miR-708-5p Attenuates Osteoarthritis Progression via Multi-Target Modulation of the NOX4/NF-κB Axis and Cartilage Homeostasis

Abstract

Objective

To investigate the novel role of miR-708-5p in osteoarthritis (OA) and its potential as a therapeutic target through regulation of NOX4/NF-κB signaling.

Methods

Expression levels of miR-708-5p were analyzed in OA cartilage using GEO datasets and validated in interleukin (IL)-1β-treated primary human chondrocytes. Gain- and loss-of-function experiments were performed using miR-708-5p mimics and inhibitors to evaluate its effects on inflammation, extracellular matrix metabolism, apoptosis, and oxidative stress. Direct targeting of NOX4 by miR-708-5p was confirmed through bioinformatic prediction, luciferase reporter assays, and rescue experiments.

Results

miR-708-5p was significantly downregulated in OA cartilage and IL-1β-treated chondrocytes. Overexpression of miR-708-5p attenuated IL-1β-induced inflammatory responses by suppressing pro-inflammatory cytokines (IL-1β, IL-6, tumor necrosis factor [TNF]-α), inhibiting matrix-degrading enzymes (MMP3, ADAMTS-4), and enhancing anabolic factors (COL2A1, SOX9). miR-708-5p protected against chondrocyte apoptosis by regulating Bcl2/BAX and caspase-3 expression. It also increased chondrocyte proliferation in EdU assays and reduced reactive oxygen species (ROS) production. Mechanistically, miR-708-5p directly inhibited NOX4, reducing ROS generation and nuclear factor kappa B (NF-κB) activation. NOX4 overexpression reversed the protective effects of miR-708-5p, confirming the functional significance of this regulatory axis.

Conclusion

miR-708-5p is downregulated in OA and exerts chondroprotective effects. These findings suggest that restoring miR-708-5p expression may effectively suppress the NOX4/NF-κB axis and modulate chondrocyte inflammation, oxidative stress, apoptosis, and matrix degradation.

Keywords

miR-708-5p osteoarthritis NOX4/NF-κB signaling chondrocyte inflammation cartilage homeostasis

Introduction

Osteoarthritis (OA) is a prevalent chronic degenerative joint disorder characterized by progressive cartilage loss, synovial inflammation, abnormal subchondral bone remodeling, and osteophyte formation.^1-3 Current therapeutic approaches remain primarily palliative, ranging from early-stage anti-inflammatory medications to advanced disease surgical interventions.^4,5 The molecular mechanisms underlying OA pathogenesis remain incompletely understood, and effective disease-modifying treatments are lacking, highlighting the urgent need for novel therapeutic strategies.

MicroRNAs (miRNAs) are small, single-stranded, non-coding RNAs, typically 20 to 25 nucleotides long, which serve as crucial post-transcriptional regulators of gene expression. These molecules bind to complementary sequences in the 3'-untranslated regions (3'-UTRs) of target messenger RNAs (mRNAs), leading to either mRNA degradation or translational suppression.⁶ Despite the current lack of U.S. Food and Drug Administration (FDA) approval, miRNAs represent promising therapeutic candidates for OA treatment.⁷ Their ability to simultaneously target multiple genes makes them uniquely suited to address OA’s complex pathology, while their endogenous nature and flexible targeting suggest a favorable safety profile.⁸ These characteristics and growing evidence of their regulatory roles in OA strongly support their continued therapeutic development.^9-11

miR-708-5p has emerged as a potential regulatory factor in joint diseases, with conflicting roles reported across different models. In rheumatoid arthritis (RA), miR-708-5p was downregulated in synovial tissues, where its supplementation induced synoviocyte apoptosis through Wnt3a/β-catenin pathway inhibition in rats.¹² Conversely, elevated miR-708-5p was observed in rabbit knee OA, and its repression promoted cartilage repair via SATB2 targeting.¹³ Recent temporomandibular joint (TMJ) studies found that miR-708-5p deficiency contributed to OA through TLR4/NF-κB pathway activation.¹⁴ These divergent findings across different joint conditions highlight the context-dependent nature of miR-708-5p regulation.

Inflammation, central to OA, is primarily mediated through the cytokine interleukin-1β (IL-1β).^15,16 IL-1β is one of the major catabolic factors involved in OA, and many of its biological effects, such as suppression of extracellular matrix (ECM) synthesis and cell apoptosis, are mediated through reactive oxygen species (ROS) generation. NOX4, a major producer of ROS in chondrocytes, has emerged as a crucial mediator of oxidative stress and inflammation in OA pathogenesis.¹⁷ IL-1β stimulation significantly upregulates NOX4 activity, leading to increased ROS production, which subsequently activates redox-dependent transcription factors such as NF-κB and AP-1.¹⁸ This activation triggers matrix catabolism and chondrocyte death through the increased expression of matrix metalloproteinases (MMPs), ADAMTS proteins, and caspase-3.^19,20 Importantly, NOX4 activation promotes increased production of inflammatory cytokines and leads to the persistence of inflammation, hence sustaining pro-catabolic pathways causing cartilage degradation. Recent studies have demonstrated that NOX4 deficiency protects against cartilage degradation and osteophyte formation in experimental OA models, highlighting its potential as a therapeutic target.^17,21

In this study, we conducted analyses of GEO datasets, revealing significant downregulation of miR-708-5p expression in OA articular tissues compared with normal controls. Subsequently, we investigated the functional role of mir-708-5p in an IL-1β-induced human chondrocyte model of OA. We identified NOX4 as a novel direct target of miR-708-5p through computational prediction and experimental validation. We used multiple molecular approaches to establish that miR-708-5p suppresses NOX4 expression and attenuates chondrocyte inflammatory responses. These findings reveal a novel miR-708-5p/NOX4 regulatory axis in OA pathogenesis and suggest miR-708-5p as a potential therapeutic target.

Materials and Methods

Materials

Recombinant human IL-1b protein was obtained from LEADGENE BIOMEDICAL, Inc. (Taipei, Taiwan). Antibodies against ADAMTS-4, SOX9, ACAN, MMP-3, MMP-13, iNOS, BAX, caspase-3, NOX4, and β-Actin were purchased from Proteintech Group (USA). Anti-COL2A1 was obtained from Arigo biolaboratories Corp (Taiwan). Antibodies against IL-1β, IL-6, and TNF-α were from Boster biological technology (USA). MMP-3 IL-6 and tumor necrosis factor-alpha (TNF-α) enzyme-linked immunosorbent assay (ELISA) kits were purchased from ABclonal Technology (Palo Alto, CA, USA). Polymerase chain reaction (PCR) Master Mix and Lipofectamine^® 2000 were bought from Thermo Scientific. Total RNA was extracted using the RNAzol or TOOLSmart RNA Extractor reagent (BIOTOOLS) (Foster City, CA, USA). Protease and phosphatase inhibitors were purchased from BIOTOOLS (Taiwan).

Isolation and Culture of Primary Human Chondrocytes

Following Institutional review Board (IRB) approval (Blinded for peer review), human chondrocytes from individuals with OA (3 females, ages 80, 72, and 65 years) were extracted during total knee arthroplasty procedures. To isolate the chondrocytes, the articular cartilage slices were chopped finely with a scalpel blade. Cartilage tissue was digested overnight with 0.01% (w/v, 0.166 U/mL) collagenase P in a medium containing 10% fetal calf serum (FCS) at 37°C. Afterward, the freed cells were separated from tissue debris by filtration through a 70 µm nylon cell strainer and collected from the filtrate to remove the undigested cartilage. The chondrocytes were cultured with DMEM (high glucose) supplemented with 10% FCS, L-glutamine, and penicillin at 100 U/mL (Gibco) and streptomycin at 100 µg/mL (Gibco) at 37°C in humidified conditions with 5% CO₂.

