Abstract
Salvia miltiorrhiza Bge. (Danshen) is widely used to improve blood circulation and the dredge meridian in traditional Chinese medicine. In the present study, we evaluated the effects of dihydrotanshinone I (DHTS), a natural product from Danshen, on chronic high-fat feeding-induced cardiac remodeling and dysfunction. DHTS (25 mg/kg, intraperitoneal) did not affect blood glucose, insulin levels, and glucose intolerance. However, it alleviated diastolic dysfunction induced by the high-fat diet, as indicated by the increase in the ratio of peak early filling velocity to peak late filling velocity of the mitral and suppression of the extension of the isovolumic relaxation phase of the left ventricle. Further investigations revealed that DHTS ameliorated high-fat induced cardiac hypertrophy in mice and suppressed insulin-induced enlargement of cardiomyocytes in vitro. In neonatal cardiomyocytes, DHTS restored insulin-induced suppression of CCAAT/enhancer-binding protein beta-2 isoform (CEBPβ) and the phosphorylation of glycogen synthase kinase-3β (GSK3β) and extracellular signal-regulated kinase (ERK). Taken together, our results indicated that DHTS ameliorated cardiac hypertrophy and diastolic dysfunction in high-fat-fed mice, probably through the inhibition of insulin-induced suppression of CEBPβ and phosphorylation of GSK3β and ERK in cardiomyocytes.
Keywords
Introduction
Diabetes is the seventh leading cause of death worldwide. Cardiovascular diseases, including chronic heart failure, are the major life-threatening complications associated with diabetes. 1 Diabetic cardiomyopathy refers to cardiac hypertrophy, myocardial fibrosis, and other diabetes-induced pathological changes in heart in the absence of other cardiac risk factors, such as coronary artery disease and hypertension. 2 Type 2 diabetes (T2D) accounts for approximately 90% of diabetic cases. Unlike type 1 diabetes, which is caused by the loss of insulin production due to immune destruction of β cells, T2D is a metabolic disease characterized by insulin resistance, defined as a reduced sensitivity or responsiveness of target tissues (such as liver, muscle, and adipose tissue) to the action of insulin. 3 In order to maintain normoglycemia, β-cells secrete an increasing amount of insulin to compensate for insulin resistance, eventually leading to hyperinsulinemia, which has been suggested as an independent risk factor for chronic coronary heart disease. 4,5
Ectopic lipid accumulation has been recognized as a major cause of insulin resistance by interrupting insulin signaling transduction in insulin’s target tissues such as the liver, muscle, and adipose tissue. 6 In the heart, excess fatty acids can induce the accumulation of lipid intermediates such as ceramide and diacylglycerol. These lipid intermediates may cause lipotoxicity, which induces cardiomyocyte apoptosis and contractile dysfunction. 7 In addition, it has been shown that diabetic individuals were associated with increased fatty acid oxidation in the heart, leading to the elevation of reactive oxygen species (ROS) production. 8 Increased ROS production can result in cardiomyocyte apoptosis, cardiac hypertrophy, and fibrosis. 8
Danshen, the root of Salvia miltiorrhiza Bge., is used for promoting blood circulation and dredging meridians in traditional Chinese medicine. The extract of Danshen has been reported to have various effects on cardiovascular diseases, including cardioprotective and therapeutic effects on atherosclerosis, angina, and coronary heart disease. 9 The cardioprotective effects of Danshen may result from its components, including tanshinone IIa, 10 cryptotanshinone, 11 tanshinone VI, 12 danshensu, 13 salvianolic acid A, 14 and salvianolic acid B. 15 It has been shown in dogs 10 and rats 16 that tanshinone IIa ameliorates cardiac infarction induced by left anterior descending artery ligation through suppression of inflammation. Moreover, dihydrotanshinone I (DHTS), which is one of the major lipid-soluble constituents of Danshen, 17 has been shown to possess an anti-atherosclerosis effect in ApoE−/− mice. 18 However, its effect on diabetic cardiomyopathy has not yet been reported in the literature.
