Cellular Senescence in Human Chondrocytes in Relation to Osteoarthritis

Abstract

Introduction

Cellular senescence, i.e., a state of permanent cessation of cell division, is a hallmark of aging and has been associated with age-related diseases, most notably osteoarthritis (OA). Here we assessed senescence in chondrocytes, first in vitro after treatment with the mutagens N-ethyl-N-nitrosourea (ENU) or bleomycin, and then in vivo in cartilage samples from OA patients and control subjects.

Methods

Cellular senescence in cultured chondrocytes treated with mutagens was assessed by senescence-associated β-galactosidase (SA-β-gal) staining and by evaluating the expression levels of p16 and p21. Cellular senescence in human hip cartilage chondrocytes from OA patients or non-OA controls was similarly evaluated. Apoptosis in vitro was measured by the Bcl-2/Bax expression ratio, and in vivo by both TUNEL assay and the Bcl-2/Bax ratio.

Results

In human articular cartilage, senescent cells were found to be significantly elevated in OA lesions of patients as compared with normal cartilage of non-OA control subjects. In vitro, senescence was observed in bleomycin-treated chondrocytes, but not in ENU-treated cells.

Conclusions

Our findings demonstrate that cellular senescence is associated with the pathogenesis of OA, with DNA damage and mutations as potential contributing factors in OA-associated senescence.

Introduction

Osteoarthritis (OA) is an age-related, multifactorial degenerative disease of articular cartilage. Approximately 250 million people worldwide are suffering from OA. ¹ Aging is the most prominent risk factor for OA. Multiple aging-related factors—including inflammation, cellular senescence, mitochondrial dysfunction, and oxidative stress—can converge to drive cartilage degradation by promoting a proinflammatory and catabolic environment. This hostile milieu increases chondrocyte susceptibility to cell death, impairs the maintenance and repair of the extracellular matrix (ECM), and ultimately contributes to joint tissue destruction in OA. ²

Cellular senescence, one of the 12 key hallmarks of aging, ³ is characterized by prolonged and generally irreversible cell cycle arrest, changes in cell morphology, secretion of cytokines, and metabolic changes, ⁴ which play an important role in the pathogenesis of age-related chronic diseases.^5-8 Senescent cells accumulate with age in multiple tissues and are thought to exert adverse effects on normal physiology through the senescence-associated secretory phenotype (SASP), i.e., the secretion by senescent cells of high levels of inflammatory cytokines, immune modulators, growth factors, and proteases. ⁹ In addition, cellular senescence is often accompanied by increased lysosomal biogenesis, as evidenced by increased β-galactosidase activity. ¹⁰ Tumor suppressors such as p16 and p21, which are involved in cell cycle regulation and DNA damage repair, play crucial roles in the induction and maintenance of senescence. ¹¹

Chondrocytes are major contributors to the ECM, which produces and maintains the cartilage matrix. Overload and mechanical stress, inflammatory microenvironments, oxidative stress, metabolic and energy shortages, and autophagy are mechanisms leading to the accumulation of senescent chondrocytes.^2,12-20 Evidence has been reported for the age-associated accumulation of senescent osteocytes. ²¹ Previous studies have found that selective clearance of senescent chondrocytes can attenuate the development of OA and improve joint function. ²²

Here, we studied cellular senescence in human chondrocytes in relation to DNA damage and in cartilage lesions of OA patients. We first stimulated chondrocytes in vitro using two DNA damaging agents, N-ethyl-N-nitrosourea (ENU) and bleomycin. ENU is an alkylating agent that primarily induces point mutations by forming alkylated DNA adducts, while bleomycin causes DNA double-strand breaks, a more severe form of DNA damage. ²³ Comparing their effects offers a useful model to explore how specific types of DNA damage contribute to the induction of senescence in chondrocytes, and potentially to OA progression. Only bleomycin treatment was found to show a substantial and significant increase in cellular senescence. To translate these in vitro observations to a clinical context, we then examined the frequency of senescent cells in clinical articular cartilage samples, which we found significantly elevated in OA lesion cartilage as compared with cartilage from non-OA control subjects. These results are discussed in relation to genome instability as the possible cause of increased senescence in OA.