Analysis of the GEO Database

Gene-level profiles in OA and normal articular cartilage and synovial tissue were analyzed using 2 GEO datasets: GSE105027 (comprising 12 OA and 12 normal samples) and GSE143514 (comprising 5 OA patients and 3 healthy controls).^22,23 These datasets analyzed miR-708-5p expression levels between OA and normal tissues.

DNA Constructs

PCR amplified the full-length cDNA of the human NOX4 gene. The PCR fragments were then inserted into the KpnI and ApaI sites of the pcDNA3.1/myc-His A expression vector containing the cytomegalovirus (CMV) promoter. PCR amplified the full-length 3’UTR of the human NOX4 gene. The PCR fragments were cloned into the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA). Mutant-type NOX4 3’-UTR (miR-708-5p binding site mutant) luciferase reporters were purchased from MDBio, Inc.

Luciferase Reporter Gene Assay

Chondrocytes were placed in 12-well plates and were transfected with the plasmid and miRNA or expression plasmids using Lipofectamine 2000. Forty-eight hours after transfection, the cells were collected and lysed. Then, the measurement of luciferase activity was described previously by Huang et al.²⁴ The luciferase activity was determined and normalized with the amount of total protein. Continuous data are presented as mean values and standard deviations (SDs) for 3 determinations.

Transfection

MiR-708-5p mimics and inhibitors are chemically synthesized in MDBio, Inc. (Taipei, Taiwan). The sequences of miR-708-5p mimics were 5’- AAGGAGCUUACAAUCUAGCUGGG-3’ for sense and 5’-CAGCUAGAUUGUAAGCUCCUUUU-3’ for antisense. The sequences of miR-708-5p mimics NC were 5’-UCAGAGAAAUCAUCAGGGCUUGG-3’ for sense and 5’-AAGCCCUGAUGAUUUCUCUGAUU-3’ for antisense. The sequence of miR-708-5p inhibitors was 5’-CCCAGCUAGAUUGUAAGCUCCUU-3’. The sequence for miR-708-5p inhibitors NC was 5’-AUAUGUGGACGUCCCUCCCUUAA-3’. Human chondrocytes in 6-well plates grown to about 80% confluence, 10 nM miR-708-5p mimics, 10 nM mimics negative control (mimics NC), 10 nM miR-708-5p inhibitor, and 10 nM inhibitor NC or 2 μg pcDNA-NOX4 or pcDNA vector were transfected into cells at 37 °C for 24 h, using Lipofectamine 2000 (Invitrogen). After transfection, the cells were stimulated with IL-1β for 24 hours and then utilized in subsequent experiments.

qRT-PCR

According to the manufacturer’s protocol, total RNA was extracted from chondrocytes with the RNAzol reagent (MOLECULAR RESEARCH CENTER, INC). Reverse transcription was synthesized using the Thermo Scientific Maxima First Strand cDNA Synthesis Kit (ThermoFisher, Waltham, MA, USA), respectively. The primers for qRT-PCR analyses were as follows: miR-27a forward: 5’-TTCACAGTGGCTAAG-3’; miR-27a reverse: 5’-GTGCAGGGTCCGAGGT-3’; U6 forward: 5’-TGCGGGTGCTCGCTTCGCAGC-3’; U6 reverse: 5’-CCAGTGCAGGGTCCGAGGT-3’; Odz4 forward: 5’-CACCCTTCG GATTCTGTACGAC-3,’ reverse: 5’-AGCTCCATGTCTTCCCATCAGC-3,’ COL2A1 forward: 5’-ACATGGAGACTGGCGAGACTTG-3,’ reverse: 5’- GGACAGCAGGCGTAGGAAGGTC-3’; SOX9 forward: 5’-CGGTCAGCCAGGTGCTCAAAGG-3,’ reverse: 5’-GAGCTTGCC CAGCGTCTTGCTG-3,’ MMP3 forward: 5’-GAACCTGTCCCTCCAGAACCTG- 3,’ reverse: 5’-TATGCGGCATCCACGCCTGAAG-3,’ ADAMTS4 forward: 5’-CAAGCATCCGCAATCCTGTCAG-3,’ reverse: 5’- ACACAGGTCCTGACGGGTAAAC-3,’ NOX4 forward:5’- TCTTGGCTTACCTCCGAGGATC-3,’ reverse: 5’-GTTGAGGGC ATTCACCAGATGG-3,’ IL-1β forward: 5’-TTCAGGCAGGCCGCGTCAGTTG-3,’ reverse: 5’-CGGAGCGTGCAGTTCAGTGATC-3,’ IL-6 forward: 5’-CCAGAGCTGTGCAGATGAGTAC-3,’ reverse: 5’- CAGGCTGGACTGCAGGAACTCC-3,’ BCL2 forward: 5’ -AGCTGCACCTGACGCCCTTCAC-3,’ reverse: 5’-GTGCCGGTT CAGGTACTCAGTC-3,’ caspase-3 forward: 5’- ATTGTGGAATTGATGCGTGA -3,’ reverse: 5’-CAACGATCCCCTCTGAAAAA- 3,’ GAPDH forward: 5’-GGCCAAGGTCATCCATGACAAC-3,’ GAPDH reverse: 5’-TCCCGTTCAGCTCAGGGATGAC-3.’ To measure miR-708-5p, reverse transcription was performed using the miRCURY LNA miRNA PCR Starter Kit (Qiagen, Hilden, Germany), and relative quantification was determined by normalization to U6 or GAPDH. The qRT-PCR assays were performed in triplicate, and the relative expression levels were calculated based on the 2^−ΔΔCt method.

Western Blot

The cells were washed thrice with cold phosphate-buffered saline (PBS), and cell lysates were extracted with RIPA buffer (50 mM Tris–HC1, 150 mM NaCl, 1% IGEPAL CA-630, and 0.5% sodium deoxycholate) containing the protease and phosphatase inhibitor (BIOTOOLS, Taiwan). The total protein concentration of various lysates was determined according to the Bio-Rad Bradford Protein Assays kit using bovine serum albumin (BSA) as a standard. A semidry apparatus separated Equal amounts of proteins on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride membrane. Primary antibodies against the following proteins were used: MMP-3, MMP-13, ADAMTS-4, SOX9, iNOS, BAX, IL-1β, IL-6, TNFα, COL2A1, ACAN, caspase 3, NOX4 and β-Actin were employed as primary antibodies. The immunoblot analysis was performed using a secondary mouse or rabbit immunoglobulin G (IgG) antibody coupled with horseradish peroxidase, which was detected by the Millipore ECL kit (Thermo Fisher Scientific, UK). The densities of the immunoblots were determined using an image analysis system installed with the BIO-ID software (VilberLourmat, France).

Edu Assay

We used the Click-iT™ EdU Cell Proliferation Kit (Invitrogen, ThermoFisher) to evaluate cell proliferation. Briefly, after transfection with miR-708-5p mimics, miR-708-5p inhibitor, or corresponding negative controls for 48 hours, chondrocytes were exposed to 20 μM EdU for 2 hours and fixed with 4% formaldehyde in PBS for 20 minutes. Thereafter, the cells were stained with Hoechst 33342, while proliferative cells were labeled with EdU staining in green. Afterward, they were photographed with fluorescence microscopy. EdU-positive (EdU⁺) cells were imaged using a fluorescence microscope and counted under a microscope.

