Watermelon Flower Petal-derived Apigenin Exhibits Anti-inflammatory Effects by Suppressing M1 Macrophage Polarization in Lipopolysaccharide/Interferon-gamma-co-stimulated RAW264.7 Cells

Abstract

Background

Watermelon fruits contain various bioactive compounds. However, the bioactivity of watermelon flower petals, specifically in the context of the anti-inflammatory effects, remains unknown.

Objectives

In this study, we aimed to evaluate the effects of watermelon flower petal-derived components on nitric oxide (NO) production and elucidate the mechanisms underlying this process in murine macrophage RAW264.7 cells that were co-stimulated with lipopolysaccharide (LPS) and interferon-gamma (IFNγ).

Materials and methods

Phenolic compounds (specifically p-hydroxybenzoic acid, protocatechuic acid, apigenin, and rhoifolin) were first isolated from watermelon flower petals. NO production was assessed using a Griess reagent kit. The mRNA expression of Nos2, Cox2, Tnfα, Il6, and Cd80 was determined using quantitative real-time polymerase chain reaction. The protein expression levels of the following molecules were assessed using western blotting: inducible NO synthase (iNOS); cyclooxygenase-2; heme oxygenase-1; toll-like receptor 4; phosphorylated-extracellular signal-regulated kinase (p-ERK); ERK; p-p38; p38; p-Jun amino terminal kinase (p-JNK); JNK; p-nuclear factor-kappa B (p-NF-κB); NF-κB; p-signal transducer and activator of transcription 1 (p-STAT1); and STAT1. Furthermore, the nuclear translocation of NF-κB was observed using fluorescence microscopy.

Results

NO production was suppressed in LPS/IFNγ-co-stimulated RAW264.7 cells treated with apigenin. Additionally, iNOS mRNA and protein expression were reduced in LPS/IFNγ-co-stimulated RAW264.7 cells. Apigenin resulted in a slight reduction in the levels of phosphorylated p38, JNK, and STAT1; on the other hand, phosphorylation and nuclear translocation of NF-κB remaining unchanged in the LPS/IFNγ-co-stimulated RAW264.7 cells. mRNA expression of Cd80, a notable cell surface M1 macrophage marker, was suppressed by apigenin in LPS/IFNγ-co-stimulated RAW264.7 cells.

Conclusion

Apigenin was found to suppress M1 macrophage polarization in LPS/IFNγ-co-stimulated RAW264.7 cells. The study findings suggest that watermelon flower petals represent a promising and valuable source of anti-inflammatory agents.

Keywords

watermelon flower petal apigenin anti-inflammatory M1 polarization RAW264.7 cell

Introduction

Inflammation is one of the initial immune responses; it can be pathogenic or physiochemically driven. The inflammatory process is closely involved in the activation of several immune cells, including macrophages, lymphocytes, and neutrophils, which interact with tissues to maintain host homeostasis by effectively removing foreign substances and repairing tissues.^1,2 Macrophages drive inflammation through the production of nitric oxide (NO).^3,4 However, NO overproduction is detrimental to the body and can trigger the development of pathologies such as rheumatoid arthritis, gastritis, bowel inflammation, and neuronal cell death.^5–8

Various signaling pathways are involved in the process of NO production via toll-like receptors (TLRs) present on the plasma membrane.^9,10 In humans, 10 types of TLRs have been identified. These TLRs recognize different pathogen-associated molecular patterns.^9,10 Specifically, TLR2 forms heterodimers with TLR1 and TLR6, and recognizes lipoproteins that are a component of lipoteichoic acid and peptidoglycan in the cell wall of gram-positive bacteria. While TLR3 recognizes virus-derived double-stranded RNA (dsRNA), TLR4 recognizes lipopolysaccharide (LPS), which is a component of the outer cell membrane of gram-negative bacteria. Activated TLRs recognize the ligands and bind to myeloid differentiation factor 88, which is an adapter molecule.¹¹ Subsequently, transcription factors such as activator protein 1 and nuclear factor-κB (NF-κB) are activated via the mitogen-activated protein kinase (MAPK) pathway, after which NO and inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, and IL-6 are released.¹²

Moreover, macrophages can polarize into different functional states, mainly M1 (pro-inflammatory) and M2 (anti-inflammatory). LPS, interferon-γ (IFNγ), and granulocyte-macrophage colony-stimulating factor polarize macrophages to the M1 phenotype, which produce pro-inflammatory cytokines, such as TNF-α, IL-1β, IL-12, IL-18, IL-23, and reactive oxygen species.^13,14 M1 polarization is important in defense against bacterial infections; however, prolonged and excessive M1 polarization can lead to chronic inflammation and tissue damage, which are hallmarks of various inflammatory diseases, such as arthritis, atherosclerosis, and autoimmune disorders.¹⁵ Natural compounds that can inhibit the excessive production of NO, release of inflammatory cytokines, and M1 polarization can be beneficial in the development of drugs to treat various inflammatory diseases.^16,17

Watermelons (Citrullus lanatus) are consumed worldwide, with an estimated global production of approximately 1.01 × 10¹¹ tons in 2021.¹⁸ Watermelon fruits are a rich source of lycopene, citrulline, arginine, and γ-aminobutyric acid (GABA).^19–21 Lycopene shows potent scavenging activity against singlet oxygen, and its intake can help prevent lifestyle-related diseases and delay aging.²² Citrulline, a non-protein constituent amino acid, was first discovered in watermelon in 1930. This compound maintains blood flow by promoting NO production; NO triggers vasodilation, thus reducing blood pressure.^23,24 Arginine, a substrate of NO synthase (NOS), is involved in vasodilation via NO production, similar to citrulline.²⁵ GABA, a major inhibitory neurotransmitter in the brain, is abundant in the hypothalamus, which is considered the sympathetic nerve center. GABA performs various physiological functions, such as reducing blood pressure, improving mental stability, improving memory, preventing diabetes, and activating renal and hepatic functions.²⁶ Therefore, the daily consumption of watermelon, which contains these components, can significantly contribute to the maintenance and improvement of human health.

