyte senescence or OA remains largely unexplored.

In this study, we first aimed to delineate the role of FKBP38 in cartilage aging and OA. In addition, we sought to elucidate the molecular mechanisms underlying the specific actions of FKBP38 in OA. Finally, we performed gain- and loss-of-function interventions targeting FKBP38 in primary chondrocytes and multiple animal models to assess its potential as a novel therapeutic target for OA.

Methods

Animals

We used the ARRIVE1 reporting guidelines. ²² Animal protocols were conducted in strict accordance with ethical guidelines and were approved by the Institutional Animal Care and Use Committee of Southern Medical University. Twelve-week-old male C57BL/6J mice, sourced from the Laboratory Animal Center of Southern Medical University, were used to establish control and experimental groups to examine the role of FKBP38 in OA. Col2a1-Cre; Fkbp38^flox/flox mice were designated as Fkbp38-cKO, while Col2a1-CreERT2; Fkbp38^flox/flox mice were labeled Fkbp38-iKO, with Fkbp38^flox/flox littermates serving as controls. All of these mice were on a C57BL/6J background. The Fkbp38-cKO mice and their littermate controls serves as natural aging mice models, while the Fkbp38-iKO mice and their littermate controls serves as experimental OA mice models (n = 5 mice in each group). Mice were housed under specific pathogen-free (SPF) conditions, including controlled temperature, humidity, and a 12-hour light/dark cycle, with no more than 5 mice per cage. Fkbp38 gene recombination in Fkbp38-iKO mice was induced by administration of tamoxifen dissolved in corn oil, followed by surgical destabilization of the medial meniscus (DMM) to induce OA. ²³ Mice were humanely killed under carbon dioxide to minimize distress and pain in the animals.

Experimental Model of OA

An experimental model of OA was established in 12-week-old male C57BL/6J mice, Fkbp38-iKO mice, and their littermate controls to assess the effects of FKBP38 on disease progression. Osteoarthritis was induced by destabilization of the medial meniscus (DMM) surgery in the right knee under sterile conditions. A small incision was made over the medial joint capsule to expose and sever the meniscotibial ligament, followed by suturing of the joint capsule, leading to destabilization of the medial meniscus. Sham-operated animals underwent the same procedure without ligament transection and served as a control group to evaluate the impact of surgery alone on joint morphology. Postoperatively, all mice were housed in padded cages to minimize stress and allowed free movement to facilitate recovery. The mice were sacrificed at 4 and 8 weeks post-surgery. At specified time points, mice were humanely killed under carbon dioxide and knee joint specimens were collected.

Intra-Articular Administration of Adeno-Associated Virus (AAV) Vectors

The therapeutic effects of FKBP38 modulation in OA models were examined by intra-articular injection of an AAV vector overexpressing FKBP38, which allowed targeted delivery to the affected joint and minimized systemic side effects. AAV vectors encoding Fkbp38 or control sequences were obtained from Hanheng Biotechnology (Shanghai, China). After anesthetizing the mice and disinfecting the knee area, 10 µL AAV solution was injected into the right knee joint cavity using an insulin syringe, ensuring accurate delivery without damaging the joint structures. AAV injections were administered when the mice were 8 weeks old, with joint specimens collected 4 or 8 weeks later, or injected at 12 weeks of age, with samples collected at 8 or 18 months.

Histological Analysis

Mice knee joints were fixed in 4% paraformaldehyde for 24 hours, then decalcified in 10% EDTA (pH 7.4) for 21 days. Tissues were embedded in paraffin and sectioned at 3 µm, with consecutive slices taken at 50-µm intervals from the medial and lateral compartments. Midsagittal sections (n = 7−8) were selected, dewaxed in xylene, and hydrated using graded ethanol. Safranin-O staining was used to visualize cartilage, while Fast Green staining was used to assess tissue structure. This dual-staining method enabled cartilage degradation and glycosaminoglycan content in the matrix to be evaluated. Imaging was performed using an Olympus BX43 microscope with the CellSens (v4.1) software. Sections were examined at various magnifications to assess pathological changes such as cartilage loss and irregularities. OA severity was quantified using the OARSI grading system, with 3 blinded observers independently scoring the sections for accuracy.