Methods

Human Subjects

Clinical human articular cartilage samples were obtained from the Department of Orthopedics, Shanghai Sixth People’s Hospital, Shanghai Jiao Tong University School of Medicine. Eight clinical samples of hip arthroplasty for OA or other reasons such as osteonecrosis of the femoral head were collected in this study. The collection of clinical samples for research and publication was conducted according to protocols approved by the Independent Ethics Committee of Shanghai Sixth People’s Hospital (approval number: 2021-122). A total of eight clinical samples were classified into OA and non-OA groups based on clinical diagnosis made by experienced clinicians, according to typical OA symptoms (e.g., joint pain and stiffness), physical examination findings, and radiographic evidence, following the diagnostic criteria recommended in Chinese clinical guidelines. Samples in the OA group were further divided into a lesion group and nonlesion group, according to the degree of cartilage damage. In total, we analyzed four non-OA control samples, four OA lesion samples, and two OA nonlesion samples.

Chondrocyte Isolation

The articular cartilage samples were cut into small pieces in precooled PBS (Beyotime). For digestion, the cartilage pieces were weighed and aliquoted, and 0.25% Trypsin-EDTA (GIBCO) was added for tissue dissociation at 37°C, 10% O₂ and 5% CO₂ for 30 minutes. Then, the cartilage pieces were washed by DMEM (GIBCO) supplemented with 2% Penicillin-Streptomycin (P/S) (GIBCO). For further cell dissociation, Collagenase II (Sigma-Aldrich) was added and the pieces were incubated at 37°C, 10% O₂ and 5% CO₂. After 4–6 hours of digestion, the digestion supernatant was collected and filtered through a cell strainer (Falcon). The cell suspension was centrifuged, after which the cell pellet was washed with DMEM supplemented with 2% P/S to get suspended chondrocytes.

Cell Culture and Treatment

The human primary chondrocyte cell line was purchased from iCell Biotech Co. The cells were cultured in DMEM supplemented with 10% FBS (GIBCO) and 1% P/S at 37°C, 10% O₂ and 5% CO₂. When the cells were attached to the cell culture plate (Corning), the culture medium was replaced with medium containing different doses of bleomycin (Selleck) or ENU (Sigma-Aldrich). Since ENU induces point mutations through alkylation that are typically fixed during DNA replication, active cell proliferation is generally required for its mutagenic effects to manifest, whereas bleomycin induces DNA strand breaks independent of cell cycle progression. ENU was dissolved in 100% ethanol (Sigma-Aldrich) at a concentration of 100 mg/ml to prepare a stock solution, while bleomycin was dissolved in ultrapure water (Beyotime) at a concentration of 1 mM. Both stock solutions were subsequently diluted with culture medium to obtain working solutions. For the bleomycin treatment groups, in order to capture both immediate and long-term outcomes, cells were harvested at two time points: 2 hours after bleomycin treatment and 7 days after incubation in DMEM following the removal of bleomycin. For ENU treatment, cells were collected after 48 hours of incubation. Three parallel replicates were performed for each treatment group. Control cells received the culture medium only.

Hematoxylin Eosin (HE) Staining

Upon separation of articular cartilage from bone, the cartilage tissue was immediately fixed with 4% paraformaldehyde (PFA) (Beyotime) for more than 24 hours. After fixation, the cartilage tissue was put into water and washed for 20 minutes. Embedding frames containing cartilage tissue were dehydrated step by step using ethanol of increasing concentrations (e.g., 70%, 80%, 95%, 100%). The dehydrated cartilage was embedded with paraffin and then sectioned. After dissolving the wax away with xylene, sections were H&E stained using a kit from Beyotime following the manufacturer’s instructions.

Senescence-Associated β-Galactosidase (SA-β-gal) Staining

SA-β-gal staining assay was performed using a Senescence β-galactosidase staining kit (Cell Signaling Technology) following the manufacturer’s instructions.

For cultured cells, adherent cells were washed with PBS after incubation, which was followed by adding the fixation buffer. After fixation, the chondrocytes were washed twice to completely remove the fixation buffer. And then the cells were incubated with the staining buffer containing X-gal at 37°C, pH 6.0 with no CO₂, overnight. The blue cells were counted after staining.

For tissue, the cartilage tissues were embedded with OCT (Sakura) when separating from bone, followed by slicing. Fixation and staining were as described for cells in culture.