Cultivation methods for watermelon have been established based on the land and climatic conditions to produce a well-fertilized fruit crop. Generally, watermelon agricultural by-products, including leaves, side shoots, thinned-out young fruits, and flowers, are discarded during the growing period. We previously isolated the novel phenolic glycosides citrulluside H and citrulluside T from thinned-out young watermelon fruits and found that they attenuate ultraviolet B radiation-induced matrix metalloproteinase expression in human dermal fibroblasts.²⁷ Studies on the bioactive potential of watermelon flower petals are currently scarce. However, given that the flower petals of various plants have anti-inflammatory properties, it is reasonable to hypothesize that the same outcome could be observed in watermelon flower petals.^28–30 Therefore, we investigated the inhibitory effects of phenolic compounds (p-hydroxybenzoic acid, protocatechuic acid, apigenin, and rhoifolin) isolated from watermelon flower petals on LPS and interferon-γ (IFNγ)-co-stimulated NO production in murine macrophage RAW264.7 cells. In particular, though it is known that apigenin induces an anti-inflammatory effect by inhibiting the NF-κB signaling pathway, we have further confirmed that apigenin inhibits LPS/IFNγ-co-induced polarization into M1 macrophages.^31,32 Here, we examined the molecular mechanisms underlying the inhibitory effect of apigenin on LPS/IFNγ-co-stimulated inflammation.

Materials and Methods

Phenolic Compounds Isolated from Watermelon Flower Petals

All solvents were purchased from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan) and used without further purification. ¹H and ¹³C NMR spectra were recorded in a JEOL ECX-400-P spectrometer (JEOL Ltd, Tokyo, Japan). EIMS spectra were obtained using a JEOL JMS-400 mass spectrometer (JEOL Ltd). Silica gel column chromatography (CC) was performed on silica gel 60N (Wakogel, 38-100 μm, FUJIFILM Wako Pure Chemical Corporation). Thin-layer chromatography spots on plates pre-coated with silica gel 70F₂₅₄ were detected using a UV lamp (254 nm).

The EtOH extract of watermelon flower petals was concentrated to 1 L and was partitioned with n-hexane and then EtOAc. The EtOAc fraction (30 g) was separated using SiO₂ column chromatography (CC) via stepwise mobile phase gradient elution (CHCl₃ → CHCl₃/EtOAc = 1/1 → EtOAc/MeOH = 10/1 → 5/1 →5/2 → 3/1), to give six sub-fractions. Repeated CC using SiO₂ (CHCl₃ → CHCl₃/MeOH = 50/1 → 20/1) and Sephadex LH-20 (MeOH) of sub-Fr. 1-2 afforded p-hydroxybenzoic acid (12 mg) and protocatechuic acid (34 mg). The sub-Fr. 1-3 was purified using SiO₂ CC (CHCl₃/MeOH = 20/1 → 10/1), to afford apigenin (23 mg). The sub-Fr. 1-5 was separated repeatedly using SiO₂ CC (CHCl₃/MeOH = 10/1 → Me₂CO/MeOH = 5/1) and Sephadex LH-20 CC (MeOH), to yield rhoifolin (18 mg).

Antibodies

Antibodies against inducible nitric oxide synthase (iNOS #2982, and #13120), cyclooxygenase-2 (COX-2 #4842), heme oxygenase-1 (HO-1 #5141), p44/42 MAPK (ERK #4695S), phospho-p44/42 MAPK (Thr202/Tyr204) (p-ERK #4370S), p38 MAPK (#9212S), phospho-p38 MAPK (Thr180/Tyr182) (p-p38 #4511S), SAPK/JNK (JNK #9252S), phospho-SAPK/JNK (Thr183/Tyr185) (p-JNK #9251S), NF-κB (#3034P), phospho-NF-κB (Ser536) (p-NF-κB #3033P), Stat1 (#9172), phospho-Stat1 (Tyr701) (p-Stat1 #9167), and Lamin B1 (#12586) were purchased from Cell Signaling Technology (Beverly, MA, USA). The antibody against β-actin (#0000093224) was purchased from Sigma-Aldrich (St. Louis, MO, USA). The antibody against TLR4 (76B357.1) was purchased from Novus Biologicals LLC. (Centennial, CO, USA).

Cell Culture

Murine macrophage RAW264.7 cells were purchased from the American Type Culture Collection (Manassas, VA, USA). The cells were cultured in Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA), penicillin (100 U/mL) and streptomycin (100 µg/mL) in a humidified atmosphere of 5% CO₂ at 37 °C.

Culture of Cutibacterium acnes

Cutibacterium acnes (NBRC 107605) was purchased from Biological Resource Center, National Institute of Technology and Evaluation (Kisarazu, Chiba, Japan). C. acnes was cultured in Gifu anaerobic medium (GAM, Shimadzu Diagnostics Corporation, Tokyo, Japan) under anaerobic conditions using Anaero Pack (Mitsubishi Gas Chemical Co. Inc., Tokyo, Japan) at 37 °C. The culture was incubated until the optical density at 600 nm reached approximately 2.0 (corresponding to approximately 1 × 10⁶ colony forming units/mL, logarithmic growth phase).

Preparation of Heat-killed C. acnes Powder

C. acnes was cultured in GAM under anaerobic conditions using Anaero Pack at 37 °C for 48 h, harvested via centrifugation at 3000×g for 20 min, and then washed twice with sterilized phosphate-buffered saline (PBS; 0.85% NaCl, 2.86 mM KCl, 10 mM Na₂HPO₄, and 1.76 mM KH₂PO₄ at pH 7.7). After washing, the cells were heat-killed at 121 °C for 15 min in an autoclave (BS-325, Tomy Seiko Co. Ltd, Tokyo, Japan) and then freeze-dried (FDS-1000, Tokyo Rikakikai Co. Ltd, Tokyo, Japan) to yield a powder (hk-C. acnes). This hk-C. acnes powder was suspended in sterile PBS to form a concentration of 200 mg/mL.

Cell Treatment and Measurement of NO Production

RAW264.7 cells (2 × 10⁵ cells/well) were seeded into a 24-well plate and cultured for 24 h. After incubation for 24 h, the cells were pre-treated with isolated phenolic compounds for 2 h, after which the cells were co-stimulated with or without LPS (final concentration, 200 ng/mL; Sigma-Aldrich) and IFNγ (final concentration, 25 ng/mL; Merck, Darmstadt, Germany). Subsequently, the culture media were collected and a Griess reagent kit (Promega, Madison, WI, USA) was used to measure the amount of nitrite, a stable metabolite of NO, in the supernatants. Briefly, 50 µL of each culture media was added to a 96-well plate in triplicate, and then 50 µL of sulfanilamide solution was dispensed. After incubation at 25 °C for 10 min, absorbance was measured at 540 nm using a colorimetric microplate reader (Varioskan LUX, Thermo Fisher Scientific).

