Luteolin-Zn Complex Inhibits Invasion and Migration of M2-Like TAMs via the Downregulation of AMPK/mTOR and PI3K/Akt/mTOR Signaling Pathway Under Hypoxia

Abstract

Purpose: The high mortality rate of malignant tumors is often attributable to the loss of surgical opportunities due to late diagnosis when invasion and metastasis have significantly affected the patient. A hypoxic microenvironment can promote the progression of malignant tumors. This study explored the invasion resistance and migration ability of luteolin-Zn complexes. Methods: We created a low-oxygen environment using a 3-atmosphere incubator. The appropriate drug concentration was determined using the CCK8 experiment. We determined its role in cell invasion and migration through scratch and transwell experiments. Western blotting, polymerase chain reaction, and cellular immunity experiments were used to study the mechanism and its impact on the secretion of invasion and migration factors. Results: Our results indicated that the luteolin-Zn complex significantly reduced MMP2, MMP9, N-Ca, and HIF-1ɑ expression. It also upregulated TIMP1 and E-Ca expression. Moreover, its capabilities may be achieved by regulating the AMPK/mTOR and PI3K/Akt/mTOR signaling pathways. Conclusions: The luteolin-Zn complex was highly resistant to the invasion and migration of M2-like tumor-related macrophages. This may exert a unique influence on mTOR by integrating various signals. This study suggests that the luteolin-Zn complex has a strong anticancer effect under hypoxic conditions.

Introduction

Malignant tumors are a leading threat to human health and a hypoxic microenvironment is the initiating factor in them. ¹ An increasing number of studies have demonstrated the importance of hypoxia in tumorigenesis and its development.^2,3 Therefore, the study of tumor treatment in a hypoxic microenvironment has clinical and scientific significance.

Tumor-associated macrophages can infiltrate tumor tissues, which have high plasticity and heterogeneity and can adjust their functional status with changes in the tumor microenvironment (TME). ⁴ By secreting immunosuppressive factors such as IL-10 and proteases such as matrix metalloproteinase-9 (MMP-9), M2-phenotypic TAMs can modify the state of the TME and then produce relevant effects on the tumor.^5,6 Based on this background, regulating M2-like TAMs is a critical strategy for tumor therapy.^7,8

Cell metastasis requires breaking through the basement membrane and the surrounding intercellular matrix. Matrix metalloproteinases (MMPs) are of enormous importance. ⁹ They are promoted by hydrolyzing matrix components and destroying the tissue barrier.^10,11 In the process of tumor development, epithelial-mesenchymal transformation also plays a crucial role. ¹² Studies have demonstrated that N-cadherin could transform the epithelial cell morphology into fibroblasts, increasing their vitality and invasiveness. This indicates that the stronger invasion and metastasis ability correlated with higher expression of N-cadherin in tumor cells. ¹³ Therefore, regulating MMP-2, MMP-9, and other epithelial-mesenchymal transition (EMT)-related factors can effectively inhibit tumor migration and invasion.

As a serine/threonine protease, the mammalian target of rapamycin (mTOR) is crucial for cell cycle regulation, differentiation, and cell growth.^14,15 Intervention of the mTOR pathway can regulate oncogene transformation, tumor growth, and angiogenesis. ¹⁶ The mTOR signaling pathway is thought to be involved in tumorigenesis and growth. Some studies have demonstrated that mTOR expression is significantly altered in cervical cancer, colon cancer, and other malignant tumors.^17,18 mTOR is the junction of multiple signaling pathways, primarily the classical phosphatidylinositol 3-hydroxy kinase (PI3K)/phosphorylated protein kinase B (Akt)- dependent and-independent pathway, where the upstream signal is transmitted and then integrated. ¹⁹ AMPK regulates mTOR via the PI3K/Akt independent pathway. ²⁰ Consequently, we hypothesized whether we could inhibit mTOR activity thus achieving an anti-tumor effect by simultaneously regulating the AMPK/mTOR and PI3K/Akt/mTOR signaling pathways.

Recent research on flavonoids and their metal complexes has aided in developing new high-efficiency and low-toxicity natural drugs.^21,22 Numerous pharmacological studies have revealed that flavonoids exert their pharmacological effects by combining with trace elements in the body. This synergistic effect can enhance biological and pharmacological activities and reduce their toxicity. Luteolin is a naturally occurring flavonoid with numerous biological and pharmacological properties. As an enzyme component, Zn considerably influences many metabolic processes. After preparing the luteolin-Zn complex, we studied its biological activity and explored its influence on the invasion and migration of tumor-related macrophages under hypoxia and its related mechanisms.