ELISA Assay

Cells were transfected with various plasmids, pcNOX4 or miR-708-5p, after which they were exposed to IL-1β (10 ng/ml) for 24 or 72 hours. Then, the levels of IL-6 (cat no. KE00139, Proteintech, Rosemont, USA) and TNF-α (cat no.KE00068, Proteintech, Rosemont, USA) in the culture supernatants were detected using the commercial ELISA kits per the manufacturer’s standard protocols.

ROS Detection

Human chondrocytes were transiently transfected with the 10 nM miR-708-5p mimics, 10 nM mimics negative control (mimics NC), 10 nM miR-708-5p inhibitor, and 10 nM inhibitor NC for 24 hours, using Lipofectamine 2000 (Invitrogen). Then, the cells were stimulated with or without 10 ng/ml IL-1β for 24 hours. The cells were then incubated with 10 μM DCFH-DA in DMEM for 30 minutes at 37°C washed with ice-cold PBS. They detected the fluorescence via fluorescence microscopy at 488 nm excitation and 525 nm emission.

Statistical Analysis

All experiments were performed at least 3 times independently and data are presented as mean ± standard deviation (SD). Statistical analyses were conducted using GraphPad Prism software (version 10.0). For comparisons between 2 groups, Student’s t-test was applied. For multiple group comparisons, 1-way analysis of variance (ANOVA) was performed. For time-dependent experiments, 2-way ANOVA was used. A p value <0.05 was considered statistically significant.

Results

MiR-708-5p is Downregulated in OA Cartilage and IL-1β-Treated Human Articular Chondrocytes

Gene Expression Omnibus (GEO) database records (GSE105027, GSE143514) were first analyzed to evaluate the clinical relevance of miR-708-5p in OA pathogenesis. This analysis revealed significantly lower levels of miR-708-5p in cartilage and synovial tissues collected from OA patients compared with those from healthy controls (Fig. 1A, B).

Figure 1.

miR-708-5p expression is downregulated in osteoarthritic cartilage and IL-1β-stimulated chondrocytes. (A, B) Expression levels of miR-708-5p in normal and osteoarthritis (OA) cartilage tissues from GEO datasets (A) GSE105027 and (B) GSE143514. (C, D) Time-dependent suppression of (C) miR-708-5p and its host gene (D) Odz4 expression in human chondrocytes following stimulation with IL-1β (10 ng/ml) for indicated periods (0, 1, 6, 12, or 24 hours). Expression levels were determined by real-time PCR and normalized to GAPDH. Data are presented as mean ± SD. Statistical significance: * P < 0.05, ** P < 0.01, *** P < 0.001 compared to control group.

To validate these clinical findings and investigate the regulatory mechanisms, we investigated miR-708-5p expression in an IL-1β-induced OA cell model. Primary human chondrocytes were treated with 10 ng/ml IL-1β at 0, 1, 6, 12, or 24 hours before evaluating miR-708-5p expression. IL-1β treatment significantly suppressed miR-708-5p expression in a time-dependent manner compared with the untreated controls (Fig. 1C). Moreover, we observed that Odz4 mRNA, which hosts miR-708-5p in its first intron and is regulated by CCAAT enhancer-binding homologous protein (CHOP) in vertebrates,²⁵ exhibited a similar time-dependent decrease following IL-1β treatment (Fig. 1D). The consistent downregulation of miR-708-5p observed in the GEO database analysis of OA patient tissues and our IL-1β-treated chondrocyte model strongly suggests its involvement in OA pathogenesis.

miR-708-5p Overexpression Attenuated IL-1β-Mediated Inflammation

Proinflammatory cytokines, including IL-1β, IL-6, and TNF-α, contribute to OA pathogenesis by enhancing proteolytic enzyme activity that degrades the ECM of cartilage.²⁶ To investigate the regulatory effects of miR-708-5p on IL-1β-induced inflammatory response in OA, human chondrocytes were transfected with miR-708-5p mimics or inhibitors to achieve overexpression or suppression, respectively. Transfection efficiency was verified by RT-qPCR (Fig. 2A, E). The transfected cells were subsequently stimulated with IL-1β (10 ng/mL) for 24 hours. Results confirmed that miR-708-5p mimics or inhibitors successfully promoted or suppressed miR-708-5p expression compared with the corresponding negative control (NC). Notably, the IL-1β-induced inflammatory response was significantly attenuated by miR-708-5p overexpression (Fig. 2B-D) and enhanced by miR-708-5p inhibition (Fig. 2F-H), suggesting that miR-708-5p negatively regulates the production of IL-1β, IL-6, and TNF-α.

Figure 2.

miR-708-5p inhibits IL-1β-induced inflammatory responses in human chondrocytes. (A) RT-qPCR analysis of miR-708-5p expression in chondrocytes transfected with miR-708-5p mimics or negative control (NC). (B-D) Effects of miR-708-5p overexpression on inflammatory mediators. RT-qPCR analysis of (B) IL-1β and (C) IL-6 mRNA expressions. (D) Western blot analysis and quantification of IL-6 and TNF-α protein levels in chondrocytes transfected with miR-708-5p mimics or NC and treated with IL-1β (10 ng/ml) for 24h. β-Actin served as loading control. (E) RT-qPCR analysis of miR-708-5p expression in chondrocytes transfected with miR-708-5p inhibitor or inhibitor negative control (NC). (F-H) Effects of miR-708-5p inhibition on inflammatory mediators. RT-qPCR analysis of (F) IL-1β and (G) IL-6 mRNA expressions. (H) Western blot analysis and quantification of IL-6 and TNF-α protein levels in chondrocytes transfected with miR-708-5p inhibitor or NC and stimulated with IL-1β (10 ng/ml) for 24h. (I-L) ELISA analysis of IL-6 and TNF-α production in culture supernatants. Concentration of (I, K) IL-6 and (J, L) TNF-α in supernatants from chondrocytes transfected with (I, J) miR-708-5p mimics or (K, L) miR-708-5p inhibitor and stimulated with IL-1β (10 ng/ml) for 24h. Data are presented as mean ± SD. Statistical significance: * P < 0.05, ** P < 0.01, *** P < 0.001 compared to untreated control; # P < 0.05, ## P < 0.01, ### P < 0.001 compared to IL-1β + NC group.

To further characterize the anti-inflammatory effects of miR-708-5p, we measured the secreted protein levels of IL-6 and TNF-α in cell culture supernatant through ELISAs. IL-1β treatment significantly increased IL-6 and TNF-α secretion compared to untreated controls (Fig. 2I-L). Importantly, the overexpression of miR-708-5p mimics significantly reversed the pro-inflammatory effects of IL-1β (Fig. 2I, J), while miR-708-5p inhibition further enhanced the inflammatory response (Fig. 2K, L). These findings establish miR-708-5p as a critical negative regulator of inflammatory responses in OA pathogenesis, with potential therapeutic implications for controlling disease progression.

MiR-708-5p Modulates ECM Homeostasis by Regulating Anabolic and Catabolic Gene Expression in IL-1β-Induced OA

In OA, ECM degradation occurs through the breakdown of collagen and proteoglycan, primarily mediated by MMPs and ADAMTS proteases. We investigated the regulatory role of miR708-5p on cartilage ECM homeostasis by examining its effects on key anabolic factors (COL2A1 and SOX9) and catabolic enzymes (MMP3 and ADAMTS-4) (Fig. 3).