Western Blotting

RAW264.7 cells were seeded into a 6-well plate (2 × 10⁵ cells/well) and cultured for 24 h. After incubation for 24 h, the cells were pre-treated with apigenin for 2 h and then co-stimulated with LPS/IFNγ. Whole-cell extracts were prepared by lysing cells in radioimmunoassay precipitation buffer (25 mM Tris-HCl (pH7.6), 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% sodium dodecyl sulfate [SDS]) containing a 2% complete protease inhibitor cocktail and 2% phosphatase inhibitor cocktail (Roche, Penzberg, Germany). Sample proteins were separated using SDS-polyacrylamide gel electrophoresis and electroblotted onto polyvinylidene difluoride (PVDF) membranes (GE Healthcare UK Ltd, Buckinghamshire, UK). The PVDF membranes were then incubated with primary antibodies, followed by incubation with horseradish peroxidase-conjugated secondary antibodies. Immunolabeled proteins were detected using an ECL chemiluminescence kit (GE Healthcare, Piscataway, NJ, USA) and an iBright CL1500 Imaging System (Thermo Fisher Scientific).

Quantitative Real-time Polymerase Chain Reaction

Total RNA was extracted from each group of cells using TRIzol reagent (Life technologies, Carlsbad, CA, USA), followed by DNase Ⅰ treatment. cDNA was synthesized from total RNA using a High Capacity RNA-to-cDNA kit (Life technologies). Reverse transcription-quantitative polymerase chain reaction (PCR) was performed using a StepOne Real-Time PCR system (Life technologies). Primers for inducible NOS (Nos2), cyclooxtgenase-2 (Cox2), Tnfα, Il6, Cd80, and glyceraldehyde 3-phosphate dehydrogenase (Gapdh) were purchased from Takara Bio Inc. (Ohtsu, Shiga, Japan) (Table 1). The PCR reaction comprised 45 cycles (95 °C for 10 s and 60 °C for 40 s) after an initial denaturation step (95 °C for 10 min). The expression level of each gene was determined using the comparative Ct method and normalized to that of Gapdh, which was used as an internal control.

Table 1.

Primers Used for Quantitative Real-time PCR.

Target gene	Primers
Target gene	Forward	Reverse
Nos2	5′ TAGGCAGAGATTGGAGGCCTTG-3′	5′ GGGTTGTTGCTGAACTTCCAGTC 3′
Cox2	5′ CTGGAACATGGACTCACTCAGTTTG· 3′	5′ AGGCCTTTGCCACTGCTTGTA· 3′
Tnfa	5′ AAGCCTGTAGCCCACGTCGTA· 3′	5′ GGCACCACTAGTTGGTTGTCTTTG· 3′
1/6	5′ CAACCATGATGGCACTTGCAGA· 3′	5′ CTCCAGGTAGCTATGGTACTCCAGA· 3′
Cd80	5′ AAGTTTCCATGTCCAAGGCTCA 3′	5′ TGTAACGGCAAGGCAGCAATA· 3′
Gopdh	5′ AAATGGTGAAGGTCGGTGTGAAC 3′	5′ CAACAATCTCCACTTTGCCACTG· 3′

Preparation of Cytoplasmic and Nuclear Proteins

Cytoplasmic and nuclear proteins were prepared using a Nuclear/Cytosol Fraction kit (Abcam, Cambridge, UK) according to the manufacturer's instructions. RAW264.7 cells were seeded into a 6-well plate (2 × 10⁵ cells/well) and cultured for 24 h. After incubation for 24 h, the cells were pre-treated with apigenin for 2 h and then co-stimulated with LPS/IFNγ. The apigenin-treated cells were scraped and harvested using centrifugation at 3000×g for 5 min. Cytosolic extracts were prepared using a cytoplasmic protein extraction agent. The pellet was resuspended in a nuclear protein extraction agent to obtain the nuclear extracts.

Fluorescence Microscopy

To detect the effect of apigenin on the nuclear translocation of NF-κB protein, the Image-iT Fixation/Permeabilization Kit (Thermo Fisher Scientific) and Alexa Fluor 488-conjugated NF-κB antibodies (Cell Signaling Technology) were used to determine the position of the NF-κB protein in RAW264.7 cells. Cells were seeded into a 35-mm dish (2 × 10⁵ cells/well) (AGC TECHNO GLASS Co., Ltd, Shizuoka, Japan) and pre-cultured for 24 h. After incubation, the cells were treated with apigenin (20 µM) for 2 h and then co-stimulated with LPS/IFNγ. The cells were washed with PBS(-) three times and fixed with a fixative solution (Image-iT) at 25 °C for 15 min. The fixed cells were permeabilized with permeabilization solution (Image-iT) for 15 min and blocked with a blocking solution (Image-iT) for 1 h at 25 °C. The cells were then incubated with Alexa fluor 488-conjugated primary anti-NF-κB monoclonal antibodies at 25 °C for 30 min in the dark. After incubation, Hoechest33342 was added for staining at 25 °C for 30 min in the dark. The cells were observed using fluorescence microscopy (BZ-X800, Keyence Co., Ltd, Osaka, Japan) with an excitation wavelength of 395 nm for Hoechest33342 and 470 nm for Alexa488.

Statistical Analysis

All data were analyzed using the Mac statistical analysis software package for Macintosh, version 2.0 (Esumi Co., Tokyo, Japan). All data were expressed as the mean ± standard error. Statistical analyses were performed using the Tukey-Kramer test with statistical significance set at P values < .05.

Results

Isolation of Phenolic Compounds

The EtOH extract of watermelon flower petals was separated using SiO₂ and Sephadex LH-20 CC, to yield p-hydroxybenzoic acid, protocatechuic acid, apigenin, and rhoifolin (Figure 1). The resultant phenolic compounds were identified using MS and NMR techniques. The purity of all the isolated compounds was confirmed to be 95% or higher using a UPLC-MS system (Aquity HPLC Xevo QTof, Waters Co., Milford, MA, USA).

Figure 1.

Chemical structure of phenolic compounds isolated from watermelon flower petals.

p-Hydroxybenzoic acid: ¹H NMR (400 MHz, acetone-d₆): δ 7.90 (2H, d, J = 8.7 Hz, H-2 and H-6), 6.90 (2H, d, J = 8.7 Hz, H-3 and H-5); ¹³CNMR (100 MHz, acetone-d₆): δ 166.8, 161.8, 131.9, 121.8, 115.2.

Protocatechuic acid: ¹H NMR (400 MHz, acetone-d₆): δ 7.50 (1H, d, J = 2.3 Hz, H-2), 7.44 (1H, dd, J = 8.2 and 2.3 Hz, H-6), 6.86 (1H, d, J = 8.2 Hz, H-5); ¹³CNMR (100 MHz, acetone-d₆): δ 166.8, 149.9, 144.8, 122.7, 122.6, 116.7, 114.9.