TUNEL Staining for Apoptosis

The TUNEL BrightGreen Apoptosis Detection Kit (Vazyme) was used for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining. Paraffin- embedded tissue sections were deparaffinized in xylene and rehydrated through a graded series of ethanol to distilled water. The sections were then incubated with Proteinase K at room temperature for permeabilization. After that, the sections were incubated in the equilibration buffer. During this time, the TdT reaction mixture was prepared freshly in the dark. After equilibration, the sections were incubated in TdT reaction mixture at 37°C in a wet box overnight and then washed with PBS. DAPI (Beyotime) was used for counterstaining the samples in the dark, after which PBS was applied for washing. The sections were analyzed under a fluorescence microscope (NIKON Ti2-FL).

RT-qPCR

The expression levels of p16 and p21 were used to assess cellular senescence. The ratio of Bcl-2 expression level to Bax expression level was used to evaluate apoptosis. Total RNA from chondrocytes was isolated using a FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme) and reverse-transcribed to cDNA using a HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme). The PCR reaction containing SYBR Green (Thermo), primers (Biosune), cDNA template and H₂O was run on QuantStudio6 pro and each reaction was repeated 3 times. The mRNA expression levels were normalized to β-actin. The primer sequences used are listed as follows: p16, forward: GAGCAGCATGGAGCCTTC, reverse: CGTAACTATTCGGTGCGTTG; p21, forward: TCACTGTCTTGTACCCTTGTGC, reverse: GGCGTTTGGAGTGGTAGAAA; Bcl-2, forward: AGGCTGGGATGCCTTTGTGGAA, reverse: CAAGCTCCCACCAGGGCCAAA; Bax, forward: GCCGGGTTGTCGCCCTTTTC, reverse: GCAGCCCCCAACCACCCTG; β-actin, forward: CCAACCGCGAGAAGATGA, reverse: CCAGAGGCGTACAGGGATAG.

Statistical Analysis

For statistical analyses, we fitted linear regression models to test the significance of age-related changes in biomarkers. One-way analysis of variance (ANOVA) was performed to assess differences among groups, followed by Tukey’s post hoc test for pairwise comparisons. Adjusted p-values less than .05 were considered statistically significant. All analyses were performed in R. Error bars represent the standard deviation (SD), calculated from biological replicates.

Results

Bleomycin Induces Cellular Senescence and Apoptosis

We treated the chondrocyte cell line with bleomycin to induce cellular senescence with concentrations of 5, 10, or 20 μM ( Fig. 1 ), while mock-treated cells with only DMEM served as the control group. At 2 hours postbleomycin treatment (2h-BLM), cellular senescence markers, SA-β-gal activity ( Fig. 2A-C ) and p16 expression levels ( Fig. 2D ) showed no significant differences; increased p21 expression ( Fig. 2E ) and a decreased ratio of Bcl-2 to Bax (a measure of apoptosis; Fig. 2F ) were statistically significant but of small magnitude. However, at 7 days after recovery (2h-BLM-recover-7d), all three senescence markers were significantly increased ( Fig. 2C-E ), and the ratio of Bcl-2 to Bax showed a marked and pronounced decrease ( Fig. 2F ). These results indicate the simultaneous presence of cellular senescence and apoptosis in bleomycin-treated chondrocytes. While some chondrocytes enter the senescent state after exposure to bleomycin, others undergo programmed cell death due to the divergent DNA damage responses.

Figure 1.

Study design for analyzing chondrocytes for cellular senescence.

Figure 2.

Bleomycin-induced cellular senescence and apoptosis. (A) Representative images of SA-β-gal in chondrocytes treated with bleomycin for 2 hours. Scale bar = 100 μm. (B) Representative images of SA-β-gal in chondrocytes treated with bleomycin for 2 hours and incubated for 7 days. Scale bar = 100 μm. (C) SA-β-gal positive rate for each group. Images from 10 nonoverlapping fields were collected per group for quantification. (D, E) p16 and p21 expression level for each group. Each group included six replicates. (F) The ratio of Bcl-2 expression level to Bax expression level for each group. Each group included six replicates. Data are shown as average ± SD.