Materials and Methods

Reagents. Luteolin (CAS491-70-3) was purchased from Munster Biotechnology, Ltd. It was combined with Zn under specific conditions to produce the luteolin-Zn complex, which was dissolved in dimethyl sulfoxide before use in the following experiments. ²³ Fetal bovine serum (FBS) was obtained from Sigma-Aldrich (Merck, Darmstadt, Germany), DMEM from Gibco (Thermo Fisher Scientific), anti-MMP9 (no. A0289), anti-VEGF (no. A12303), anti-HIF-1ɑ (no. A11945), anti-MMP2 (no. A11144), anti-AKT1 (no. A11016), anti-p-AKT1 (no. AP0637), anti-mTOR (no. A11355), anti-p-mTOR (no. Ap0115), anti-PI3K (no. A4992), anti-p-PI3K (no. Ap0854), anti-AMPK (no. A11184), anti-p-AMPK (no. AP0871), anti-N-Ca (no. A19083), anti-E-Ca (no. A20798), anti-TIMP1 (no. A1389), and anti-β-actin (no. AC004) from Abclonal, and IL-4 from PeproTech EC Ltd.

Cell culture. The complete medium consisted of DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. The mouse macrophage line RAW264.7 was obtained from Procell Life Science & Technology Co., Ltd (CL-0190, Wuhan, China). When the cells occupied 80% of the culture bottle, we conducted cell passages and subsequent experiments.

Induced polarization. When the cell density in either the 6-hole plate or culture dish reached approximately 80%, we added IL-4 (10 ng/mL) to polarize it, which took approximately 2 h.

Cells are grouped and processed. The experiment was divided into 4 groups, designated as A to D. Group A was the control group. Group B consisted of cells that were induced to form M2-like TAMs by IL-4. The group consisted of cells rendered into M2-like TAMs by IL-4 supplemented with 40 μM of the Lu-Zn complex. Group D consisted of cells rendered into M2-like TAMs by IL-4 and supplemented with 80 μM Lu-Zn complex. All cells were placed in a hypoxic incubator with 1% O₂ for 24 h at 37 °C.

Cell viability assay. After cell delivery, the cells were placed into 96 well plates, at a density in each well of 1 × 10⁴. The culture medium was replaced with serum-free DMEM when the cell density reached approximately 80%. Simultaneously, Lu-Zn (20, 40, 60, 80, 100, 120, 160, or 200 µM) was added at different concentrations according to the experimental design. After incubation for 24 h, 10 µL of CCK8 solution was added to each well and incubated for 2 h. Finally, the absorbance of each well was evaluated at 450 nm.

Scratch test. First, the markers, rulers, and other essential experimental equipment were prepared on a sterile bench. The 6-pore plate was then marked horizontally with a marker pen based on 4 equal points of pore size. Following the aforementioned treatment, cells were collected, added to an appropriate amount of complete medium, suctioned using a disposable sterile straw to count the number of suspension cells, and placed in a labeled 6-pore plate at a cell density of approximately 5 × 10⁵ cells per pore. The 6-pore plate was then shaken thoroughly. When 80% to 90% of the 6-pore plate was covered with cells, a horizontal marking line and vertical segmentation line for each pore were made using an aseptic gun head with the help of a ruler. After the PBS was removed, images were taken under a microscope. After adding serum-free medium and the corresponding drug and incubating for 24 h, the cells were observed and photographed using a microscope.

Cell invasion and migration assays. The aperture of the transwell filter chamber was 8 µm. Before the invasion experiment, the Matrigel basement membrane matrix was paved in advance. The cells were collected in the logarithmic growth phase, and after centrifugation, they were blown with serum-free DMEM culture medium. Then, 100 µL DMEM culture medium containing cells was added to each Transwell chamber. In the migration and invasion experiments, the number of cells in each chamber was 5 × 10³ and 5 × 10⁴, respectively. After that, we added 600 µL of complete culture media to the lower chamber of Transwell. After adding the corresponding drug to the upper chamber, cells were placed in a hypoxic incubator for 24 h. The cells were then washed thrice with PSB and soaked in 4% paraformaldehyde. The sections were then stained with hematoxylin after washing and left for 20 min. After processing, we took pictures of each group under a microscope at 200× magnification and randomly selected 3 visual fields.