Apigenin: ¹H NMR (400 MHz, acetone-d₆): δ 7.92 (2H, d, J = 8.7 Hz, H-2′ and H-6′), 7.00 (2H, d, J = 8.7 Hz, H-3′ and H-5′), 6.61 (1H, s, H-3), 6.51 (1H, d, J = 1.8 Hz, H-8), 6.22 (1H, d, J = 1.8 Hz, H-6); ¹³CNMR (100 MHz, acetone-d₆): δ 182.3, 164.0, 163.9, 162.6, 161.0, 158.0, 128.5, 122.5, 116.0, 104.3, 103.3, 98.9, 93.9. EIMS: 252 [M-H₂O]⁺.

Rhoifolin: ¹H NMR (400 MHz, CD₃OD): δ 7.82 (2H, d, J = 8.7 Hz, H-2′ and H-6′), 6.88 (2H, d, J = 8.7 Hz, H-3′ and H-5′), 6.72 (1H, d, J = 1.8 Hz, H-8), 6.60 (1H, s, H-3), 6.39 (1H, d, J = 1.8 Hz, H-6), 5.27 (1H, d, J = 1.4 Hz, H-1″′ of Rham), 5.16 (1H, d, J = 7.8 Hz, H-1″ of Glc), 3.98-3.88 (3H, m, sugars), 3.72-3.35 (7H, m, sugars), 1.30 (3H, d, J = 6.4 Hz, Me of Rham); ¹³CNMR (100 MHz, CD₃OD): δ 182.6, 165.4, 163.0, 161.5, 157.6, 128.3, 115.8, 105.7, 102.7, 101.2, 99.6, 98.4, 94.5, 77.7, 77.6, 76.9, 72.6, 70.8, 70.0, 68.7, 61.1, 16.9.

Apigenin Suppressed NO Production

NO production is triggered by LPS/IFNγ stimulation in macrophages, which induces the expression of a series of inflammatory cytokines and mediators.^3,4 Therefore, we investigated the effect of the watermelon flower petal-derived phenolic compounds on NO production in LPS/IFNγ-co-stimulated RAW264.7 cells. NO production increased by 8 times by LPS/IFNγ-co-stimulation in RAW264.7 cells. Apigenin treatment at a final concentration of 10 μM suppressed the increased NO production by LPS/IFNγ-co-stimulation by 69.6%, and the inhibitory effect was in a dose-dependent manner. However, no suppressive effect was observed for the other three compounds (Figure 2). NO production increased by 26 times by hk-C. acnes-stimulation in RAW264.7 cells (Supplementary Figure S1). The NO production is stimulated by hk-C. acnes was suppressed by all the test compounds at a final concentration of 10 μM (inhibition rate, p-hydroxybenzoic acid; 39.9%, protocatechuic acid; 30.3%, apigenin; 61.1%, and rhoifolin; 33.8%). Apigenin exhibited the strongest inhibitory effect. This outcome of dsRNA-stimulated NO production was similar to that observed with the LPS/IFNγ-co-stimulation, with suppression only observed under apigenin treatment. Overall, apigenin significantly suppressed NO production increased by either LPS/IFNγ-co-stimulation or dsRNA-stimulation.

Figure 2.

Apigenin suppressed NO production in LPS/IFNγ-co-stimulated RAW264.7 cells. RAW264.7 cells were pre-treated with apigenin and other phenolic compounds (10-50 µM, 1; p-Hydroxybenzoic acid, 2; Protocatechuic acid, 3; Apigenin, 4; Rhoifolin) for 2 h. The cells were then stimulated with or without LPS (200 ng/mL)/IFNγ (25 ng/mL) for 24 h. The level of nitrite in cell culture media were measured. Data are expressed as the mean ± standard error (n = 8). Asterisks indicate statistical significance as determined by the Student's t-test (#P < .05, vs Control group, *P < .05 and **P < .01, vs LPS/IFNγ-co-stimulated RAW264.7 cells with no phenolic compounds treatment). NO, nitric oxide; LPS, lipopolysaccharide; IFNγ, interferon-gamma.

Apigenin Suppressed the Expression of the iNOS Gene and Protein

iNOS and COX-2 are responsible for the production of NO and prostaglandin E₂, which are important inflammatory enzymes.^33,34 To determine the association between the inhibitory effect of apigenin on LPS/IFNγ-co-stimulated NO production and the expression of inflammatory enzymes in RAW264.7 cells, we investigated the mRNA and protein expression of iNOS and COX-2. Apigenin downregulated Nos2 only (Figure 3A), suggesting that the attenuation of LPS/IFNγ-co-stimulated NO production requires Nos2 expression to be suppressed. In contrast, the mRNA and protein expression of COX-2 was not suppressed under apigenin treatment in LPS/IFNγ-co-stimulated RAW264.7 cells (Figure 3B).

Figure 3.

Apigenin suppressed the expression of the iNOS gene and protein in LPS/IFNγ-co-stimulated RAW264.7 cells. (A) Nos2 and Cox2 expression levels were determined in apigenin-treated RAW264.7 cells (10 µM) using reverse transcription-quantitative polymerase chain reaction (mean ± standard error., n = 6). Gapdh was used as an internal control. The data were tested for significant differences using the Tukey-Kramer method, with different alphabets indicating significant differences of P < .05. (B) Western blot analysis of lysates of cells treated with apigenin (10 µM) using antibodies specific for iNOS, COX-2, and β-actin (control). A representative blot from two independent experiments is shown. The expression levels of iNOS, and COX-2 were normalized to that of β-actin and were represented as the fold-change relative to that in RAW264.7 cells. Statistical analysis was performed using the Tukey-Kramer test. LPS, lipopolysaccharide; IFNγ, interferon-gamma; Nos2/iNOS, inducible nitric oxide synthase; Cox2/COX-2, cyclooxygenase 2; Gapdh, glyceraldehyde-3-phosphate dehydrogenase.

Apigenin Treatment did not Affect the mRNA Expression of pro-Inflammatory Cytokines

Pro-inflammatory cytokines play an important role in host survival following infection and repair of tissue injury.^35,36 To evaluate the inhibitory effect of apigenin on pro-inflammatory cytokine mRNA expression, we determined the mRNA expression levels of Tnfα and Il6. Apigenin did not affect the expression of either Tnfα or Il6 in LPS/IFNγ-co-stimulated RAW264.7 cells (Figure 4).

Figure 4.

Apigenin did not affect the gene expression of inflammatory cytokines in LPS/IFNγ-co-stimulated RAW264.7 cells. Tnfα and Il6 expression levels in apigenin-treated RAW264.7 cells (10 µM) were determined using reverse transcription-quantitative polymerase chain reaction (mean ± standard error, n = 6). Gapdh was used as an internal control. The data were tested for significant differences using the Tukey-Kramer method, with different alphabets indicating significant differences of P < .01. LPS, lipopolysaccharide; IFNγ, interferon-gamma; Tnfα, tumor necrosis factor-alpha; Il6, interleukin-6; Gapdh, glyceraldehyde-3-phosphate dehydrogenase.