N-ethyl-N-nitrosourea (ENU) Does Not Induce Cellular Senescence or Apoptosis

Chondrocytes were treated with 25 and 50 μg/ml ENU, while mock-treated cells with only DMEM served as the control group ( Fig. 1 ). The percentage of SA-β-gal positive cells, as well as markers of cellular senescence, including p16 and p21 ( Fig. 3B-D ), showed no significant differences among the three groups. Similarly, the ratio of apoptotic markers Bcl-2 to Bax ( Fig. 3E ) were consistent across all treatment conditions.

Figure 3.

ENU does not induce cellular senescence or apoptosis. (A) Representative images of SA-β-gal in chondrocytes treated with ENU. Scale bar = 100 μm. (B) SA-β-gal positive rate for three groups. Images from 10 nonoverlapping fields were collected per group for quantification. (C, D) p16 and p21 expression level for three groups. Each group included nine replicates. (E) The ratio of Bcl-2 expression level to Bax expression level for three groups. Each group included nine replicates. Data are shown as average ± SD.

Increased Senescence in Chondrocytes from Cartilage Lesions in Osteoarthritis Patients

To study cellular senescence in human cartilage in vivo, in relation to OA, we collected four OA and four non-OA articular cartilage samples ( Table 1 ). OA samples were classified as an OA lesion and an OA nonlesion group, based on the degree of cartilage damage ( Fig. 1 ).

Table 1.

Clinical Sample Information.

Sample ID	Age	Gender	Diagnosis	Cartilage
P26	74	female	OA	OA Lesion
				OA non-Lesion
P27	69	female	OA	OA Lesion
				OA non-Lesion
P28	64	female	OA	OA Lesion
P29	73	female	OA	OA Lesion
P30	80	female	non-OA	Control
P31	80	female	non-OA	Control
P32	90	female	non-OA	Control
P33	69	female	non-OA	Control

The level of cellular senescence was assessed using the SA-β-gal biomarker, as well as the expression levels of p16 and p21. The mRNA level of p16 and p21 did not change with age (Fig. 4A, B). However, the mRNA level of p16 was significantly higher in the OA lesion group compared with the non-OA control group ( Fig. 4D ). The mRNA level of p21, although not statistically significant, also exhibited a trend of being higher in OA-lesion cartilage compared with the control group ( Fig. 4E ). The positive rate of SA-β-gal was significantly higher in the OA lesion group compared with the non-OA control group and the OA nonlesion group ( Fig. 4J ). We also measured the apoptosis levels, using the ratio of expression of Bcl-2 to Bax (Fig. 4C, F, I) and TUNEL staining ( Fig. 4K , Suppl. Fig. S1) as measures. The results showed a significant decrease in Bcl-2 to Bax ratio and an increase in TUNEL staining in cartilage of the OA group, both indications of increased apoptosis. In the non-OA control group, the Bcl-2 to Bax ratio decreased with age. Hence, these results indicate increased cellular senescence and apoptosis in chondrocytes from OA cartilage as compared with cartilage from non-OA controls.

Figure 4.

Cellular senescence and apoptosis biomarkers in chondrocytes from articular cartilage. (A-I) Age-associated trends and intergroup comparison in p16 and p21 expression levels and the ratio of Bcl-2 expression level to Bax expression level. Each sample included three replicates. Data are shown as boxplots indicating the interquartile range (IQR), with the center line representing the median and whiskers extending to 1.5 × IQR. (J, K). SA-β-gal and TUNEL positive rates for each group. The rates were calculated by dividing the number of positive cells by the total number of cells. Each group included three replicates. Data are shown as average ± SD.