Figure 3.

miR-708-5p regulates extracellular matrix homeostasis in IL-1β-stimulated chondrocytes. (A-C) RT-qPCR analysis of mRNA expression for (A) MMP3, (B) ADAMTS4, and (C) COL2A1 in chondrocytes transfected with miR-708-5p mimics and stimulated with IL-1β (10 ng/ml) for 24h. (D) Western blot analysis and densitometric quantification of catabolic (MMP3, ADAMTS-4) and anabolic (SOX9, COL2A1) proteins in chondrocytes transfected with miR-708-5p mimics or negative control (NC) and stimulated with IL-1β (10 ng/ml) for 24h. β-Actin served as loading control. (E-G) RT-qPCR analysis of mRNA expression for (E) MMP3, (F) ADAMTS-4, and (G) COL2A1 in chondrocytes transfected with miR-708-5p inhibitor and stimulated with IL-1β (10 ng/ml) for 24h. (H) Western blot analysis and quantification of MMP3, ADAMTS-4, SOX9, and COL2A1 proteins in chondrocytes transfected with miR-708-5p inhibitor or inhibitor NC and stimulated with IL-1β (10 ng/ml) for 24h. Data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001 compared to untreated control; # P < 0.05, ## P < 0.01, ### P < 0.001 compared to IL-1β + NC group.

IL-1β treatment for 24 hours significantly altered ECM component expression in human chondrocytes. At the mRNA level, IL-1β induced downregulation of anabolic factors COL2A1 while upregulating catabolic enzymes MMP3 and ADAMTS-4 (Fig. 3A-C). Consistently, protein expression analysis revealed decreased COL2A1 and SOX9 and increased MMP3 and ADAMTS-4 following IL-1β stimulation (Fig. 3D). miR-708-5p overexpression substantially attenuated these IL-1β-induced changes at both mRNA and protein levels, restoring anabolic marker expression while reducing catabolic enzyme levels (Fig. 3A-D).

Conversely, inhibition of miR-708-5p amplified the IL-1β-mediated effects, further elevating catabolic enzyme expression and enhancing suppression of anabolic markers (Fig. 3F-H). These results demonstrate that miR-708-5p is a crucial regulator of cartilage ECM homeostasis through its dual action on matrix synthesis and degradation pathways.

miR-708-5p Attenuates IL-1β-Induced Chondrocyte Apoptosis and Proliferation Impairment

We conducted gain- and loss-of-function analyses to examine miR-708-5p’s effects on chondrocyte survival. IL-1β treatment induced significant apoptosis, as demonstrated by the elevated expression of BAX and cleaved caspase-3, with concurrent bcl2 downregulation (Fig. 4A-C). Importantly, miR-708-5p overexpression significantly mitigated these pathological changes compared to NC transfections. Complementary experiments with miR-708-5p inhibitors confirmed this regulatory relationship, as inhibition exacerbated IL-1β-mediated apoptotic marker expression (Fig. 4D-F).

Figure 4.

miR-708-5p modulates IL-1β-induced chondrocyte apoptosis. (A-B) RT-qPCR analysis of mRNA expression for (A) Bcl2 and (B) caspase-3 in chondrocytes transfected with miR-708-5p mimics or negative control (NC) and treated with IL-1β (10 ng/ml) for 24h. (C) Western blot analysis and densitometric quantification of apoptotic markers Bcl-2-associated X protein (BAX) and cleaved caspase-3 in chondrocytes transfected with miR-708-5p mimics or NC and stimulated with IL-1β (10 ng/ml) for 24h. β-Actin served as loading control. (D-E) RT-qPCR analysis of mRNA expression for (D) Bcl2 and (E) caspase-3 in chondrocytes transfected with miR-708-5p inhibitor or NC and treated with IL-1β (10 ng/ml) for 24h. (F) Western blot analysis and quantification of BAX and cleaved caspase-3 proteins in chondrocytes transfected with miR-708-5p inhibitor or NC and stimulated with IL-1β (10 ng/ml) for 24h. Data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001 compared to untreated control; # P < 0.05, ## P < 0.01, ### P < 0.001 compared to IL-1β + NC group.

Cell proliferation analyses using EdU incorporation assays demonstrated that IL-1β significantly suppressed chondrocyte proliferation, reducing EdU⁺ cell populations (Fig. 5A-B). Notably, miR-708-5p overexpression partially restored proliferative capacity (Fig. 5A). At the same time, its inhibition further diminished proliferating cell numbers (Fig. 5B). These findings reveal a previously unrecognized regulatory mechanism whereby miR-708-5p suppresses the NOX4/NF-κB signaling axis, providing mechanistic insight into its anti-inflammatory effects and strengthening its candidacy as a therapeutic target for OA

Figure 5.

miR-708-5p regulates chondrocyte proliferation under IL-1β stimulation. (A-B) Human chondrocytes were transfected with (A) miR-708-5p mimics or (B) miR-708-5p inhibitor or respective negative controls (NC) for 24h, then treated with IL-1β (10 ng/ml) for 24h. Cell proliferation was assessed by EdU incorporation assay (green) with DAPI nuclear counterstaining (blue). Quantification is shown as the percentage of EdU-positive cells (right panels). ***P < 0.001 compared to untreated control; ## P < 0.01, ### P < 0.001 compared to IL-1β + respective NC group.

Identification and Functional Validation of NOX4 as a Direct Target of miR-708-5p

To elucidate the molecular mechanism by which miR-708-5p attenuates IL-1β-induced cartilage degradation and inflammatory response in chondrocytes, we used computational algorithms (miRWalk) to predict the targets of miR-708-5p. Bioinformatic analyses revealed a specific binding site within the NOX4 3'-UTR that corresponds to the miR-708-5p sequence (Fig. 6A). Our experiments confirmed that miR-708-5p directly regulates NOX4 expression, as miR-708-5p overexpression significantly decreased NOX4 mRNA and protein levels (Fig. 6B, C). In contrast, miR-708-5p inhibition increased NOX4 expression (Fig. 6D, E).

Figure 6.

NOX4 is a direct target of miR-708-5p. (A) Predicted secondary structure of miR-708-5p and sequence alignment showing the binding site between miR-708-5p and NOX4 3'UTR. The wild-type (WT) sequence and mutated (MUT) binding site are shown with mutated nucleotides highlighted in red. (B-C) Effects of miR-708-5p on NOX4 expression: (B) Relative NOX4 mRNA expression and (C) representative Western blot with quantification of NOX4 protein expression in chondrocytes transfected with miR-708-5p mimic or negative control (NC). (D-E) Effects of miR-708-5p inhibition on NOX4 expression: (D) Relative NOX4 mRNA expression and (E) representative Western blot with quantification of NOX4 protein expression in chondrocytes transfected with miR-708-5p inhibitor or negative control (NC). β-Actin served as loading control for all Western blots. (F-G) Luciferase reporter assay results showing relative luciferase activity in chondrocytes co-transfected with miR-708-5p mimic or NC along with (F) wild-type NOX4 3'UTR or (G) mutated NOX4 3'UTR reporter constructs. **P < 0.01, ***P < 0.001 compared to respective NC.

To validate NOX4 as a direct target of miR-708-5p, we performed a luciferase reporter plasmid carrying the wild-type (WT) or mutant (MUT) NOX4 3’-UTR, which were co-transfected with the miR-708-5p mimics or mimics-NC (Fig. 6F, G). The results revealed that miR-708-5p overexpression significantly reduced luciferase activity in cells transfected by the WT NOX4 3’-UTR constructs, while no significant changes were observed in cells transfected with the MUT NOX4 3’-UTR. These findings provide strong evidence that NOX4 is a direct target of miR-708-5p, establishing a molecular mechanism through which miR-708-5p may exert its protective effects in chondrocytes.

miR-708-5p Upregulation Suppressed IL-1β-Induced NOX4 Expression, Oxidative Stress Response, and ROS Production in Chondrocytes

ROS and oxidative stress are crucial in cartilage homeostasis and OA pathogenesis.²⁷ Using the DCF-DA assay, we observed that IL-1β significantly elevated intracellular ROS levels, which was effectively suppressed by miR-708-5p overexpression (Fig. 7A) and further amplified by miR-708-5p inhibition (Fig. 7C).