Apigenin Slightly Suppressed LPS/IFNγ-co-Stimulated Signal Transduction

LPS is a component of the outer cell membrane of gram-negative bacteria that binds to TLR4. Subsequently, macrophages activate intracellular inflammatory signaling pathways such as MAPK, NF-κB, and Janus kinase/signal transducer and activator of transcription (STAT) and promote the production of NO and proinflammatory cytokines.^37–39 To determine the inhibitory effect of apigenin on inflammatory signaling pathways, we evaluated the activation of various signaling molecules involved in NO production via western blotting. The levels of phosphorylated extracellular signal-regulated kinase (ERK) and NF-κB were not affected by apigenin after LPS/IFNγ co-stimulation in RAW264.7 cells (Figure 5). p38, c-Jun N-terminal kinase (JNK), and STAT1 activation were detected at 5-60 min after LPS/IFNγ-co-stimulation in RAW264.7 cells. Apigenin slightly decreased the levels of phosphorylated p38 at 5-15 min after LPS/IFNγ co-stimulation. JNK and STAT1 activation was slightly suppressed by apigenin at 5-60 min after LPS/IFNγ co-stimulation.

Figure 5.

Apigenin slightly suppressed the early signal transduction events in LPS/IFNγ-co-stimulated RAW264.7 cells. The cells were treated with apigenin (10 µM) prior to LPS/IFNγ-co-stimulation. Cell lysates were harvested at the indicated times (0-60 min) after LPS/IFNγ-co-stimulation and used in western blot analysis for detection of phosphorylated and total ERK, p38, JNK, NF-κB, and STAT1 proteins. A representative blot from two independent experiments is shown. The ratio of phosphorylated-to-total protein for each protein was calculated and normalized to the levels of β-actin; and it was represented as the fold-change relative to that in RAW264.7 cells at 0 min. LPS, lipopolysaccharide; IFNγ, interferon-gamma; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; NF-κB, nuclear factor-kappa B; STAT1, signal transducer and activator of transcription 1.

Apigenin did not Affect the NF-κB Signaling Pathway

The NF-κB signaling pathway plays a crucial role in various inflammatory diseases.⁴⁰ Apigenin modulates NF-κB activity via inactivation of the inhibitor of NF-κB kinase (IKK) complex in LPS-stimulated RAW264.7 cells.^31,32 Based on western blotting, the levels of phosphorylated NF-κB were not affected by apigenin after LPS/IFNγ co-stimulation in RAW264.7 cells. As our findings were incongruent with those of previous studies, we further investigated the inhibitory effect of apigenin on the nuclear translocation of NF-κB in LPS/IFNγ-co-stimulated RAW264.7 cells based on western blotting and immunocytochemistry. Western blotting results indicated that while the co-stimulation of LPS/IFNγ increased the nuclear NF-κB level and decreased the cytosolic NF-κB level, apigenin did not affect these NF-κB levels (Figure 6A). Immunocytochemistry results indicated that nuclear NF-κB staining (green) was increased by LPS/IFNγ co-stimulation compared to that of non-stimulated cells, whereas the nuclear NF-κB staining (green) remained unchanged after apigenin treatment (Figure 6B).

Figure 6.

Apigenin did not affect the nuclear translocation of NF-κB in LPS/IFNγ-co-stimulated RAW264.7 cells. (A) The cells were pre-treated with or without apigenin (20 µM) for 2 h and then stimulated with LPS/IFNγ for 2 h. The cytosolic and nuclear fractions were analyzed for detection of NF-κB via western blot analysis. A representative blot from three independent experiments is shown. The expression levels of nuclear and cytosolic NF-κB were normalized to that of Lamin B1 and β-actin, respectively; and those were represented as the fold-change relative to that in RAW264.7 cells. Statistical analysis was performed using the Tukey-Kramer test. (B) The cells were pre-treated with or without apigenin (20 µM) for 2 h and then stimulated with LPS/IFNγ for 12 h. NF-κB was detected by Alexa Fluor 488-conjugated NF-κB antibody staining (green), and the nucleus was stained using Hoechest33342 (blue). LPS, lipopolysaccharide; IFNγ, interferon-gamma; NF-κB, nuclear factor-kappa B.

Apigenin Suppressed the mRNA Expression of an M1 Macrophage Marker

We investigated whether apigenin inhibited the polarization into M1 macrophages, which have pro-inflammatory properties. The mRNA expression of Cd80, which is a cell surface marker of M1 macrophages, was increased by LPS/IFNγ-co-stimulation and subsequently suppressed by apigenin treatment in RAW264.7 cells (Figure 7).

Figure 7.

Apigenin suppressed the expression of M1 macrophage marker gene in LPS/IFNγ-co-stimulated RAW264.7 cells. Cd80 expression level in apigenin-treated RAW264.7 cells (10 µM) was determined using reverse transcription-quantitative polymerase chain reaction (mean ± standard error, n = 6). Gapdh was used as an internal control. The data were tested for significant differences using the Tukey-Kramer method, with different alphabets indicating significant differences of P < .05. LPS, lipopolysaccharide; IFNγ, interferon-gamma; Cd80, cluster of differentiation 80; Gapdh, glyceraldehyde-3-phosphate dehydrogenase.

Discussion

Our primary finding is that watermelon flower petal-derived apigenin suppressed NO production in LPS/IFNγ-co-stimulated RAW264.7 cells (Figure 2). Additionally, apigenin suppressed NO production in RAW264.7 cells stimulated with hk-C. acnes and dsRNA, demonstrating the anti-inflammatory effects against gram-negative bacteria as well as against gram-positive bacteria and viruses (Supplementary Figure S1).

NO is derived from the amino acid L-arginine via the enzymatic activity of iNOS in macrophages activated by inflammatory enzymes and cytokines.³ Here, we found that apigenin substantially suppressed iNOS mRNA and protein expression in LPS/IFNγ-co-stimulated cells. This outcome was consistent in cells stimulated with hk-C. acnes and dsRNA (Figure 3A, Supplementary Figure S2A). These findings suggest that apigenin enhances NO production by suppressing Nos2 expression and driving anti-inflammatory effects. Furthermore, the mRNA expression of Cox2, which is an inflammatory mediator, specifically the driver of prostaglandin E₂, was downregulated by apigenin in RAW264.7 cells solely stimulated with dsRNA (Figure 3B, Supplementary Figure S3A).