Isolation of Primary Chondrocytes and Culture

Ribs and articular cartilage were isolated from 6 C57BL/6J mice and digested with trypsin (30 min). Primary chondrocytes were isolated, purified and digested for a further 6 hours at 37°C with 0.1% type II collagenase (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin sulfate. Purified chondrocytes were resuspended and cultured as a monolayer in DMEM/F12 medium containing 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin sulfate at 37°C with 5% CO₂, yielding three 10-cm dishes (approximately 78.5 cm² per dish) of P1 primary chondrocytes. Upon reaching confluence (approximately 2 × 10⁶ cells per dish), the P1 primary chondrocytes were passaged and evenly seeded into six 6-well plates (approximately 9.6 cm² per well) to generate P2 primary chondrocytes, which were then cultured until they reached 85–95% confluence (approximately 2.5 × 10⁵ cells per well). Primary chondrocytes were then transfected with a Control plasmid or an Fkbp38-Mus plasmid (500ng/µl, Suzhou GenePharma Co., Ltd, Jiangsu, China) using Lipofectamine 3000 (Invitrogen) and infected with Fkbp38-NC or Fkbp38-KD (1.5 × 10¹²vg, created and packaged by Hanbio Biotechnology, Shanghai, China) to regulate the expression of FKBP38. They were treated with either vehicle or H₂O₂ (200 µM), or with vehicle or rapamycin (20 nM) for the indicated time periods to assess the potential of FKBP38 as a novel therapeutic target for osteoarthritis.

Immunofluorescence (IF) Staining

Paraffin-embedded slices (3 µm thick) were mounted on glass slides for staining. Antigen retrieval was performed overnight at 60°C in citrate buffer (10 mM, pH 6.0) to enhance epitope exposure and antibody binding. Slides were blocked with 1% sheep serum at 37°C for 1 hour to prevent nonspecific interactions, followed by overnight incubation with primary antibodies (in 1% BSA, 0.2% Triton X-100) at 4°C. Sections were then incubated with Alexa Fluor 488-or Alexa Fluor 594-conjugated secondary antibodies for 1 hour in the dark at room temperature. Nuclei were stained with 4, 6-diamidino-2-phenylindole (DAPI) and images were acquired using a FluoView FV1000 confocal microscope (Olympus, city, country) with FV10-ASW Viewer (v4.2). Image analysis was conducted using Image-Pro Plus (v6.0) (Batch Process macro) and ImageJ (v1.8) (macro) software to quantify the staining intensity and distribution. Observers blinded to the experimental conditions standardized the staining and imaging. Positively stained cells were counted in 2 fields of view from each slice, across 3 consecutive slices of articular cartilage per mouse. Quantitative IF data for FKBP38, p16 ^INK4A , MMP13, and pS6 were statistically analyzed to compare expression across groups.

Quantitative Real-Time PCR (RT-PCR) Analysis

RNA was extracted from samples (primary chondrocytes treated as control, H₂O₂, OE-FKBP38+H₂O₂, si-FKBP38, or si-FKBP38+Rapamycin; n = 3 per group) using TRIzol (Invitrogen, city, country). The RNA concentration was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, city, country). Reverse transcription was carried out using reverse transcriptase (Takara Bio, Shiga, Japan), and RT-PCR was performed using SYBR Green reagent (Yeasen Biotechnology, Shanghai, China) and specific primers. Quantitative PCR was conducted using LightCycler® 96 (Roche, city, country) with LightCycler® 96 (v1.1) software. The thermal cycling conditions were 95°C for 2 minutes, followed by 40 cycles at 94°C for 15 seconds, 60°C for 15 seconds, and 72°C for 20 seconds. Gene expression was normalized to that of GAPDH and quantified using the 2^-ΔΔCq method. R. Data analysis was conducted using Microsoft Excel, and data visualization was performed using GraphPad Prism software. The primer sequences used for qRT-PCR are listed in Table 1 .

Table 1.

The Primer Sequences Used for qRT-PCR.