In the present study, we evaluated the effects of DHTS on diabetic cardiomyopathy in mice. The effects of DHTS on diabetes were assessed by measuring blood glucose, insulin levels, and the glucose tolerance test. Echocardiography was used to evaluate cardiac function. Cardiac hypertrophy and fibrosis were evaluated by histological analysis. The effects and underlying mechanism of DHTS were further investigated in isolated neonatal cardiomyocytes.
Results
Effects of DHTS on Diabetes
A high-fat diet is commonly used for inducing obesity and diet-induced metabolic diseases in animals. Our results showed that high-fat feeding led to significant increases in body weight and blood glucose levels in mice compared with chow diet (Figure 1(A) and (B)). Besides, a trend for an increase in plasma insulin levels was observed in high-fat-fed mice (Figure 1(C)). As shown in Figure 1(D), high-fat feeding also induced glucose intolerance, which is an indication of T2D. However, the administration of DHTS did not improve the above characteristics of T2D in mice.

DHTS had no effect on body weight and hyperglycemia in mice. CH group was fed CH diet for 38 weeks; HF group was fed 60% HF diet for 38 weeks; DHTS group was fed 60% HF diet for 38 weeks with DHTS injection (25 mg/kg) every 2 days for the last 6 weeks (HF + D). (A) Body weight was measured at the end of the study. (B) Blood glucose was tested by using a glucometer. (C) Plasma insulin level was measured using an enzyme-linked immunosorbent assay kit. (D) Glucose tolerance test (1.5 g/kg body weight) was performed on week 37 by intraperitoneal injection; n = 9 for CH, n = 6 for HF and HF + D group. *P < 0.05, **P < 0.01 versus CH. CH, chow; DHTS, dihydrotanshinone I; HF, high fat; HF + D, high fat + dihydrotanshinone I.
Effects of DHTS on Cardiac Function
Diabetic cardiomyopathy is characterized by diastolic dysfunction in its early stage. 8 In the present study, we assessed cardiac systolic and diastolic functions in mice by using echocardiography (Table 1). High-fat feeding did not induce systolic dysfunction as indicated by a constant ejection fraction and fractional shortening (Figure 2(A-C)). Moreover, systolic function did not change after the administration of DHTS. However, the end-diastolic posterior wall thickness (PWD) and estimated left ventricular mass were significantly increased by the high-fat diet, suggesting cardiac hypertrophy (Figure 2(D) and (E)). These 2 parameters were lower in the DHTS group compared with the high-fat group, indicating that DHTS may ameliorate high-fat induced cardiac hypertrophy. Color Doppler was used to assess the diastolic function in mice. High-fat feeding significantly decreased the ratio of peak early filling velocity (E) to peak late filling velocity (A) of the mitral and DHTS rescued the E/A ratio of high-fat mice (Figure 3(A) and (B)). The isovolumic relaxation time (IVRT) of the left ventricle (LV) was extended by high-fat feeding, and DHTS reduced the IVRT of high-fat mice (Figure 3(C)). These results indicated that DHTS ameliorated LV diastolic dysfunction induced by high-fat feeding.
Echocardiographic Analysis of Left Ventricular Function in Mice.
Abbreviations: CH, chow; HF, high fat; HF + D, high fat + dihydrotanshinone I; IVS d, intact ventricular septum end diastole; IVS s, intact ventricular septum end systole; LVID d, left ventricular internal diameter end diastole; LVID s, left ventricular internal diameter end systole; LVPW s, left ventricular posterior wall end diastole; LV Vol d, left ventricular volume end diastole; LV Vol s, left ventricular volume end systole.
Note. n = 9 for CH, n = 6 for HF and HF + D group. *P < 0.05 versus CH, **P < 0.01 versus CH.