Apigenin is a flavone; thus, it has a structure similar to those of 3-OH flavone, baicalein, kaempferol, and quercetin. These flavonoids suppress iNOS protein expression and NO production by inducing heme oxygenase-1 (HO-1) in LPS-stimulated RAW264.7 cells.⁴¹ Our findings confirm that 2 h of pre-treatment with apigenin did not increase the HO-1 levels (Supplementary Figure S4). Additionally, we elucidated the mechanism by which apigenin suppresses TLR4-mediated LPS stimulation. Briefly, during iNOS expression, the transcription factors NF-κB, STAT, and interferon regulatory factor-1 (IRF-1) bind to the iNOS promoter region.^42–44 The NF-κB, JAK-STAT, and MAPK signaling pathways greatly contribute to transcription factor activation. Macrophages first recognize LPS via TLR4, followed by activation of the intracellular signal transduction system.⁹ After confirming the inhibitory role of apigenin in the context of the binding of LPS and TLR4 by binding to TLR4 (Supplementary Figure S5), we examined the levels of phosphorylated STAT1 in the JAK-STAT pathway; p38, JNK, and ERK in the MAPK pathway; and NF-κB in the NF-κB pathway; however, definitive effects were not found after apigenin treatment (Figure 5). Among them, NF-κB is important for the activation or inhibition of Nos2 gene expression.⁴⁵ Additionally, apigenin modulates NF-κB activity via inactivation of the IKK complex in LPS-stimulated RAW264.7 cells.^31,32 Western blots indicated that the levels of phosphorylated NF-κB were unaffected by apigenin treatment after LPS/IFNγ co-stimulation in RAW264.7 cells. As our findings are not congruent with those of previous studies, we further investigated the inhibitory effect of apigenin on the nuclear translocation of NF-κB in LPS/IFNγ-co-stimulated RAW264.7 cells using western blotting and immunocytochemistry. Both analyses confirmed that apigenin did not suppress the nuclear translocation of NF-κB in LPS/IFNγ co-stimulated RAW264.7 cells (Figure 6). Overall, no changes were observed in the intracellular signal transduction system and NF-κB nuclear translocation to support the anti-inflammatory effect of apigenin. The anti-inflammatory effects of apigenin in LPS-stimulated RAW264.7 cells have already been reported, and its mechanism of action includes 1) the suppression of pro-inflammatory cytokine production⁴⁶; 2) inhibition of NF-κB activation^31,32; and 3) inhibition of MAPK pathway.⁴⁷ Our results do not match those of any of the previous reports.

Macrophages exhibit plasticity and versatility, a trait that is clearly reflected in their ability to switch between phenotypes.⁴⁸ This phenotypic switching is context-specific, as it is dependent on the local microenvironmental stimuli of a specific tissue; these inter-tissue microenvironmental variations activate various signaling cascades, thus driving phenotypic switching. M1 macrophages, which are activated by bacterial components (eg, LPS and IFNγ) produced during infections, are involved in the elimination of pathogens. In contrast, M2 macrophages, which are induced by IL-4 and IL-13, modulate the inflammatory response and help repair tissues. A wide array of compounds has been implicated in driving anti-inflammatory effects, with their underlying mechanism being the suppression of M1 differentiation.^49–51 CD80, which is a cell surface M1 macrophage marker, is a co-stimulatory molecule expressed by antigen-presenting cells like macrophages. It interacts with CD28 and cytotoxic T lymphocyte antigen-4 present on T cells to regulate T cell activation and tolerance. CD80 expression is increased on activated macrophages, which then polarize into the M1 phenotype, and produce pro-inflammatory cytokines, and phagocytose pathogens. Apigenin suppressed Cd80 expression in LPS/IFNγ-co-stimulated RAW264.7 cells (Figure 7). We also found that apigenin suppressed the mRNA and protein expression of iNOS, an intracellular M1 macrophage marker. These results suggest that apigenin exerts an anti-inflammatory effect by suppressing M1 polarization of macrophages; however, the detailed mechanism remains unclear. All three, IRF, STAT, and suppressor of cytokine signaling, play a role in shifting macrophage function towards either the M1 or M2 phenotype.^48,52 The IRF/STAT pathway activated by IFN and TLR signaling polarizes macrophages to an M1 activation state via STAT1.⁴⁸ In this study, apigenin treatment also slightly decreased the phosphorylation level of STAT1 in LPS/IFNγ-co-stimulated RAW264.7 cells. A role for Bruton's tyrosine kinase (Btk) in macrophage polarization in response to LPS stimulation has also been suggested. The lack of Btk promoted macrophage polarization towards the M2 phenotype, suggesting that Btk plays an important role in M1 polarization.⁵³ We plan to investigate the mechanism by which apigenin suppresses M1 polarization in the future.

In conclusion, watermelon flower petal-derived apigenin drove an anti-inflammatory response by suppressing M1 macrophage polarization in LPS/IFNγ-co-stimulated RAW264.7 cells. To the best of our knowledge, this is the first study reporting the anti-inflammatory effect of watermelon flower petals. Based on these findings, watermelon flower petals, which normally represent waste in the context of cultivation, could be used as a sustainable source of anti-inflammatory drugs from our in vivo study. However, deletion of IL-12a decreases the survival rate of LPS-treated mice, exacerbates cardiac dysfunction and myocardial injury, which are well-known complications of sepsis, and polarizes macrophages to the M1 phenotype.⁵⁴ Furthermore, IL-34 upregulation contributes to macrophage polarization and recruitment, leading to cardiac remodeling and heart failure after ischemia/reperfusion.⁵⁵ Inhibition of transient receptor potential ankyrin 1 suppresses M2 macrophage polarization and ameliorates cardiac fibrosis.⁵⁶ Ghosh et al also reported that machine learning identifies signatures of macrophage reactivity and tolerance that predict disease outcomes.⁵⁷ Based on the results of these previous studies using LPS-induces mouse models or machine learning analysis, it is important to test the safety of apigenin in terms of drug utilization in the future, as overregulation of macrophage polarization may increase the risk of cardiac disease and sepsis.