Name	Organism		Primers (5′-3′)
FKBP38	Mouse	Forward	GACAGCCTACAGTGGAGGAG
		Reverse	AGCAATCCGTTCCCCAGAATG
P16	Mouse	Forward	CGCAGGTTCTTGGTCACTGT
		Reverse	TGTTCACGAAAGCCAGAGCG
P21	Mouse	Forward	CCTGGTGATGTCCGACCTG
		Reverse	CCATGAGCGCATCGCAATC
P53	Mouse	Forward	CTCTCCCCCGCAAAAGAAAAA
		Reverse	CGGAACATCTCGAAGCGTTTA
MMP13	Mouse	Forward	CTTCTTCTTGTTGAGCTGGACTC
		Reverse	CTGTGGAGGTCACTGTAGACT
Col2a	Mouse	Forward	GGGAATGTCCTCTGCGATGAC
		Reverse	GAAGGGGATCTCGGGGTTG

Immunoblotting

Cells were lysed on ice using 2 × SDS buffer (62.5 mM Tris-HCl [pH 6.8], 10% glycerol, 2% SDS, 50 mM dithiothreitol, 0.01% bromophenol blue), followed by heating at 96°C for 10 min. The lysate was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA, USA) via wet transfer. Membranes were blocked with 5% non-fat milk in TBS-T (100 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% Tween 20) at 37°C for 1 hour. After blocking, membranes were incubated at 4°C with primary antibodies on a shaker overnight. The next day, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 1 hour at 37°C. Protein bands (FKBP38, p16 ^INK4A , p53, MMP13, GAPDH, pS6, S6, Col2a1, mTOR, p-mTOR, AKT, p-AKT) were detected using enhanced chemiluminescence reagents (Santa Cruz Biotechnology), and imaged using Tanon Imaging (v1.0) and GeneSys (v1.8.5) software.

Statistics and Reproducibility

Data were initially assessed for normality using Kolmogorov-Smirnov and Shapiro-Wilk tests to determine the appropriate statistical analysis. For data following a normal distribution, parametric tests, such as Student’s t test (for 2 groups) or one-way analysis of variance (ANOVA) (for multiple groups), were applied. Post-ANOVA, Tukey’s test, and Dunnett’s multiple comparison tests were conducted to identify group-specific differences. If the data did not meet the normality assumption, non-parametric tests, such as the Mann-Whitney U test (for 2 groups) or the Kruskal-Wallis test (for multiple groups), were used. Statistical analysis was performed using SPSS software with 2-tailed tests, and P-values below 0.05 were considered significant. Quantitative variables were expressed as mean ± standard deviation (SD). Data were presented as graphs generated by GraphPad Prism software. At least 3 independent biological replicates were used for all experiments, including the histological and IF analyses. Western blot images are representative of the number of replicated experiments noted in the figure legends. In this study, “n” involves the number of independent biological replicates in each group. The sample allocation was randomized in all cases. For in vitro studies, cells were randomly assigned to different groups, while in vivo studies involved the random assignment of wild-type and transgenic mice. Surgeons performing the DMM and control procedures were blinded to the genotype of the mice. Similarly, those conducting surgeries and joint cavity injections were unaware of the mouse genotypes and experimental groups. Sample IDs were used to maintain blinding during data collection. For histological analysis, blinding was performed for the genotype, treatment, and surgery. All experiments were performed by researchers who were not involved in the experimental design.

Results

FKBP38 Expression in Chondrocytes is Decreased in Aged and Experimental OA Mice Model

First, we examined changes in FKBP38 expression levels in a naturally aging mouse model to determine FKBP38 expression patterns in naturally aging chondrocytes. Safranin-O/Fast Green staining and OARSI scores revealed that in articular cartilage from mice aged 3, 12 and 18 months, cartilage tissue damage gradually increased with advancing age (n = 5, P = 0.0008 or P < 0.0001) ( Fig. 1A , B ). IF staining further confirmed the number of p16 ^INK4A positive chondrocytes, which represent senescent chondrocytes, also gradually increased in articular cartilage along with aging (n = 5, P = 0.0006 or P < 0.0001). Moreover, we noticed that there was a progressive decline in FKBP38 expression during cartilage aging (n = 5, P < 0.0001) ( Fig. 1C, D ). Next, we established a destabilization of the medial meniscus (DMM) surgical-induced experimental OA model in C57BL6/J mice, the mice were sacrificed at 4 and 8 weeks post-surgery. Safranin-O/Fast Green staining and OARSI scoring analysis confirmed the gradually loss of proteoglycan in articular cartilage at 4 and 8 weeks post-surgery (n = 5, P = 0.0021 or P < 0.0001) ( Fig. 1E, F ). IF staining revealed enhanced expression of p16^INK4A (n = 5, P = 0.0005 or P < 0.0001) and decreased expression of FKBP38 along with advanced cartilage damage in OA mice at 4 and 8 weeks post-surgery (n = 5, P < 0.0001) (Fig. 1G, H). Together, our findings in naturally aging and experimental OA mice models suggest that FKBP38 downregulation is closely related to chondrocytes senescence and OA progression.