Reverse transcription-quantitative polymerase chain reaction. After processing the cells, we extracted them using the TRIzol reagent. Next, we used ABScript II cDNA First-Strand Synthesis Kit (RK20400, Abclonal.) to reverse transcript these samples. The expression levels of β-actin, MMP9, MMP2, E-Ca, N-Ca, VEGF, and TIMP1 were quantitatively analyzed using a Fast Start Universal SYBR Green Master Kit (ROX; no. 4913850001, Roche Diagnostics) on a 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The reaction was completed using the following temperature scheme: the first stage, 95 °C, 3 min; stage 2: 95 °C for 15 s, 60 °C for 1 min, 40 cycles; and stage 3: 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, and 60 °C for 15 s. We then used the 2-ΔΔCq method to evaluate the expression of target genes. The detailed information was ΔΔCq = (target gene of Cq experimental group, β-actin gene of Cq experimental group) − (target gene of QC control group, β-actin gene of QC control group). Primers were obtained from Jiangsu Synbio Technology Co., Ltd, China, and their sequences are presented in Table 1.

Table 1.

Sequence of Various Primers.

Gene	Sense (5′-3′)	Antisense (5′-3′)
MMP2	GCCAAGGTGGAAATCAGAGA	GTTGAAGGAAACGAGCGAAG
MMP9	AGACGACATAGACGGCATCC	TGGGACACATAGTGGGAGGT
TIMP1	TCTGGCATCCTCTTGTTG	GGTGGTCTCGTTGATTTCT
E-Ca	CAAGGACAGCCTTCTTTTCG	TGGACTTCAGCGTCACTTTG
N-Ca	ATCAAGTGCCATTAGCCAAG	CTGAGCAGTGAATGTTGTCA
VEGF	ACTTTCTGCTCTCTTGGGT	GACTTCTGCTCTCCTTCTGT
β-actin	GCAGAAGGAGATTACTGCTCT	GCTGATCCACATCTGCTGGAA

Western blot analysis. After processing, the cells were placed on ice, the culture solution was removed, and the cells were washed thrice with PBS. We then added cell lysates to each group consisting of 200 µL RIPA, 25 µL PMSF, and 2 µL phosphatase inhibitor. After a period of reaction, the samples were centrifuged, and the supernatant was extracted. A BCA kit (Abcam, RM00005) was used to detect the total protein concentration in each group. For electrophoresis, a 10% separation gel and a 5% gel were used. The conditions for the membrane transfer were 200 mA for 100 min. After membrane conversion, TBST with 5% skim milk was used to seal for 1.5 h. The washout was then repeated with TBST. After washing, we applied the PVDF membrane with the corresponding primary antibody solution and stored it at 4 °C overnight. Specific antibody concentrations: HIF-1ɑ, MMP2, MMP9, E-Ca, N-Ca, TIMP1, VEGF, AKT1, p-AKT1, PI3K, mTOR, p-mTOR, AMPK, p-AMPK, PI3K, and p-PI3K were all 1:1000, and the concentration of β-actin was 1:10000. On the second day, we washed the PVDF membrane 3 times with TBST and incubated the 2 antivenoms after washing. Finally, strip exposures (Abcam, RM00020) were carried out by adding ultra-sensitive photometric solutions.

Immunofluorescence staining. After processing, the cells were immobilized with paraformaldehyde. Subsequently, PBS was used for 3 washings. Then, 0.5% Triton X-100 was added to the solution for 20 min. After washing thrice with PBS, the sections were blocked with 5% goat serum for 1 h. After that, we stored them in dark rooms. The slides from each group were coated with the corresponding primary antibody and stored overnight at 4 °C. After washing, fluorescent secondary antibodies were added, and the cells were incubated for 1 h. After washing thrice with TBST, DAPI solution was added dropwise for 5 min. TBST was then washed 3 times, and the liquid on the cover glass was sucked dry with absorbent paper for the last time. At this time, we covered the glass slide with an anti-fluorescence quenching agent. Finally, we took pictures of each group under an inverted fluorescence microscope.

Statistical analysis. We used SPSS (26.0) software to process all data. Representative curves in the pictures are displayed as the mean ± standard deviation. To evaluate the differences between the groups, we used 1-way ANOVA. P < .05 was taken to mean that the difference between groups was statistically significant. All experiments were repeated 3 times.

Results

Luteolin-Zn Complex Demonstrated Cytotoxicity and Affected Cell Invasion and Migration Under Hypoxic Conditions

The cell survival rate depicted no significant decrease when the concentration of luteolin-Zn was 0 to 60 μM. However, there was a significant decrease at concentrations above 80 μM, and cytotoxicity was relatively high (Figure 1A). Therefore, concentrations of 40 and 80 μM were used in subsequent experiments. To assess the efficacy of luteolin and luteolin-Zn complex, we chose a concentration of 40 μM to detect their effect on HIF-1ɑ secretion. The results showed that Lu-Zn had a better antitumor effect than luteolin (Figure 1B). Group B contained significantly more migrating cells than Group A in the scratch test. The number of migrating cells in Groups C and D was substantially lower than that in Group B, indicating that Lu-Zn can effectively inhibit cell migration (Figure 1C). Group B was observed to have more invasive and migratory cells than Group A in the Transwell experiment, consistent with the characteristics of M2-like TAMs. Cell invasion and migration were significantly downregulated by the addition of Lu-Zn, indicating that Lu-Zn can effectively inhibit cell invasion and migration (Figure 1D-G).