Figure 7.

miR-708-5p modulates IL-1β-induced oxidative stress and NOX4/NF-κB signaling in chondrocytes. (A-D) Effects of miR-708-5p on ROS production and NOX4 expression. Human chondrocytes were transfected with miR-708-5p (A-B) mimics or (C-D) inhibitors and treated with IL-1β (10 ng/ml) for 24h. (A, C) ROS production visualized with DCFH-DA staining (green fluorescence, bottom panels) and corresponding phase contrast images (top panels). (B, D) RT-qPCR analysis of NOX4 mRNA expression under the same treatment conditions. (E-F) Western blot analysis and quantification of NOX4 protein expression in IL-1β-stimulated chondrocytes after transfection with miR-708-5p (E) mimics or (F) inhibitor, with β-Actin as loading control. (G-H) Western blot analysis and quantification of NF-κB pathway activation showing phosphorylated NF-κB (p-NF-κB) and total NF-κB in IL-1β-stimulated chondrocytes transfected with miR-708-5p (G) mimics or (H) inhibitor relative to appropriate controls. * P < 0.05, ** P < 0.01 compared to untreated control; # P < 0.05, ## P < 0.01 compared to IL-1β + respective negative control (NC) group.

At the molecular level, IL-1β treatment substantially upregulated NOX4 expression. qRT-PCR analysis revealed that this IL-1β-mediated induction of NOX4 mRNA was significantly suppressed by miR-708-5p overexpression (Fig. 7B) and enhanced by miR-708-5p inhibition (Fig. 7D). Western blot analysis confirmed parallel changes at the protein level, establishing an inverse relationship between miR-708-5p and NOX4 expression under inflammatory conditions (Fig. 7E, F).

Given NOX4’s role in NF-κB signaling, we examined this downstream pathway activation. IL-1β stimulation significantly increased NF-κB phosphorylation, which was markedly diminished by miR-708-5p overexpression (Fig. 7G) and enhanced by miR-708-5p inhibition (Fig. 7H). These findings demonstrate that miR-708-5p modulates IL-1β-induced inflammatory responses through regulation of the NOX4/NF-κB signaling axis, highlighting its potential therapeutic value in OA treatment.

The miR-708-5p/NOX4 Axis Modulated IL-1β-Induced Chondrocyte Damage

To confirm the functional significance of the miR-708-5p/NOX4 regulatory axis, we examined the effects of NOX4 overexpression in combination with miR-708-5p (Fig. 8). Western blot analysis demonstrated that NOX4 expression increased in IL-1β-stimulated chondrocytes compared to control. This IL-1β-induced upregulation of NOX4 was suppressed by miR-708-5p overexpression, while co-transfection with NOX4 overexpression plasmid (pcNOX4) restored NOX4 protein levels (Fig. 8A). Under IL-1β stimulation, the expressions of matrix-degrading enzymes (MMP13), inflammatory mediators (iNOS), and apoptotic markers (caspase3) were significantly elevated. miR-708-5p overexpression suppressed these inflammatory and catabolic responses, while NOX4 overexpression counteracted miR-708-5p’s protective effects. MTT assay results showed that miR-708-5p enhanced chondrocyte viability under IL-1β stimulation, while NOX4 overexpression reduced cell viability (Fig. 8B).

Figure 8.

The miR-708-5p/NOX4/NF-κB axis modulates IL-1β-induced inflammatory and catabolic responses in chondrocytes. (A) Western blot analysis and densitometric quantification of MMP3, MMP13, iNOS, NOX4, and caspase3 protein expression in human chondrocytes. Cells were co-transfected with miR-708-5p mimics and/or NOX4 overexpression plasmid (pcNOX4) as indicated, then stimulated with IL-1β (10 ng/ml) for 24h. β-Actin served as loading control. (B) Cell viability assessed by MTT assay in chondrocytes under the same treatment conditions as in (A). Results expressed as OD570 nm. (C-D) ELISA analysis of (C) IL-6 and (D) TNF-α production in culture supernatants of chondrocytes treated as in (A). ** P < 0.01, *** P < 0.001 compared to untreated control; # P < 0.05, ### P < 0.001 compared to IL-1β treated group; & P < 0.05, && P < 0.01, *** P < 0.001 compared to IL-1β + miR708-5p group.

ELISA analysis further confirmed the role of the miR-708-5p/NOX4 axis in regulating inflammatory cytokine production (Fig. 8C, D). The inhibitory effects of miR-708-5p on IL-6 and TNF-α secretion were partially reversed by NOX4 overexpression. Collectively, our data demonstrate that the miR-708-5p/NOX4/NF-κB signaling axis plays a pivotal role in mediating IL-1β-induced oxidative stress, catabolic enzyme expression, and chondrocyte dysfunction, highlighting its regulatory significance in OA pathology.

Discussion

The present study identified miR-708-5p as a critical regulator of OA pathogenesis through the comprehensive analysis of GEO databases and in vitro models. Our investigations revealed significant decreases in miR-708-5p expression in OA patients’ articular cartilage tissues and IL-1β-treated chondrocytes. Using computational algorithms (miRWalk), we identified NOX4 as a direct target of miR-708-5p. Moreover, overexpression of miR-708-5p alleviated IL-1β-induced inflammatory response, apoptosis, cartilage degradation, and ROS production through the NOX4/NF-κB pathway in chondrocytes. Our data indicate miR-708-5p as a promising therapeutic modulator of the NOX4/NF-κB signaling axis, with a multifaceted role in maintaining cartilage homeostasis.

Aberrant expression of miRNAs is closely correlated with various diseases, including OA.^28-30 miRNAs exert important functions in chondrocyte homeostasis by regulating the inflammatory responses, oxidative stress, ECM-related protein production, apoptosis, and senescence.^31,32 Recent studies have revealed diverse roles of miR-708-5p in tissue homeostasis and stress responses, highlighting its potential significance in joint diseases.^12,13,33 To validate the role of miR-708-5p in OA and address the knowledge gap in human studies, we investigated its function using primary human chondrocytes and clinical sample databases. Our study in human knee OA chondrocytes revealed decreased miR-708-5p expression in OA conditions, similar to Xu’s findings in rodent TMJ.¹⁴

While Xu et al.¹⁴ investigated miR-708-5p’s role in mechanically-induced TMJ OA through the TLR4/NF-κB pathway in rodent models, our study uniquely demonstrates that miR-708-5p regulates oxidative stress-mediated cartilage degradation through the NOX4/NF-κB axis in human chondrocytes. The consistency between our findings and Xu’s observations in TMJ regarding miR-708-5p’s protective role suggests a common regulatory mechanism in inflammatory conditions. However, Wang et al.¹³ reported contrasting findings in their rabbit knee OA model, where miR-708-5p was upregulated in the chondrocytes and exhibited detrimental effects through targeting SATB2. This apparent dichotomy in miR-708-5p function likely reflects fundamental differences between the studies in experimental contexts, tissue characteristics, and disease progression stages.