Figure 1.

FKBP38 expression in chondrocytes is decreased in aged and experimental OA mice model. (A) Representative images showing Safranin-O staining and OARSI scores (B) in the articular cartilage of 3-, 12-, and 18-month-old mice (n = 5, bar = 50 μm). (C) Representative IF images showing FKBP38 and p16^INK4A staining and quantification (D) of FKBP38 and p16 ^INK4A in the articular cartilage of 3-, 12-, and 18-month-old mice. Nuclei are shown in blue (DAPI). n = 5, bar = 50 μm. (E) Representative images showing Safranin-O staining and OARSI scores (F) in the articular cartilage of mice from the following treatment groups: control, 4 and 8 weeks post-DMM surgery. n = 5, bar = 50 μm. (G) Representative IF staining showing FKBP38 and p16 ^INK4A staining and quantification (H) of FKBP38 and p16 ^INK4A in the articular cartilage of mice from the following treatment groups: control, 4 and 8 weeks post DMM surgery. Nuclei are shown in blue (DAPI). n = 5, bar = 50 μm. Data are shown as mean values ± SD.

FKBP38 Attenuates Chondrocytes Senescence via Inhibiting mTORC1 Signaling

To further elucidate the role of FKBP38 in chondrocytes, we next cultured primary mouse chondrocytes and induced senescence with H2O2 stimulation in vitro. The chondrocytes were divided into 3 groups, saline treatment control group, H2O2 stimulation group and FKBP38 overexpression via plasmid transfection plus H2O2 stimulation group. RT-qPCR analysis revealed that H2O2 stimulation resulted in decreased expression of FKBP38 (n = 5, P < 0.0001), increased senescence (p16 ^INK4A , p21, p53) (n = 5, P = 0.0328, P = 0.0452 and P = 0.0254) and catabolism (MMP13) (n = 5, P = 0.0299) markers while decreased chondrocyte anabolism (Col2a1) (n = 5, P = 0.0321), but that FKBP38 overexpression protected chondrocytes against H2O2-induced senescence (n = 5, P < 0.05) ( Figure 2A ). Western blot analysis confirmed overexpression of FKBP38 reduced p16 ^INK4A , p53 and MMP13 expression levels, but also decreased the phosphorylation of S6, mTOR and AKT, suggesting that the mTOR signaling was suppressed ( Fig. 2B , Suppl. Fig. S1A). Next, the cultured chondrocytes were induced senescence with H2O2 stimulation, treated with Fkbp38 knockdown lentivirus (Fkbp38-KD) with or without Rapamycin to inhibit mTORC1 signaling. With RT-qPCR and WB analysis, we noticed that FKBP38 knockdown led to increased expression levels of senescence, increased catabolism and decreased anabolism markers (n = 5, P < 0.05). Notably, addition of rapamycin to inhibit mTORC1 signaling rescued the effect of FKBP38 knockdown in chondrocytes ( Fig. 2C, D , Suppl. Fig. S1B ). These data suggest that FKBP38 plays a protective role in chondrocytes senescence via inhibiting mTORC1 signaling.

Figure 2.