Supplemental Material

sj-pptx-1-npx-10.1177_1934578X251315323 - Supplemental material for Watermelon Flower Petal-derived Apigenin Exhibits Anti-inflammatory Effects by Suppressing M1 Macrophage Polarization in Lipopolysaccharide/Interferon-gamma-co-stimulated RAW264.7 Cells

Supplemental material, sj-pptx-1-npx-10.1177_1934578X251315323 for Watermelon Flower Petal-derived Apigenin Exhibits Anti-inflammatory Effects by Suppressing M1 Macrophage Polarization in Lipopolysaccharide/Interferon-gamma-co-stimulated RAW264.7 Cells by Shingo Fujita, Akiho Yamaguchi, Masayuki Ninomiya, Mamoru Koketsu, Toshiharu Hashizume and Tomohiro Itoh in Natural Product Communications

Supplemental Material

sj-docx-2-npx-10.1177_1934578X251315323 - Supplemental material for Watermelon Flower Petal-derived Apigenin Exhibits Anti-inflammatory Effects by Suppressing M1 Macrophage Polarization in Lipopolysaccharide/Interferon-gamma-co-stimulated RAW264.7 Cells

Supplemental material, sj-docx-2-npx-10.1177_1934578X251315323 for Watermelon Flower Petal-derived Apigenin Exhibits Anti-inflammatory Effects by Suppressing M1 Macrophage Polarization in Lipopolysaccharide/Interferon-gamma-co-stimulated RAW264.7 Cells by Shingo Fujita, Akiho Yamaguchi, Masayuki Ninomiya, Mamoru Koketsu, Toshiharu Hashizume and Tomohiro Itoh in Natural Product Communications

Footnotes

Acknowledgements

Not applicable.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethical Approval

Ethical approval is not applicable for this article.

Funding

The authors received no financial support for the research, authorship, and/or publication of this article.

ORCID iDs

Shingo Fujita

Tomohiro Itoh

Statement of Human and Animal Rights

This article does not contain any studies with human or animal subjects.

Statement of Informed Consent

There are no human subjects in this article and informed consent is not applicable.

Supplemental Material

Supplemental material for this article is available online.

References

Chaplin

. Overview of the immune response. J Allergy Clin Immunol. 2010;125(2):S3-S23.

Medzhitov

Janeway

. Innate immunity: impact on the adaptive immune response. Curr Opin Immunol. 1997;9(1):4-9.

Bogdan

. Nitric oxide and the immune response. Nat Immunol. 2001;2(10):907-916.

Bogdan

. Nitric oxide and the regulation of gene expression. Trends Cell Biol. 2001;11(2):66-75.

Nagy

Koncz

Telarico

, et al. Central role of nitric oxide in the pathogenesis of rheumatoid arthritis and systemic lupus erythematosus. Arthritis Res Ther. 2010;12(3):210. doi:https://doi.org/10.1186/ar3045.

Touati

Michel

Thiberge

, et al. Chronic Helicobacter pylori infections induce gastric mutations in mice. Gastroenterology. 2003;124(5):1408-1419.

Kolios

Valatas

Ward

. Nitric oxide in inflammatory bowel disease: a universal messenger in an unsolved puzzle. Immunology. 2004;113(4):427-437.

Murphy

. Nitric oxide and cell death. Biochim Biophys Acta. 1999;1411(2-3):401-414.

Moresco

EMY

LaVine

Beutler

. Toll-like receptors. Curr Biol. 2011;21(13):R488-R493. doi:https://doi.org/10.1016/j.cub.2011.05.039.

10.

Kawai

Akira

. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity. 2011;34(5):637-650. doi:https://doi.org/10.1016/j.immuni.2011.05.006.

11.

O’Neill

LAJ

Fitzgerald

Bowie

. The toll-IL-1 receptor adaptor family grows to five members. Trends Immunol. 2003;24(6):286-289.

12.

Kawai

Akira

. The role of pattern-recognition receptors in innate immunity: update on toll-like receptors. Nat Immunol. 2010;11(5):373-384.

13.

Rendra

Riabov

Mossel

, et al. Reactive oxygen species (ROS) in macrophage activation and function in diabetes. Immunobiology. 2019;224(2):242-253.

14.

Arango Duque

Descoteaux

. Macrophage cytokines: involvement in immunity and infectious diseases. Front Immunol. 2014;5:491. doi:https://doi.org/10.3389/fimmu.2014.00491.

15.

Labonte

Tosello-Trampont

Hahn

. The role of macrophage polarization in infectious and inflammatory diseases. Mol Cells. 2014;37(4):275-285.

16.

Cragg

Newman

. Natural products: a continuing source of novel drug leads. Biochim Biophys Acta. 2013;1830(6):3670-3695.

17.

Saqib

Sarkar

Suk

, et al. Phytochemicals as modulators of M1-M2 macrophages in inflammation. Oncotarget. 2018;9(25):17937-17950.

18.

Food and Agriculture Organization of the United Nations (FAO) home page. 27 Dec. 2023. FAO. 11 Jan. 2024. https://www.fao.org/faostat/en/#data/QCL.

19.

Perkins-Veazie

Collins

Davis

Roberts

. Carotenoid content of 50 watermelon cultivars. J Agric Food Chem. 2006;54(7):2593-2597.

20.

Hartman

Wehner

Perkins-Veazie

. Citrulline and arginine content of taxa of Cucurbitaceae. Horticulturae. 2019;5(1). doi:https://doi.org/10.3390/horticulturae5010022.

21.

Osawa

Fujita

Inakuma

. γ-aminobutyric acid (GABA) content in watermelon (Citrullus lanatus) fruits. Food Preserv Sci. 2022;48(5):235-238.

22.

Inakuma

. Study of carotenoid activity in vegetables: application to food development. Nippon Shokuhin Kagaku Kogaku Kaishi. 2015;62(6):263-273.

23.

Orozco-Gutiérrez

Castillo-Martínez

Orea-Tejeda

, et al. Effect of L-arginine or L-citrulline oral supplementation on blood pressure and right ventricular function in heart failure patients with preserved ejection fraction. Cardiol J. 2010;17(6):612-618.

24.

Figueroa

Wong

Jaime

Gonzales

. Influence of L-citrulline and watermelon supplementation on vascular function and exercise performance. Curr Opin Clin Nutr Metab Care. 2017;20(1):92-98.

25.

Hayashi

. The role of L-arginine and L-citrulline on atherosclerosis. Seikagaku. 2014;86(3):352-359.

26.

Watanabe

Maemura

Kanbara

Tamayama

Hayasaki

. GABA and GABA receptors in the central nervous system and other organs. Int Rev Cytol. 2002;213:1-47. doi:https://doi.org/10.1016/s0074-7696(02)13011-7.

27.

Itoh

Fujita

Koketsu

Hashizume

. Citrulluside H and citrulluside T from young watermelon fruit attenuate ultraviolet B radiation-induced matrix metalloproteinase expression through the scavenging of generated reactive oxygen species in human dermal fibroblasts. Photodermatol Photoimmunol Photomed. 2021;37(5):386-394.

28.