Discussion

Cellular senescence is a cellular state characterized by irreversible cell cycle arrest and a pro-inflammatory secretory phenotype. Senescent cells can contribute to tissue dysfunction and chronic inflammation. ²⁴ Cellular senescence likely results from DNA damage, more specifically, DNA double-strand breaks and genome structural variation. Indeed, our results show that while bleomycin, a clastogen, readily induces cellular senescence in chondrocytes, the point mutagen ENU has no such effects. The DNA damage repair systems are critical for preserving genome stability, but their efficiency and accuracy may diminish with age. The interplay between DNA damage repair mechanisms, cellular senescence, and somatic mutations is central to understanding the pathogenesis of aging-related diseases. ²⁵ OA is a common aging-related disease characterized by cartilage degeneration and joint dysfunction. Its prevalence increases with age, and studies suggest a strong link between DNA damage and OA progression.^26,27 Recent research has observed that somatic mutations in osteoarthritic chondrocytes accumulate with age, consistent with patterns seen in normal aging tissues. ²⁸ Studies have shown that senescent chondrocytes exhibit telomere shortening, increased SA-β-gal activity, and the SASP. The latter is proinflammatory, disrupts the tissue microenvironment and hinders regeneration, thereby contributing to OA progression. ²⁹ Senescent cells impair chondrocyte function and promote further senescence in neighboring cells, exacerbating OA pathology. ³⁰ By directly comparing chondrocytes from cartilage of OA patients with the same cells from cartilage of non-OA controls, we provide clear evidence for increased senescent cells in OA patient lesions. Moreover, we show that the clastogen bleomycin, but not the point mutagen ENU readily induces cellular senescence. This suggests that increased DNA double-strand breaks, which have been demonstrated in OA lesions, ³¹ is a causal factor in OA by driving cellular senescence.

We showed that in OA lesions SA-β-gal activity and p16 expression levels were significantly higher compared with non-OA controls, while p21 expression levels, although not statistically significant, also exhibited a trend of being higher in OA-lesion cartilage compared with the control group. These results suggest an accumulation of senescent cells in OA joints, which is consistent with the growing body of evidence implicating cellular senescence as a contributing factor in OA pathogenesis. ² As mentioned above, senescent cells may contribute to tissue dysfunction through the SASP, which can exacerbate cartilage degradation and promote disease progression. We did not have access to bone samples from young, healthy subjects but increased senescence during aging has been demonstrated in mitotically active cells, most notably from the skin. ¹⁰ Since chondrocytes are essentially nondividing cells, we would not expect an increase of senescence in this cell type.

We also found increased apoptosis in OA cartilage as compared with cartilage from non-OA controls, which confirms results from multiple studies showing evidence that apoptotic cell death occurs at an increased rate in osteoarthritic cartilage. ³² While senescent cells are known to be refractory to programmed cell death, ³³ it is certainly possible that some cells are triggered into apoptosis while others opt for the cellular senescence pathway. It is possible that this is determined by the severity of the DNA damage. The decision between senescence and apoptosis is influenced in part by the extent and type of DNA damage, with milder or repairable lesions typically promoting senescence, while severe or irreparable damage tends to activate apoptotic pathways. Indeed, senescence and apoptosis are distinct biological pathways, which could contribute in different ways to the pathogenesis of OA. ³⁴ Increased apoptosis may lead to a progressive loss of chondrocytes, thereby weakening the structural integrity of cartilage and diminishing its ability to maintain and repair ECM components. This reduction in viable, functional cells further limits the tissue’s capacity to respond to damage, ultimately exacerbating degeneration. Thus, both apoptosis and senescence may act synergistically to drive OA development through different but complementary mechanisms.

The upstream causes of senescence in joint tissues remain unknown. However, based on the results from both in vivo and in vitro experiments, we propose that cellular senescence in OA is caused by DNA double-strand breaks in response to joint injury. Especially in subjects with already relatively weak DNA repair, such damage may accumulate to levels that overwhelm the capacity for repair. ³⁵

Finally, limitations of our study include the relatively small sample size, which may limit the generalizability of our findings, and the lack of a detailed sequence of events that leads from DNA damage to senescence. Future studies involving larger cohorts and more in-depth mechanistic investigations will be essential to validate and extend our observations, as well as to elucidate the molecular cascade underlying senescence in OA. In addition, further research examining senescence biomarkers or senolytic treatments might help identify early-stage OA and open doors to targeted clinical interventions. These directions will not only enhance the translational relevance of our findings but also provide a foundation for developing strategies to mitigate OA progression.

Supplemental Material

sj-jpg-1-car-10.1177_19476035251344875 – Supplemental material for Cellular Senescence in Human Chondrocytes in Relation to Osteoarthritis

Supplemental material, sj-jpg-1-car-10.1177_19476035251344875 for Cellular Senescence in Human Chondrocytes in Relation to Osteoarthritis by Yu Qiang, Chen Zheng, Alexander Y. Maslov, Zhenzhen Lu, Min Zhou, Junjie Gao, Peijun Ren, Yidan Pang and Jan Vijg in CARTILAGE