FKBP38 attenuates chondrocytes senescence via inhibiting mTORC1 signaling. (A) Relative Fkbp38, p16 ^INK4A , p21, p53, Mmp13 and Col2a1 mRNA expression levels in group of control, H2O2 and OE- Fkbp38+H2O2 primary chondrocytes. (B) Representative western blot showing FKBP38, p16 ^INK4A , p53, MMP13, pS6 and S6 protein expression levels in group of control, H2O2 and OE- Fkbp38+H2O2 primary chondrocytes. n = 3. The n indicates the number of biologically independent samples per group. (C) Relative Fkbp38, p16 ^INK4A , p21, p53, Mmp13 and Col2a1 mRNA expression levels in group of control, Si- Fkbp38 and Si- Fkbp38+Rapamycin primary chondrocytes. (D) Representative western blot showing FKBP38, p16 ^INK4A , p53, MMP13, Col2a1, pS6 and S6 protein expression levels in group of control, Si- Fkbp38 and Si- Fkbp38+Rapamycin primary chondrocytes. n = 3. The n indicates the number of biologically independent samples per group. Data are shown as mean values ± SD.

Specific Deletion of FKBP38 in Chondrocytes Promotes Senescence and Aggravates Age-Related OA Progression

To examined the effects of FKBP38 knockout on chondrocyte senescence in vivo, we next generated chondrocytes specific FKBP38 knockout (Fkbp38-cKO) mice using Col2a1-Cre and Fkbp38^flox/flox mice. We observed that mice with Fkbp38-cKO did not show any potential defects in skeletal development compared to the control group (Suppl. Fig. S2). Next, the articular cartilage from control and Fkbp38-cKO were analyzed at 8- and 18-month age to determine the effects of FKBP38 deficiency on chondrocytes senescence and natural aging OA. Safranin-O/Fast Green staining of the murine cartilage samples revealed a significant increase in severe erosion and structural disintegration in naturally aging Fkbp38-cKO mice than controls (n = 5, P = 0.0147 or P = 0.0019). These findings were consistent with the corresponding OARSI scores and suggested that loss of FKBP38 exacerbated degenerative changes associated with natural aging processes in the cartilage (Fig. 3A, B). IF staining confirmed that FKBP38 was successfully deleted in chondrocytes (n = 5, P = 0.0002 or P < 0.0001). We also noticed increased expression of p16 ^INK4A (n = 5, P = 0.0007 or P < 0.0001), and MMP13 (n = 5, P = 0.0026 or P = 0.0085) in the cartilage tissue from Fkbp38-cKO mice at 8- and 18- month age. In addition, the mTOR downstream target pS6 was significantly upregulated in the Fkbp38-cKO group compared to controls (n = 5, P < 0.0001 or P = 0.0420), indicating that the loss of FKBP38 further promoted activation of the mTOR signaling pathway during cartilage aging ( Fig. 3C, F ). Together, our findings demonstrate that loss of FKBP38 accelerates chondrocytes senescence and aggravates age-related OA progression via activating mTORC1 signaling.

Figure 3.

Specific deletion of FKBP38 in chondrocytes promotes senescence and aggravates age-related OA progression. (A) Representative images showing Safranin-O staining and OARSI scores (B) in sagittal sections of joints from control and Fkbp38-cKO mice at 8 and 18 months. The n = 5 involves independent biological replicates per group; bar = 50 μm. (C, E) Representative images and quantification (D, F) of IF staining of FKBP38 and p16 ^INK4A (C), MMP13 and pS6 (E) in sagittal sections of joints from control and Fkbp38-cKO mice at 8 and 18 months. n = 5 independent biological replicates per group; bar = 50 μm. Data are shown as mean values ± SD.

Conditional Deletion of FKBP38 Accelerates OA Progression in DMM-Induced Mice Model

To evaluate the effect of FKBP38 knockout on experimental OA progression, we generated Col2a1-CreER^T2: Fkbp38fl/fl (Fkbp38-iKO) inducible conditional knockout mice. Fkbp38-iKO mice (Fkbp38-iKO) and their littermates as controls for the establishment of an experimental OA model by DMM after tamoxifen injection. Consistent with our findings in naturally aging mice, we observed increased erosion and structural damage in Fkbp38-iKO mice compared to controls at 4 and 8 weeks post-DMM surgery. OARSI scores were increased in Fkbp38-iKO mice compared to controls, suggesting that OA progression is significantly accelerated in the cartilage of Fkbp38-iKO mice (n = 5, P = 0.0053 or P = 0.0097) ( Fig. 4A, B ). IF analysis revealed increased levels of p16^INK4A, MMP13, and pS6 in the cartilage of Fkbp38-iKO mice (n = 5, P < 0.05) ( Fig. 4C, F ). Thus, our findings suggest that FKBP38 deficiency significantly promotes chondrocytes senescence and accelerates experimental OA progression via activating mTORC1 signaling.