Zhao

Aisa

. Anti-inflammatory effect of pomegranate flower in lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Pharm Biol. 2017;55(1):2095-2101.

29.

Tursun

Zhao

Alat

, et al. Anti-inflammatory effect of Rosa rugosa flower extract in lipopolysaccharide-stimulated RAW264.7 macrophages. Biomol Ther (Seoul). 2016;24(2):184-190.

30.

Hou

, et al. Anti-inflammatory effects of chemical components from Ginkgo biloba L. male flowers on lipopolysaccharide-stimulated RAW264.7 macrophages. Phytother Res. 2019;33(4):989-997.

31.

Liang

Huang

Tsai

, et al. Suppression of inducible cyclooxygenase and inducible nitric oxide synthase by apigenin and related flavonoids in mouse macrophages. Carcinogenesis. 1999;20(10):1945-1952.

32.

Singh

Sahoo

Agrahari

, et al. Anti-inflammatory, anti-proliferative and anti-psoriatic potential of apigenin in RAW264.7 cells, HaCaT cells and psoriasis like dermatitis in BALB/c mice. Life Sci. 2023;328:121909. doi:https://doi.org/10.1016/j.lfs.2023.121909.

33.

Marletta

. Nitric oxide synthase structure and mechanism. J Biol Chem. 1993;268(17):12231-12234.

34.

Turini

DuBois

. Cyclooxygenase-2: a therapeutic target. Annu Rev Med. 2002;53:35-57. doi:https://doi.org/10.1146/annurev.med.53.082901.103952.

35.

Goldfeld

Doyle

Maniatis

. Human tumor necrosis factor alpha gene regulation by virus and lipopolysaccharide. Proc Natl Acad Sci U S A. 1990;87(24):9769-9773.

36.

Libermann

Baltimore

. Activation of interleukin-6 gene expression through the NF-κB transcription factor. Mol Cell Biol. 1990;10(5):2327-2334.

37.

Kaminska

. MAPK signalling pathways as molecular targets for anti-inflammatory therapy-from molecular mechanisms to therapeutic benefits. Biochim Biophys Acta. 2005;1754(1-2):253-262.

38.

Sun

. The non-canonical NF-κB pathway in immunity and inflammation. Nat Rev Immunol. 2017;17(9):545-558.

39.

Banerjee

Biehl

Gadina

, et al. JAK-STAT signaling as a target for inflammatory and autoimmune diseases: current and future prospects. Drugs. 2017;77(5):521-546.

40.

Yamamoto

Gaynor

RB.

Therapeutic potential of inhibition of the NF-κB pathway in the treatment of inflammation and cancer. J Clin Invest. 2001;107(2):135-142.

41.

Lin

Juan

Shen

, et al. Inhibition of lipopolysaccharide-induced nitric oxide production by flavonoids in RAW264.7 macrophages involves heme oxygenase-1. Biochem Pharmacol. 2003;66(9):1821-1832.

42.

Xie

Kashiwabara

Nathan

. Role of transcription factor NF-κB/Rel in induction of nitric oxide synthase. J Biol Chem. 1994;269(7):4705-4708.

43.

Darnell

Jr Kerr

Stark

GR.

Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science. 1994;264(5164):1415-1421.

44.

Fujita

Sakakibara

Sudo

, et al. Evidence for a nuclear factor(s), IRF-1, mediating induction and silencing properties to human IFN-β gene regulatory elements. EMBO J. 1988;7(11):3397-3405.

45.

Chu

Marks-Konczalik

Banks

Moss

. Analysis of the cytokine-stimulated human inducible nitric oxide synthase (iNOS) gene: characterization of differences between human and mouse iNOS promoters. Biochem Biophys Res Commun. 1998;248(3):871-878.

46.

Zhang

Wang

Gurley

Zhou

. Flavonoid apigenin inhibits lipopolysaccharide-induced inflammatory response through multiple mechanisms in macrophages. PLOS ONE. 2014;9(9):e107072. doi:https://doi.org/10.1371/journal.pone.0107072.

47.

Kim

Lee

. Apigenin reduces the toll-like receptor-4-dependent activation of NF-κB by suppressing the akt, mTOR, JNK, and p38-MAPK. Naunyn Schmiedebergs Arch Pharmacol. 2018;391(3):271-283.

48.

Wang

Liang

Zen

. Molecular mechanisms that influence the macrophage M1-M2 polarization balance. Front Immunol. 2014;5:614. doi.org/10.3389/fimmu.2014.00614.

49.

Guo

Song

, et al. ACT001 Suppressing M1 polarization against inflammation via NF-κB and STAT1 signaling pathways alleviates acute lung injury in mice. Int Immunopharmacol. 2022;110:108944. doi:https://doi.org/10.1016/j.intimp.2022.108944.

50.

Wang

Cao

, et al. Luteolin alters macrophage polarization to inhibit inflammation. Inflammation. 2020;43(1):95-108.

51.

Gong

Dong

, et al. Inhibitory effects of berberine on proinflammatory M1 macrophage polarization through interfering with the interaction between TLR4 and MyD88. BMC Complement Altern Med. 2019;19(1):314. doi:https://doi.org/10.1186/s12906-019-2710-6.

52.

Xie

Liu

, et al. Effects of IRF1 and IFN-β interaction on the M1 polarization of macrophages and its antitumor function. Int J Mol Med. 2016;38(1):148-160.

53.

Ní Gabhann

Hams

Smith

, et al. Btk regulates macrophage polarization in response to lipopolysaccharide. PLOS ONE. 2014;9(1):e85834. doi:https://doi.org/10.1371/journal.pone.0085834.

54.

Wang

Liu

, et al. Il12a deletion aggravates sepsis-induced cardiac dysfunction by regulating macrophage polarization. Front Pharmacol. 2021;12:632912. doi:https://doi.org/10.3389/fphar.2021.632912.

55.

Zhuang

Zong

Yang

Fan

Tao

. Interleukin-34-NF-κB signaling aggravates myocardial ischemic/reperfusion injury by facilitating macrophage recruitment and polarization. EBiomedicine. 2023;95:104744. doi:https://doi.org/10.1016/j.ebiom.2023.104744.

56.

Wang

, et al. TRPA1 Inhibition ameliorates pressure overload-induced cardiac hypertrophy and fibrosis in mice. EBiomedicine. 2018;36:54-62. doi:https://doi.org/10.1016/j.ebiom.2018.08.022.

57.

Ghosh

Sinha

Katkar

, et al. Machine learning identifies signatures of macrophage reactivity and tolerance that predict disease outcomes. EBiomedicine. 2023;94:104719. doi:https://doi.org/10.1016/j.ebiom.2023.104719.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.47 MB

2.72 MB