HF diet and dihydrotanshinone I did not affect systolic cardiac function in mice. The systolic function of mice was assessed at the end of the study by using M-mode echocardiography. (A) Representative images of M-mode imaging on short axis; (B) ejection fraction; (C) fractional shortening; (D) estimated LV mass; and (E) the end-diastolic posterior wall thickness. n = 9 for CH, n = 6 for HF and HF +D group. * P < 0.05, ** P < 0.01 versus CH, # P < 0.05 indicated group. CH, chow; HF, high fat; HF + D, HF diet and dihydrotanshinone I; LV, left ventricle.

Dihydrotanshinone I ameliorated high-fat induced diastolic dysfunction. The diastolic function of mice was assessed at the end of the study by using Color Doppler echocardiography. (A) Representative echocardiography images from pulse-wave. (B) E/A ratio. (C) The ratio of IVRT and AET. n = 9 for CH, n = 6 for HF and HF + D group. * P < 0.05, ** P < 0.01 versus CH, # P < 0.05 indicated group. AET, aortic ejection time; CH, chow; E/A, ratio of early and late velocity of blood flow in the left ventricle; HF, high fat; HF + D, high fat + dihydrotanshinone I; IVRT, isovolumic relaxation time.
Effects of DHTS on Cardiac Hypertrophy
Diabetic cardiomyopathy is commonly associated with cardiac hypertrophy and fibrosis. 1 Hematoxylin and eosin (H&E) staining showed that the cross-section of heart and cardiomyocytes of high-fat mice were larger than that in mice fed with normal chow (Figure 4(A)). Moreover, the high-fat diet increased the heart weight of mice (Figure 4(B)). DHTS reduced the heart weight and cardiomyocytes cross-sectional area of high-fat mice. These results suggested that DHTS ameliorated high-fat induced cardiac hypertrophy. Furthermore, the gene expression of atrial natriuretic peptide (ANP), β-myosin heavy chain (β-MHC), and brain natriuretic peptide (BNP) were detected by quantitative polymerase chain reaction (qPCR) (Figure 4(C)). A significant increase of β-MHC and a trend for an increase in ANP expression were observed in the high-fat group, while DHTS reduced the expression of β-MHC and ANP. There was no significant change in BNP expression in either the high-fat or DHTS group compared with the chow group. We further measured cardiac fibrosis and apoptosis by Sirius Red and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining, respectively (Figure 5). No obvious fibrosis and apoptosis were detected in the high-fat group. This indicated that even though our model was induced by 8 months of high-fat feeding, it was at an early stage of diabetic cardiomyopathy and, therefore, could be used to assess the effect of DHTS on cardiac hypertrophy but not cardiac fibrosis and apoptosis (Figure 4).

Dihydrotanshinone I ameliorated high-fat induced cardiac hypertrophy. Cardiac hypertrophy was assessed at the end of the study by using histological analysis and qPCR. (A) Representative hematoxylin and eosin staining of heart sections, n = 3-6/group. (B) The heart weight of mice. (C) The relative expression levels of ANP, β-MHC, and BNP by qPCR, n = 9 for CH, n = 6 for HF and HF + D group. *P < 0.05 versus CH, #P < .05 indicated group. ANP, atrial natriuretic peptide, BNP, brain natriuretic peptide; β-MHC, β-myosin heavy chain; CH, chow; HF, high fat; HF + D, high fat + dihydrotanshinone I; qPCR, quantitative real-time polymerase chain reaction.

HF diet and dihydrotanshinone I did not induce a significant effect on cardiac fibrosis and apoptosis. Representative images of Sirius Red staining for the detection of fibrosis and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining for the detection of apoptosis. CH, chow; HF, high fat; HF + D, high fat + dihydrotanshinone I.