Figure 4.

Conditional deletion of FKBP38 accelerates OA progression in DMM-induced mice model. (A) Representative images showing Safranin-O staining and OARSI scores (B) in sagittal sections of joints from control and Fkbp38-iKO mice at 4 and 8 weeks post-surgery. n = 5 independent biological replicates per group; bar = 50 μm. (C, E) Representative images and quantification (D, F) of IF staining of FKBP38 and p16 ^INK4A (C), MMP13 and pS6 (E) in sagittal sections of joints from control and Fkbp38-iKO mice at 4 and 8 weeks post-surgery. The n = 5 involves independent biological replicates per group, bar = 50 μm. Data are shown as mean values ± SD.

Overexpression of FKBP38 Alleviates Chondrocytes Senescence and Age-Related OA Progression

After demonstrating that FKBP38 deficiency promotes chondrocytes senescence and cartilage degeneration in vivo, we then wondered if an overexpression of FKBP38 might reduce cartilage degeneration. AAV encoding FKBP38 overexpression plasmid was intra-articularly injected into wild-type mice (Fkbp38-OE) and assessed the role of FKBP38 overexpression in a naturally aging model by performing histological analysis on the joint tissues at 8- and 18-month age. We found that while no significant difference in cartilage integrity was observed in 8-month-old Fkbp38-OE mice, at 18 months the cartilage integrity in FKBP38-OE mice had improved compare with control mice ( Fig. 5A ). Furthermore, the OARSI score was significantly lower in Fkbp38-OE mice than control mice at 18 months (n = 5, P = 0.5555 or P = 0.0082) ( Fig. 5B ). IF staining revealed a significantly increased FKBP38 expression in the articular cartilage of FKBP38-OE mice compared to control (n = 5, P < 0.0001), while p16^INK4A, MMP13, and pS6 expression levels were reduced (n = 5, P < 0.0001, P = 0.0004 and P = 0.0035), suggesting that overexpression of FKBP38 alleviated chondrocytes senescence and cartilage destruction during the natural aging process ( Fig. 5C, F ). Together, these results indicate that overexpression of FKBP38 protected against chondrocytes senescence and cartilage degradation via inhibiting mTORC1 signaling in an age-related OA model.

Figure 5.

Overexpression of FKBP38 alleviates chondrocytes senescence and age-related OA progression. (A) Representative images showing Safranin-O staining and OARSI scores (B) in sagittal sections of joints from control and Fkbp38-OE mice at 8 and 18 months. The n = 5 involves independent biological replicates per group; bar = 50 μm. (C, E) Representative images and quantification (D, F) of IF staining of FKBP38 and p16 ^INK4A (C), MMP13 and pS6 (E) in sagittal sections of joints from control and Fkbp38-OE mice at 8 and 18 months. The n = 5 involves independent biological replicates per group; bar = 50 μm. Data are shown as mean values ± SD.

Overexpression of FKBP38 Mitigates OA Progression in DMM-Induced Mice Model

We next analyzed the effects of FKBP38 overexpression on post-traumatic OA. Safranin-O/Fast Green staining revealed improved cartilage integrity in the Fkbp38-OE group ( Fig. 6A ). Similarly, the OARSI scores of Fkbp38-OE mice were significantly reduced following surgical induction of OA compared to control mice (n = 5, P = 0.0006 or P = 0.0207), indicating that overexpression of FKBP38 alleviates OA progression ( Fig. 6B ). IF staining confirmed that FKBP38 expression levels were increased 4 and 8 weeks after surgery (n = 5, P < 0.0001), while a decrease in p16^INK4A, MMP13 and pS6 expression levels was observed in FKBP38-OE mice (n = 5, P < 0.05) ( Fig. 6C, F ). These findings demonstrate that FKBP38 overexpression effectively alleviated chondrocytes senescence and cartilage catabolism, thus mitigates OA progression in DMM-induced mice model.