Figure 1.

Toxicity assay of Lu-Zn and its effect on cell migration and invasion under hypoxia. (A) Effect of different concentrations of Lu-Zn on cell survival rate. (B) Effect of luteolin and luteolin-Zn at the same concentration on HIF-1ɑ secretion. (C) Photographs of each group at 0 and 24 h during scratch test. (D) Pictures of migration experiments in each group. (E) Pictures of invasion experiments in each group. (F-G) Cell count of each group in Transwell experiment.

Under Hypoxic Conditions, Lu-Zn Regulated Factors of Cell Invasion and Migration

As the hypoxic environment promoted invasion and migration, M2-like TAMs were better able to promote invasion and migration than macrophages. MMP2, MMP9, TIMP1, E-CA, N-Ca, VEGF, and HIF-1ɑ are all related to tumor cell invasion and migration. Western blotting and polymerase chain reaction (PCR) experiments demonstrated that MMP2, MMP9, N-Ca, VEGF, and HIF-1ɑ were significantly upregulated in the M2-like TAM group (Figure 2A-D, G-H, and K-M). However, their expression levels were significantly reduced after Lu-Zn treatment. Furthermore, the expression of TIMP1 and E-Ca significantly increased after treatment with Lu-Zn (Figure 2E-F and I-J). We also confirmed in the cell immunofluorescence experiment that Lu-Zn downregulated the levels of MMP2, MMP9, and HIF-1ɑ. In contrast, E-Ca levels were significantly increased, consistent with the PCR and Western blot results (Figure 3).

Figure 2.

Lu-Zn regulated cell invasion and migration under hypoxia. (A, C, E, G, I, K, and M) We used the Western blot method to detect protein levels in each group. These proteins are MMP2, MMP9, TIMP1, N-Ca, E-Ca, VEGF, and HIF-1, respectively. (B, D, F, H, and J) We used RT-qPCR to detect mRNA expression in each group. These genes are MMP2, MMP9, TIMP1, N-Ca, E-Ca, and VEGF.

Figure 3.

Effect of Lu-Zn on MMP2, MMP9, E-Ca, and HIF-1ɑ under hypoxia. The content and distribution of MMP2 (A), MMP9 (B), E-CA (C), and HIF-1ɑ (D) were detected by immunofluorescence.

Under Hypoxic Conditions, Lu-Zn Regulated AMPK/mTOR and PI3K/AKT/mTOR Signaling Pathways

Several studies have revealed that metformin has an inhibitory effect on breast cancer progression by putting it into a state of nutrient capture and chronic hypoxia, which may directly activate the AMPK-mTOR signaling pathway and indirectly activate the PI3K/AKT/mTOR signaling pathway. ²⁴ These signals are integrated by mTOR and coordinate with their downstream molecules to resist tumors. Therefore, we hypothesized that Lu-Zn might inhibit tumor cell invasion and migration by regulating the AMPK/mTOR and PI3K/AKT/mTOR signaling pathways. The results demonstrated that p-AKT, p-PI3K, and p-AMPK of these 2 pathways were regulated by Lu-Zn (Figure 4B, D, and F). Moreover, the expression of mTOR, the integration point of these 2 pathways, was significantly decreased in the presence or absence of phosphorylation (Figure 4G and H).

Figure 4.

Lu-Zn regulation of AMPK/mTOR and PI3K/AKT/mTOR signaling pathways under hypoxic conditions. (A-B) AKT and p-AKT1 protein expression levels in each group. (C-D) PI3K and p-PI3K protein expression levels in each group. (E-F) AMPK and p-AMPK proteins were analyzed by Western blotting. (G-H) mTOR and p-mTOR proteins were analyzed by Western blotting.