Effects of DHTS on Cardiomyocyte Hypertrophy in Isolated Cardiomyocytes
Our results indicated that DHTS ameliorated cardiac hypertrophy, independently of the blood glucose and insulin levels. This suggested that DHTS might have a direct effect on the heart. Therefore, we isolated cardiomyocytes from neonatal rats and examined the effect of DHTS on cardiomyocytes in vitro. The toxicity of DHTS on isolated cardiomyocytes was tested using a cell counting kit (CCK)-8 assay (Figure 6(B)). Our data indicated that DHTS did not induce obvious cell death at a concentration of ≤0.5 µM. The results showed that insulin increased the area of cardiomyocytes and DHTS (0.5 µM) suppressed the insulin-induced enlargement of cardiomyocytes (Figure 6(C)). Cardiomyocyte hypertrophy is often associated with increased protein synthesis. 19 A trend for an increase in protein level was observed following insulin treatment, while DHTS suppressed this effect (Figure 6(D)). These results suggested that DHTS suppressed insulin-induced cardiomyocyte hypertrophy. We further investigated the mechanism of DHTS on insulin-induced cardiomyocyte hypertrophy. The Western-blot results showed that DHTS inhibited insulin-induced activation of extracellular signal-regulated kinase (ERK), which is a marker of concentric hypertrophy. In addition, DHTS restored insulin-induced suppression of CCAAT/enhancer-binding protein beta-2 isoform (CEBPβ) and glycogen synthase kinase-3β (GSK3β) with no obvious effect on phosphorylation of protein kinase B (AKT) (Figure 6(E)).

DHTS ameliorated insulin-induced cardiomyocyte hypertrophy. The effect and mechanism of DHTS on cardiomyocyte hypertrophy was measured in isolated rat neonatal cardiomyocytes. (A) The representative images of cardiomyocytes without treatment, treated with insulin (100 nM), or insulin together with DHTS (0.5 µM). (B) The toxicity of DHTS was tested by cell counting kit-8 assay. (C) The cross-sectional area of cardiomyocytes without treatment, treated with insulin (100 nM), or insulin together with DHTS (0.5 µM). (D) The protein concentration of cardiomyocytes without treatment, treated with insulin, or insulin together with DHTS. (E) The representative images and quantitative results of protein levels of cardiomyocytes without treatment, treated with insulin, or insulin together with DHTS. n = 3, * P < 0.05, ** P < 0.01 versus CH, #P < 0.05 indicated group. AKT, protein kinase B; CEBPβ, CCAAT/enhancer-binding protein beta-2 isoform; DHTS, dihydrotanshinone I; ERK, extracellular-signal-regulated kinase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GSK3β, glycogen synthase kinase-3β.
Discussion
In the present study, we evaluated the effect of one of the major lipid-soluble compounds in Danshen, DHTS, on high-fat-induced cardiac hypertrophy and diastolic dysfunction in mice. To the best of our knowledge, this is the first study that reported on the effect of DHTS in high-fat-induced cardiac remodeling and dysfunction. Our results suggested that DHTS ameliorated diastolic dysfunction, as indicated by the increased E/A ratio and decreased isovolumic relaxation phase in high-fat mice. Moreover, histological analysis of cardiac cross-sections suggested that DHTS ameliorated cardiac hypertrophy. Further investigation of the effect on isolated cardiomyocytes indicated that DHTS suppressed the insulin-induced enlargement of cardiomyocytes. Our results also indicated that DHTS restored the insulin-induced suppression of CEBPβ and GSK3β, as well as activation of ERK, which is the mediator of cardiac hypertrophy.
The extract from Danshen has been commercialized in various formulations such as capsules and dripping pills. 20 The Compound Danshen Dripping Pill has been used for angina and coronary heart disease in China. Recently, a phase III clinical trial which evaluated its effect on angina has been completed in the United States. Moreover, animal studies suggested that Danshen extract may be used to restore the heart function of diabetic rats. 21 It has also been reported that cryptotanshinone from Danshen reduced cardiac fibrosis in streptozotocin (STZ)-induced diabetic rats. 22 Tanshinone IIA restored injured mitochondrial structure and loss of mitochondria in the heart of STZ-treated rats. Besides, DHTS ameliorated atherosclerosis in ApoE−/− mice. 18 However, its effect on diabetic cardiomyopathy has not yet been reported in the literature. By using echocardiography and biochemical analysis, we examined the effects of DHTS on diabetic cardiomyopathy in vivo and in vitro.