Several key biological and methodological factors may explain these divergent findings across experimental models. First, the cellular response to OA varies significantly depending on the joint type, disease stage, and the degree of cartilage degeneration. Our samples were derived from end-stage OA patients undergoing total knee arthroplasty, where the cartilage may have undergone phenotypic transformation toward fibrocartilage—more like TMJ tissue than to the early-stage cartilage in Wang’s experimental model. Second, the disease models employed in each study triggered distinct pathogenic mechanisms. Wang et al. focused on post-surgical regeneration involving stem cell responses, while Xu et al. examined age-related mechanical stress, and our study investigated inflammatory/oxidative stress conditions. Third, these different disease triggers likely activate distinct molecular pathways. SATB2-mediated stem cell differentiation in the rabbit model versus stress response pathways leading to NF-κB activation in TMJ and human chondrocytes. The consistency between our findings in human chondrocytes and Xu’s observations in TMJ regarding miR-708-5p’s protective role through NF-κB regulation suggests this may be the predominant pathway in inflammatory and mechanical stress conditions. However, the contrasting results from Wang’s regeneration model highlight how miR-708-5p’s function can shift when the cellular context changes from stress response to repair. These context-dependent differences suggest therapeutic strategies targeting miR-708-5p must carefully consider the specific disease mechanism and joint type involved. These model-specific difference in miR-708-5p function underscored the need to identify its direct molecular targets in human OA, which would explain its protective effects in our experimental system.

Our identification of NOX4 as a direct target of miR-708-5p reveals a novel regulatory axis in OA that modulates oxidative stress and inflammatory responses. However, the relationship between miR-708-5p and ROS signaling is highly tissue-specific and disease-dependent. The relationship between miR-708-5p and ROS displays remarkable context specificity across different tissues and disease models.^34-36 In osteoblasts, miR-708-5p protects against oxidative stress-induced apoptosis by targeting PTEN.³⁴ It also suppresses hypoxia/reoxygenation-induced inflammation and ROS generation in cardiomyocytes.³⁶ However, overexpression of miR-708-5p in cancer cells promoted ROS-induced apoptosis.^37,38 Our study has established that in human chondrocytes, miR-708-5p specifically targets NOX4, a critical upstream regulator of ROS, thereby exerting protective effects against oxidative stress in OA pathogenesis.

After identifying the context-dependent nature of miR-708-5p, we sought to elucidate its molecular mechanism in human OA chondrocytes. IL-1β, a pivotal inflammatory mediator in OA pathogenesis, triggers a cascade of cellular responses in chondrocytes, including upregulation of NOX4 and p22phox proteins, leading to increased NOX4-derived ROS generation.^39,40 This IL-1β-mediated NOX4 activation induces significant upregulation of matrix-degrading enzymes (MMPs and ADAMTs4) while simultaneously suppressing the synthesis of critical cartilage components like type II collagen and aggrecan, primarily through the activation of NF-κB, AP1, and HIF-1α signaling pathways.^19,41-43 Using luciferase reporter assays, we confirmed miR-708-5p’s ability to suppress IL-1β-induced NOX4 expression, ROS production, and NF-κB pathway activation in chondrocytes. Furthermore, our rescue experiments revealed that NOX4 overexpression could reverse the protective effects of miR-708-5p on cell viability and inflammatory responses, confirming that the miR-708-5p/NOX4 axis plays a crucial role in regulating IL-1β-induced chondrocyte injury in OA.

While our findings establish NOX4 as the key target in chondrocytes, miR-708-5p exhibits diverse roles in inflammation across different tissues. It protects cardiomyocytes against hypoxia/reoxygenation-induced inflammation by targeting HMGB1 signaling and inhibits alcohol-induced liver inflammation through ZEB1/AKT/mTOR pathway regulation.^36,44 Conversely, in dental pulp stem cells, miR-708-5p knockdown reduces LPS-induced inflammation and apoptosis.⁴⁵ Our study reveals that miR-708-5p specifically enhanced cartilage-specific matrix markers while reducing inflammatory mediators, suggesting its therapeutic potential in cartilage protection.

OA represents a highly intricate disorder affecting the entire joint, involving multiple tissues rather than cartilage.⁴⁶ The pathogenesis involves a complex interplay between cartilage, synovium, and subchondral bone that significantly affects disease progression and therapeutic outcome. While our study primarily demonstrates miR-708-5p’s protective effects in human chondrocytes through NOX4/NF-κB pathway regulation, emerging evidence indicates that miR-708-5p may exert pleiotropic effects across various tissues. The synovium contributes significantly to OA through its inflammatory response, producing pro-inflammatory mediators and proteolytic enzymes that drive cartilage degradation and joint tissue damage.⁴⁷ Notably, miR-708-5p has been found to play a protective role in the synovium by increasing cell apoptosis, inhibiting cell proliferation, and decreasing the migration capacity of synovial fibroblasts in rat RA models.¹² While these findings are promising, future studies are needed to investigate the therapeutic effect of miR-708-5p in the human OA models.

Moreover, subchondral bone remodeling is important in OA development and progression.⁴⁸ Research has revealed that miR-708-5p protects osteoblasts and may prevent osteoporosis.³⁴ However, in bone marrow stromal cells (BMSC), miR-708-5p negatively regulates osteoblast differentiation in BMSCs, and inhibition of miR-708-5p rescued the suppressive effects of glucocorticoids on BMSC function.^49,50 It is important to note that these findings regarding miR-708-5p’s effects on bone cells and BMSCs were derived from non-OA models. Further investigations are warranted to elucidate the specific role of miR-708-5p in OA-related bone remodeling, as the pathological microenvironment in OA may significantly influence miR-708-5p’s functional outcomes.

Although miR-708-5p represents a promising therapeutic candidate for OA, its clinical translation remains challenging due to inherent delivery limitations. Unmodified miRNAs are unstable in physiological environments, prone to nuclease degradation, rapid clearance, and poor cellular uptake due to their size and negative charge.⁵¹ These issues are further intensified by the dense, avascular structure of articular cartilage, which restricts molecular diffusion and limits retention.⁵² Nevertheless, various emerging delivery strategies have shown promise to enhance stability, bioavailability, and targeted delivery of miRNAs.⁵³ These include viral vectors, lipid and polymer-based nanoparticles, inorganic carriers, extracellular vesicles, and peptide-based systems.^53-55 These advances may offer a foundation for overcoming existing barriers and may facilitate the clinical translation of miR-708-5p–based OA therapy.

This study has several limitations. First, in vitro experiments were based on chondrocytes from only 3 elderly female OA patients, which limits generalizability to other age groups, sexes, or disease stages. Second, the GEO analysis used only 2 datasets with small sample sizes, reducing the strength of transcriptomic comparisons. Third, the IL-1β-induced cell model does not capture the full complexity of in vivo OA. Lastly, we did not assess in vivo efficacy or delivery strategies for miR-708-5p, which are critical for clinical translation. These limitations highlight the need for future studies utilizing in vivo models and clinical samples to validate our findings and establish the therapeutic potential of miR-708-5p in OA treatment.

Conclusion

Our study establishes miR-708-5p as a crucial regulator in OA pathogenesis through the NOX4/NF-κB signaling pathway. The consistent downregulation of miR-708-5p in both OA clinical samples and IL-1β-stimulated chondrocytes, coupled with its demonstrated ability to preserve cartilage integrity, suppress inflammatory responses, reduce oxidative stress, and maintain ECM homeostasis in IL-1β-stimulated chondrocytes, positions this microRNA as a promising therapeutic target. Future translational work should focus on targeted delivery of miR-708-5p to cartilage tissue and evaluate its therapeutic efficacy in OA animal models.

Footnotes

ORCID iDs

Shih-Hao Huang

Shu-Jung Chen

Pin-Yi Tu

Cheng-Chang Lu

Chih-Chien Wang

Li-Min Chen

Po-Chih Shen

Ethical Considerations

This study was approved by the Institutional Review Board of Kaohsiung Medical University Hospital (KMUHIRB-F(I)-20220166).