Figure 6.

Overexpression of FKBP38 mitigates OA progression in DMM-induced mice model. (A) Representative images showing Safranin-O staining and OARSI scores (B) in sagittal sections of joints from control and Fkbp38-OE mice at 4 and 8 weeks post-surgery. The n = 5 involves independent biological replicates per group; bar = 50 μm. (C, E) Representative images and quantification (D, F) of IF staining of FKBP38 and p16 ^INK4A (C), MMP13 and pS6 (E) in sagittal sections of joints from control and Fkbp38-OE mice at 4 and 8 weeks post-surgery. The n = 5 involves independent biological replicates per group, bar = 50 μm. Data are shown as mean values ± SD.

Discussion

In this study, we investigated the role of FKBP38 in chondrocyte senescence and the progression of OA. Osteoarthritis is a chronic disease closely associated with aging, and cellular senescence, particularly chondrocyte senescence, plays a significant role in driving its progression. ¹⁴ As chondrocytes undergo senescence, they accumulate cellular damage and secrete inflammatory mediators and proteases, which together degrade the cartilage matrix, ultimately leading to OA progression.^13,14,24 FKBP38 has been reported to regulate cell survival and apoptosis in various cell types, ²⁵ and has been implicated in the regulation of multiple signaling pathways and biological processes.^16,20,26 Although several markers of cellular senescence have been linked to FKBP38,^16,17,27 the role of FKBP38 in chondrocyte senescence and OA remains unclear.

Here, we sought to determine the potential of FKBP38 as a novel therapeutic target for OA by examining its role in regulating chondrocyte senescence and OA progression. Recent in-vitro human studies have reported that regulating chondrocyte senescence can decelerate or even reverse OA progression, providing the scientific basis for the current study.^28,29 We found that FKBP38 is involved in the regulation of chondrocyte senescence and OA. FKBP38 expression was significantly reduced in the articular cartilage of naturally aged mice compared to young mice. Similarly, progressive downregulation of FKBP38 expression levels correlated with advanced progression of OA in our mouse model of DMM-induced OA. In vitro, in cultured chondrocytes, FKBP38 expression levels were found to be significantly negatively correlated with the expression levels of markers of aging and the SASP. In the senescence model, conditional deletion of FKBP38 in vivo markedly accelerated chondrocyte senescence and cartilage degradation, whereas overexpression of FKBP38 effectively decelerated this process. Consistent with our findings in the senescence model, knockdown of FKBP38 in the OA model accelerated chondrocyte senescence, while overexpression of FKBP38 conferred protection against chondrocyte senescence and cartilage degradation. In both models, chondrocytes with elevated FKBP38 levels showed a significant reduction in markers of senescence and SASP, effectively alleviating cartilage degeneration. Our findings revealed a negative correlation between FKBP38 and chondrocyte senescence and cartilage degradation both in vivo and in vitro. Overexpression of FKBP38 effectively counteracted chondrocyte senescence and cartilage degradation in both the senescence and OA models.

The age-dependent decline in FKBP38 that we observe in murine cartilage parallels the well-documented decrease of several FK506-binding proteins (FKBPs) in other tissues, such as FKBP5 levels in the striatum and FKBP1b in hippocampus.^30,31 However, the functional consequence of FKBP38 loss in cartilage had remained unexplored until now. The negative correlation between FKBP38 and senescence or SASP markers is therefore not entirely unexpected: FKBP38 is an established negative regulator of mTORC1 and mitophagy, both of which are established drivers of the senescence program.^16,20