The major characteristic of diabetic cardiomyopathy that distinguishes it from other heart diseases is diastolic dysfunction with preserved systolic function in the early stage. 8 Our results showed impaired diastolic function and preserved systolic function in high-fat-fed mice, which is consistent with the features of early stage diabetic cardiomyopathy. Moreover, DHTS showed no significant effect on body weight, blood glucose, insulin levels, and glucose tolerance. This further indicated that its effect on the heart was not attributed to the alleviation of diabetes. Thus, we further investigated its direct effect on isolated cardiomyopathy and found that it suppressed insulin-induced cardiomyocyte hypertrophy.
Although the detailed mechanism has not yet been fully understood, hyperinsulinemia has been recognized as an independent risk factor for chronic coronary heart disease. 4 Retrospective studies identified insulin treatment as an independent risk factor for congestive heart failure. It has also been associated with a significantly worse prognosis for advanced heart failure in patients with diabetes. 23,24 A clinical trial suggested that treatment with saxagliptin, a dipeptidyl peptidase-4 inhibitor that can increase insulin levels, has been associated with an increased risk or hospitalization for heart failure. 25
Insulin has been well recognized for its role in cell growth and proliferation. It has been shown that hyperinsulinemia was associated with cardiac hypertrophy in neonates. 26 A study in db/db mice suggested that systemic hyperinsulinemia contributed to cardiac hypertrophy, which could be blocked by the deletion of insulin-like growth factor-1R. 27 Continuous administration of insulin for 7 weeks using osmotic pumps increased LV mass and relative wall thickness in rats. 28 In isolated rat cardiomyocytes, insulin treatment induced cardiomyocyte hypertrophy. 29 Multiple kinases or transcription factors in the insulin signaling pathway, such as GSK, ERK, and CEBPβ, have been suggested to be involved in the development of cardiac hypertrophy. An abnormal insulin signaling pathway with a significant elevation of phosphorylated GSK has been observed in type 2 diabetic subjects combined with coronary artery disease. 30 Inhibition of GSK by phosphorylation is associated with the treatment of hypertrophic stimuli in rat neonatal cardiomyocytes. 31 ERK activation and reduction of CEBPβ have been recognized to contribute to cardiac hypertrophy. 32,33 In the present study, insulin treatment induced suppression of CEBPβ, as well as phosphorylation of GSK3β and ERK in neonatal cardiomyocytes. DHTS suppressed the above effects of insulin, suggesting that DHTS may ameliorate cardiac hypertrophy by inhibiting these hypertrophic signaling associated with hyperinsulinemia.
Further investigations using transgenic or knockout animal models are needed to identify the detailed mechanisms underlying the effect of DHTS. In addition, the effect of DHTS on systemic insulin resistance and insulin action in the heart should be studied in future study. Considering the important role of lipotoxicity in the development of insulin resistance and diabetic cardiomyopathy, the effect of DHTS on lipoprotein profiles and cardiac lipid composition will also be studied in this chronic high-fat model. In order to assess further apoptosis in the heart, cleaved caspase 3 and anti/proapoptosis proteins will be measured in future study. Gut microbiota have been recognized to be involved in the development of diet-induced obesity and related metabolic diseases. 34 It will be interesting to investigate the effect of DHTS on gut microbiota in the future study.