Consent to Participate

Not applicable.

Consent for Publication

Not applicable.

Author Contributions

ZM Liu and SH Huang devised the project, the main conceptual ideas, and the proof outline. CC Wang and ZM Liu worked out almost all of the technical details and performed the numerical calculations for the suggested experiment. PC Shen and SJ Chen contributed to the final version of the manuscript. PY Tu and LM Chen contributed to the data analysis and figure visualization. CC Lu and YC Tien supervised the project.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by Kaohsiung Medical University Memorial Hospital (grant no: KMUH-113-3M35).

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability Statement

The corresponding author can provide the data supporting the present study upon reasonable request.

References

Glasson

Askew

Sheppard

Carito

Blanchet

, et al. Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. Nature. 2005;434(7033):644-8. doi:10.1038/nature03369.

Aicher

Rolauffs

. The spatial organisation of joint surface chondrocytes: review of its potential roles in tissue functioning, disease and early, preclinical diagnosis of osteoarthritis. Ann Rheum Dis. 2014;73(4):645-53. doi:10.1136/annrheumdis-2013-204308.

Hunter

Bierma-Zeinstra

. Osteoarthritis. Lancet. 2019;393(10182):1745-59. doi:10.1016/S0140-6736(19)30417-9.

Roemer

Kwoh

Hayashi

Felson

Guermazi

. The role of radiography and MRI for eligibility assessment in DMOAD trials of knee OA. Nat Rev Rheumatol. 2018;14(6):372-80. doi:10.1038/s41584-018-0010-z.

van Lieshout

WAM

Valkering

Koenraadt

KLM

van Etten-Jamaludin

Kerkhoffs

GMMJ

van Geenen

RCI

. The negative effect of joint line elevation after total knee arthroplasty on outcome. Knee Surg Sports Traumatol Arthrosc. 2019;27(5):1477-86. doi:10.1007/s00167-018-5099-8.

Ambros

. The functions of animal microRNAs. Nature. 2004;431(7006):350-5. doi:10.1038/nature02871.

Miyaki

Asahara

. Macro view of microRNA function in osteoarthritis. Nat Rev Rheumatol. 2012;8(9):543-52. doi:10.1038/nrrheum.2012.128.

Goldring

Marcu

. Epigenomic and microRNA-mediated regulation in cartilage development, homeostasis, and osteoarthritis. Trends Mol Med. 2012;18(2):109-18. doi:10.1016/j.molmed.2011.11.005.

Zeng

Liu

Zhou

Chen

Cheng

, et al. Intra-articular injection of microRNA-140 (miRNA-140) alleviates osteoarthritis (OA) progression by modulating extracellular matrix (ECM) homeostasis in rats. Osteoarthritis Cartilage. 2017;25(10):1698-707. doi:10.1016/j.joca.2017.06.002.

10.

Rao

Huo

Fan

Qiu

Zhu

, et al. MicroRNAs and long non-coding RNAs in cartilage homeostasis and osteoarthritis. Front Cell Dev Biol. 2022;10:1092776. doi:10.3389/fcell.2022.1092776.

11.

Zhu

Zhang

Ding

Zou

. Non-coding RNAs as regulators of autophagy in chondrocytes: mechanisms and implications for osteoarthritis. Ageing Res Rev. 2024;99:102404. doi:10.1016/j.arr.2024.102404.

12.

Fan

Geng

. miR-708-5p promotes fibroblast-like synoviocytes’ cell apoptosis and ameliorates rheumatoid arthritis by the inhibition of Wnt3a/β-catenin pathway. Drug Des Devel Ther. 2018;12:3439-47. doi:10.2147/dddt.S177128.

13.

Wang

Tang

Tian

Lin

, et al. Microfracture technique combined with mesenchymal stem cells inducer represses miR-708-5p to target special at-rich sequence-binding protein 2 to drive cartilage repair and regeneration in rabbit knee osteoarthritis. Growth Factors. 2023;41(3):115-29. doi:10.1080/08977194.2023.2227269.

14.

Zhang

Huo

Yang

, et al. miR-708-5p deficiency involves the degeneration of mandibular condylar chondrocytes via the TLR4/NF-κB pathway. Osteoarthritis Cartilage. 2024;32(6):666-79. doi:10.1016/j.joca.2024.02.007.

15.

Kapoor

Martel-Pelletier

Lajeunesse

Pelletier

Fahmi

. Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nat Rev Rheumatol. 2011;7(1):33-42. doi:10.1038/nrrheum.2010.196.

16.

Kerkhof

Doherty

Arden

Abramson

Attur

Bos

, et al. Large-scale meta-analysis of interleukin-1 beta and interleukin-1 receptor antagonist polymorphisms on risk of radiographic hip and knee osteoarthritis and severity of knee osteoarthritis. Osteoarthritis Cartilage. 2011;19(3):265-71. doi:10.1016/j.joca.2010.12.003.

17.

Han

Park

Han

. Inhibition of NADPH oxidases prevents the development of osteoarthritis. Antioxidants (Basel). 2022;11(12):2346. doi:10.3390/antiox11122346.

18.

Del Carlo

Jr Loeser

. Nitric oxide-mediated chondrocyte cell death requires the generation of additional reactive oxygen species. Arthritis Rheum. 2002;46(2):394-403. doi:10.1002/art.10056.

19.

Drevet

Gavazzi

Grange

Dupuy

Lardy

. Reactive oxygen species and NADPH oxidase 4 involvement in osteoarthritis. Experimental Gerontology. 2018;111:107-17. doi:10.1016/j.exger.2018.07.007.

20.

Martin

Andriamanalijaona

Mathy-Hartert

Henrotin

Pujol

. Comparative effects of IL-1beta and hydrogen peroxide (H2O2) on catabolic and anabolic gene expression in juvenile bovine chondrocytes. Osteoarthritis Cartilage. 2005;13(10):915-24. doi:10.1016/j.joca.2005.03.009.

21.

Renaudin

Oudina

Gerbaix

McGilligan Subilia

Paccaud

Jaquet

, et al. NADPH oxidase 4 deficiency attenuates experimental osteoarthritis in mice. RMD Open. 2023;9(1):e002856. doi:10.1136/rmdopen-2022-002856.

22.

Zhao

Zhang

Xie

Dai

Zhang

. Gene expression profiles analyzed using integrating RNA sequencing, and microarray reveals increased inflammatory response, proliferation, and osteoclastogenesis in pigmented villonodular synovitis. Front Immunol. 2021;12:665442. doi:10.3389/fimmu.2021.665442.

23.

Ntoumou

Tzetis

Braoudaki

Lambrou

Poulou

Malizos

, et al. Serum microRNA array analysis identifies miR-140-3p, miR-33b-3p and miR-671-3p as potential osteoarthritis biomarkers involved in metabolic processes. Clin Epigenetics. 2017;9:127. doi:10.1186/s13148-017-0428-1.

24.

Liu

Tseng

Tsai

Huang

. Transforming growth factor beta-interacting factor-induced malignant progression of hepatocellular carcinoma cells depends on superoxide production from Nox4. Free Radic Biol Med. 2015;84:54-64. doi:10.1016/j.freeradbiomed.2015.03.028.

25.

Yang

Yue

Fang

Liu

. MicroRNA-708 is downregulated in hepatocellular carcinoma and suppresses tumor invasion and migration. Biomed Pharmacother. 2015;73:154-9. doi:10.1016/j.biopha.2015.05.010.

26.

Chevalier

Eymard

Richette

. Biologic agents in osteoarthritis: hopes and disappointments. Nat Rev Rheumatol. 2013;9(7):400-10. doi:10.1038/nrrheum.2013.44.