The interactions between cartilage catabolism, chondrocyte senescence, and OA progression play a critical role in OA pathogenesis, with abnormal catabolism serving as a crucial link between cartilage senescence and OA. ³² As aging and stress accumulate, chondrocytes enter a senescent state, releasing pro-inflammatory cytokines, proteases, and other molecules through the SASP, thereby accelerating cartilage damage and OA progression. ³³ MMP13, a marker of both SASP and cartilage catabolism,^8,34 was found to be closely associated with FKBP38 expression in our study. Specifically, the conditional deletion of FKBP38 leads to a significant upregulation of aging markers p16 ^INK4A and MMP13 in models of natural aging and osteoarthritis, which suggests enhanced SASP activity and aggravated cartilage catabolism associated with aging. This imbalance in cartilage degradation is a hallmark of cartilage aging, which accelerates the progression of osteoarthritis.^8,35 During OA, chondrocyte aging has been shown to promote the shift of cartilage toward catabolism, thereby accelerating cartilage degradation, ³⁶ which is consistent with the findings of our study. We further showed that overexpression of FKBP38 markedly suppressed p16 ^INK4A and MMP13 expression in both naturally aging and OA models, suggesting that FKBP38 exerted a protective effect by suppressing SASP activation and cartilage catabolism associated with aging.

Our findings indicated that FKBP38 could serve as a promising therapeutic target for OA, with strategies to upregulate FKBP38 or mimic its activity potentially alleviating OA symptoms. However, the precise molecular mechanisms by which FKBP38 regulates chondrocyte senescence and degeneration remain unclear. Previous studies have identified FKBP38 as a key regulator of the mTORC1 pathway,^37,38 which itself has a well-established role in regulating cellular aging, growth, survival, and metabolism.^{39 -43} Since earlier studies have suggested that inhibition of mTORC1 may counteract cellular aging in various cell types,^41,44,45 we examined the alterations in mTORC1 signaling pathways in natural aging and OA models under conditions of FKBP38 deletion or overexpression. We found a significant negative correlation between FKBP38 expression and mTORC1 activity both in vitro in primary chondrocytes and in vivo in naturally aging and OA mouse models. Conditional deletion of FKBP38 resulted in upregulated mTORC1 signaling in chondrocytes, whereas overexpression of FKBP38 markedly suppressed mTORC1 activity. Our findings suggest that FKBP38 regulates the mTORC1 signaling pathway during cartilage aging and OA progression. FKBP38 may promote chondrocyte senescence through regulation of the mTORC1 signaling pathway, thereby activating the SASP and disrupting the anabolic-catabolic balance in chondrocytes.

While mTOR inhibitors attenuate OA, their systemic toxicity limits translational application. We identify FKBP38 as an endogenous, cartilage-selective brake on mTORC1 and senescence, providing a molecular target whose manipulation might uncouple the anti-aging benefit from the pleiotropic side effects of rapalogs. ⁴⁶ However, the clinical application of FKBP38 as a target is still limited by its low bioavailability, difficult joint-specific delivery, and unknown long-term safety. In addition, we have not tested the retention time and immunogenicity in large animals, let alone compared them with existing standard treatments. These issues need to be addressed in the follow-up large animal OA model to establish a reliable safety window for the first human trial.

Conclusions

Here, we showed that FKBP38 levels were significantly decreased in cartilage tissue during the natural aging process and OA progression in 2 mouse models. FKBP38 expression levels showed a significant negative correlation with aging markers, SASP activity, and mTOR activity in vitro in primary chondrocytes. Conditional deletion of FKBP38 significantly worsened cartilage degradation and accelerated OA progression in both naturally aging and OA mouse models. Conversely, FKBP38 overexpression suppressed the upregulation of chondrocyte senescence and degradation markers in both OA and aging models, while inhibiting mTORC1 signaling activation. FKBP38 overexpression effectively mitigated chondrocyte senescence and degradation, reducing cartilage degradation and OA progression in both models. Our findings identified a protective role for FKBP38 against cartilage aging and degradation and suggested that FKBP38 may be a novel therapeutic target for OA in the future.

Supplemental Material

sj-docx-1-car-10.1177_19476035251377525 – Supplemental material for FKBP38 Alleviates Osteoarthritis Progression by Inhibiting Chondrocyte Senescence

Supplemental material, sj-docx-1-car-10.1177_19476035251377525 for FKBP38 Alleviates Osteoarthritis Progression by Inhibiting Chondrocyte Senescence by Junfeng Wu, Wenping Chen, Zilin Zou, Honghao Li, Tao Zhou, Zhengquan Liao, Zhi Rao, Kai Li, Xinyu Tan, He Cao and Hong Wang in CARTILAGE