Discussion

According to the 2021 China Health Statistics Yearbook, the national cancer prevalence rate is 0.51%. Cancer is 1 of 3 deadly diseases in China. Despite the ability of tumors to continuously induce pro-angiogenesis, neovascular morphogenesis in tumor tissues is abnormal. The microvascular network is relatively inefficient in the transport of oxygen and nutrients. Moreover, rapidly proliferating tumor cells consume more oxygen than the capacity of the microvascular network, leading to hypoxia in the central region of the tumor, which is far from blood vessels. ²⁵ Hypoxic conditions cause a cascade of tumor changes, including increased glycolysis, which not only fuels the tumor but also mediates its tolerance to the hypoxic environment. These changes result in a decrease in apoptosis and necrosis and a significant increase in proliferation and migration. ² Hypoxia-inducible factors-1α are regulated by hypoxia and are highly expressed in hypoxic regions of tumor tissue, which correlates with the degree of the tumor's malignancy.^26,27 Studies demonstrated that HIF-1α is highly expressed in lung, gastric, colorectal, and esophageal cancers.^28–31 Hypoxia can induce the secretion of HIF-1α, as well as some pro-invasion and pro-migration molecules. If HIF-1α is knocked out in tumor-associated macrophages, its migration ability is reduced, while its cytotoxic activity is increased. ⁸ TAMs are essential in stimulating tumor formation, angiogenesis, invasion, and metastasis. ³² They promote cancer cell proliferation by producing growth factors. ³³ They also have proteolytic enzymes that digest the extracellular matrix to help tumor cells spread. They also provide support for distant metastasis of the tumor. ³⁴

Our results are consistent with these findings. The results of this study indicate that M2-like TAMs have high HIF-1ɑ expression and can promote the expression of pro-invasion and pro-migration factors, suggesting that M2-like TAMs play a major role in tumor initiation and progression and that regulating M2-like TAMs could be an effective strategy for tumor therapy.

MMPs are essential for tumor cell invasion and metastasis. ⁹ They play a major role in tumor cell-mediated extracellular matrix degradation, disruption of tissue barriers, and promotion of tumor cell invasion and metastasis by hydrolyzing matrix components. ¹⁰ Tumor cell infiltration and metastasis involve numerous processes, among which EMT is a critical step and is correlated with cancer invasion and metastasis. ¹²

The present study displayed that M2-like TAMs could highly express MMP2, MMP9, N-Ca, and other proteins, whereas its antagonist, TIMP1, depicted low expression. MMP2, MMP9, and N-Ca expressions were significantly reduced after adding Lu-Zn, whereas TIMP1 expression was increased. When the scratch test, transwell assay, Western blot, PCR, and immunofluorescence assay were used together, it was concluded that Lu-Zn repressed the invasion and migration of M2-like TAMs.

AMPK/mTOR and PI3K/AKT/mTOR signaling pathways are closely related to tumorigenesis.^35,36 Information transmitted by these 2 pathways and integrated by mTOR is critical for tumor growth promotion. It advances invasion and migration in cancer via phosphorylation cascades of several proteins. ³⁷ This study aimed to confirm whether Lu-Zn acts on AMPK/mTOR and PI3K/AKT/mTOR signaling pathways, resulting in biologically relevant activity in M2-like TAMs. We compared the levels of p-AMPK, p-PI3K, mTOR, p-mTOR, and p-AKT in each group. It has been shown that Lu-Zn modulates the secretion of p-AMPK, p-AKT, and p-PI3K. These factors inhibit the expression of mTOR and p-mTOR after integration, thereby inhibiting the invasion and migration of M2-like TAMs. In other words, cytokines produced by M2-like TAM promote tumor invasion and migration by activating these 2 signaling pathways.

Chinese herbal medicine is an essential component of Traditional Chinese Medicine. Many people worldwide have begun to focus on developing Chinese herbal medicine and exploring its mechanism of action to provide a scientific foundation for its use. Flavonoids, commonly found in wild medicinal plants, are active ingredients of natural medicinal plants and have various effects, such as anti-inflammatory, antioxidant, antibacterial, and anti-tumor.^38–41 Luteolin is present in most Chinese herbal medicines. Several studies have revealed that it can play an inhibitory role in tumors. ⁴² Micronutrient zinc (Zn) is a component of enzymes involved in many essential metabolic pathways in the body. As a derivative of luteolin, the luteolin-Zn complex has rarely been studied domestically and internationally. Our study found that the luteolin-zinc complex plays a crucial role in antitumor invasion and migration. Its powerful antitumor effect was also verified, providing a foundation for the subsequent development of derivatives.

Conclusions

The luteolin-Zn complex is highly resistant to the invasion and migration of M2-like tumor-related macrophages. It may exert distinct effects on mTOR by integrating various signals. This study suggests that luteolin-Zn complexes exert potent anticancer effects under hypoxic conditions. Our study provides a reference for future research on Chinese herbal compounds.