27.

Yudoh

Nguyen

Nakamura

Hongo-Masuko

Kato

Nishioka

. Potential involvement of oxidative stress in cartilage senescence and development of osteoarthritis: oxidative stress induces chondrocyte telomere instability and downregulation of chondrocyte function. Arthritis Res Ther. 2005;7(2):R380-R391. doi:10.1186/ar1499.

28.

Nugent

. MicroRNAs: exploring new horizons in osteoarthritis. Osteoarthritis Cartilage. 2016;24(4):573-80. doi:10.1016/j.joca.2015.10.018.

29.

Han

. Osteoarthritis year in review 2022: biology. Osteoarthritis Cartilage. 2022;30(12):1575-82. doi:10.1016/j.joca.2022.09.003.

30.

Iliopoulos

Malizos

Oikonomou

Tsezou

. Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks. PLoS ONE. 2008;3(11):e3740. doi:10.1371/journal.pone.0003740.

31.

Ito

Matsuzaki

Ayabe

Mokuda

Kurimoto

Matsushima

, et al. Both microRNA-455-5p and -3p repress hypoxia-inducible factor-2alpha expression and coordinately regulate cartilage homeostasis. Nat Commun. 2021;12(1):4148. doi:10.1038/s41467-021-24460-7.

32.

Liu

Huang

Dang

Zhang

, et al. Exosomal transfer of osteoclast-derived miRNAs to chondrocytes contributes to osteoarthritis progression. Nat Aging. 2021;1(4):368-84. doi:10.1038/s43587-021-00050-6.

33.

Wang

, et al. miR-708-5p Regulates Myoblast Proliferation and Differentiation. Vet Sci. 2022;9(11):641. doi:10.3390/vetsci9110641.

34.

Zhang

Cui

Zhu

Liu

. miR-708 inhibits MC3T3-E1 cells against H(2)O(2)-induced apoptosis through targeting PTEN. J Orthop Surg Res. 2020;15(1):255. doi:10.1186/s13018-020-01780-w.

35.

Yang

Wei

Wang

Guo

Lee

, et al. Metformin induces ER stress-dependent apoptosis through miR-708-5p/NNAT pathway in prostate cancer. Oncogenesis. 2015;4(6):e158. doi:10.1038/oncsis.2015.18.

36.

Zhang

Wang

Xuan

. MiR-708 affords protective efficacy in anoxia/reoxygenation-stimulated cardiomyocytes by blocking the TLR4 signaling via targeting HMGB1. Mol Cell Probes. 2020;54:101653. doi:10.1016/j.mcp.2020.101653.

37.

Pang

Chien

Kao

Chiu

Chen

Hsu

, et al. MicroRNA-708 emerges as a potential candidate to target undruggable NRAS. PLoS ONE. 2023;18(4):e0284744. doi:10.1371/journal.pone.0284744.

38.

Liu

Fang

Dong

Zhang

Leach

, et al. MicroRNA-708-5p acts as a therapeutic agent against metastatic lung cancer. Oncotarget. 2016;7(3):2417-32. doi:10.18632/oncotarget.6594.

39.

Jiang

Zhou

, et al. Nesfatin-1 suppresses interleukin-1beta-induced inflammation, apoptosis, and cartilage matrix destruction in chondrocytes and ameliorates osteoarthritis in rats. Aging (Albany NY). 2020;12(2):1760-77. doi:10.18632/aging.102711.

40.

Rousset

Hazane-Puch

Pinosa

Nguyen

Grange

Soldini

, et al. IL-1beta mediates MMP secretion and IL-1beta neosynthesis via upregulation of p22(phox) and NOX4 activity in human articular chondrocytes. Osteoarthritis Cartilage. 2015;23(11):1972-80. doi:10.1016/j.joca.2015.02.167.

41.

Huang

Cai

Peng

Shen

. Glucocorticoids induce apoptosis and matrix metalloproteinase-13 expression in chondrocytes through the NOX4/ROS/p38 MAPK pathway. J Steroid Biochem Mol Biol. 2018;181:52-62. doi:10.1016/j.jsbmb.2018.03.001.

42.

Yang

. Oleic/palmitate induces apoptosis in human articular chondrocytes via upregulation of NOX4 expression and ROS production. Ann Clin Lab Sci. 2016;46(4):353-9.

43.

Lorenz

Schäfer

Bauer

Jenei-Lanzl

Springorum

Grässel

. Norepinephrine modulates osteoarthritic chondrocyte metabolism and inflammatory responses. Osteoarthritis Cartilage. 2016;24(2):325-34. doi:10.1016/j.joca.2015.08.007.

44.

Liu

Chen

Zhang

Yang

, et al. MicroRNA-708 prevents ethanol-induced hepatic lipid accumulation and inflammatory reaction via direct targeting ZEB1. Life Sciences. 2020;258:118147. doi:10.1016/j.lfs.2020.118147.

45.

Liang

Huang

Wen

. CircFKBP5 suppresses apoptosis and inflammation and promotes osteogenic differentiation. Int Dent J. 2023;73(3):377-86. doi:10.1016/j.identj.2022.08.001.

46.

Yao

Tao

Gong

Chen

, et al. Osteoarthritis: pathogenic signaling pathways and therapeutic targets. Signal Transduct Target Ther. 2023;8(1):56. doi:10.1038/s41392-023-01330-w.

47.

Han

Fang

Tan

Jiang

Gong

Wang

, et al. The emerging role of fibroblast-like synoviocytes-mediated synovitis in osteoarthritis: an update. J Cell Mol Med. 2020;24(17):9518-32. doi:10.1111/jcmm.15669.

48.

Chen

Dou

Dong

. Microenvironment in subchondral bone: predominant regulator for the treatment of osteoarthritis. Ann Rheum Dis. 2021;80(4):413-22. doi:10.1136/annrheumdis-2020-218089.

49.

Hao

Yang

Shen

Liu

, et al. MiR-708 promotes steroid-induced osteonecrosis of femoral head, suppresses osteogenic differentiation by targeting SMAD3. Sci Rep. 2016;6:22599. doi:10.1038/srep22599.

50.

Wang

Feng

Huang

Zhao

Wang

, et al. Synergistic effects of miR-708-5p and miR-708-3p accelerate the progression of osteoporosis. J Int Med Res. 2020;48(12):300060520978015. doi:10.1177/0300060520978015.

51.

Johannes

Lucchino

. Current challenges in delivery and cytosolic translocation of therapeutic RNAs. Nucleic Acid Ther. 2018;28(3):178-93. doi:10.1089/nat.2017.0716.

52.

Thakore

Delany

. miRNA-based regulation in growth plate cartilage: mechanisms, targets, and therapeutic potential. Front Endocrinol (Lausanne). 2025;16:1530374. doi:10.3389/fendo.2025.1530374.

53.

Tian

Cheng

Liang

Lei

Qin

, et al. MicroRNA therapeutic delivery strategies: a review. J Drug Deliv Sci Technol. 2024;93:105430. doi:10.1016/j.jddst.2024.105430.

54.

Huang

Shan

Yang

Song

Xie

, et al. Intra-articular injection of lornoxicam and MicroRNA-140 co-loaded cationic liposomes enhanced the therapeutic treatment of experimental osteoarthritis. AAPS Pharmscitech. 2021;23(1):9. doi:10.1208/s12249-021-02149-w.

55.

Zhao

Zhang

Jia

Song

Sun

Meng

, et al. (p)NNS-conjugated chitosan mediated IGF-1 and miR-140 overexpression in articular chondrocytes improves cartilage repair. Biomed Res Int. 2019;2019:2761241. doi:10.1155/2019/2761241.