To conclude, our data indicated that DHTS ameliorates cardiac hypertrophy and diastolic dysfunction in high-fat-fed mice. DHTS suppressed insulin-induced cardiomyocyte hypertrophy in isolated cardiomyocytes. A possible mechanism underlying the effects of DHTS may be the restoration of insulin-induced suppression of CEBPβ and GSK3β and suppression of insulin-induced activation of ERK. The dose-response relationship, oral bioavailability, and detailed mechanism of DHTS should be further investigated by future studies.
Experimental
Animal Study
Male C57BL/6J mice (10 weeks old) were purchased from the Laboratory Animal Center of Sun Yat-Sen University (Guangzhou, China). All the animals were housed in the animal facility of Guangzhou Medical University on a 12 hours light/dark cycle with free access to water and food. All animal studies were approved by the Animal Ethics Committee of Guangzhou Medical University (GY2017-054).
After acclimatization for 2 weeks, mice were assigned into 3 groups: chow group was fed with a laboratory chow diet for 38 weeks; the high-fat group was fed a 60% high-fat diet (Research diet D12492) for 38 weeks 35 ; the DHTS group was fed with the 60% high-fat diet for 38 weeks and received an intraperitoneal (i.p.) injection of DHTS (25 mg/kg, isolated from Danshen by ShangHai PureOne Biotechnology) every 2 days for the last 6 weeks of feeding. 36,37 DHTS was prepared in saline with 5% dimethylsulfoxide (DMSO) and 5% tween 80. The chow group and high-fat group were administrated saline with 5% DMSO and 5% tween 80.
Assessment of Metabolic Parameters
The glucose tolerance test was performed at week 36. Animals were fasted for 5 hours, and glucose (1.5 g/kg body weight) was administrated to animals by i.p. injection. Blood glucose levels were measured at 0, 15, 30, 60, and 90 minutes using a glucometer (Accu-Chek, Roche). Plasma insulin levels were measured at the end of the study using an enzyme-linked immunosorbent assay kit (CUSABIO, China).
Assessment of Cardiac Function by Echocardiography
Mice were anesthetized by isoflurane. Echocardiography was performed by utilizing a VisualSonics Vevo LAZR-X ultrasound imaging system with an MX400 transducer. 38 LV M-mode was acquired from parasternal short-axis view for the measurements, including end-diastolic PWD, LV mass, ejection fraction, and fractional shortening. From apical 4-chamber views, color Doppler was used to measure the E/A ratio, IVRT, and aortic ejection time.
Histological Analysis
Tissues collected from mice were fixed in 4% paraformaldehyde and embedded in paraffin. Sections of 4 µm were cut for H&E staining, sirius red staining, and TUNEL assay (Servicebio, China).
Isolation and Treatment of Neonatal Cardiomyocytes
Heart of neonatal rats was digested by 0.05% ethylenediaminetetraacetic acid-free trypsin (Invitrogen) at 4 °C overnight. Further digestion was performed using 0.1% collagenase II (Worthington, USA) for 10 minutes at 37 °C. The cell suspension was then filtered using a 70 µm strainer (BD Biosciences, USA) and cultured in Dulbecco’s modified Eagle's medium (DMEM) high glucose medium (Gibco, USA) at 5% CO2 for 30 minutes. Cells that did not attach to the dish were collected and further cultured using DMEM with 0.1 mM BrdU for suppressing the proliferation of fibroblasts. The isolated cardiomyocytes were identified by positive staining of cardiac troponin-T and α-actinin by immunofluorescence. The toxicity of DHTS was tested by CCK-8 assay (Sigma). Cardiomyocytes were treated with insulin with or without DHTS (0.5 µM) for 48 hours and labeled by immunofluorescence of α-actinin. The cross-section area of cells was quantified using Image J.
Immunofluorescence
Cardiomyocytes were fixed with 4% paraformaldehyde for 15 minutes and permeabilized with 0.1% Triton X-100. Cells were then blocked with 1% bovine serum albumin (BSA) for 0.5 hours. Next, cells were incubated with the primary antibody for 2 hours and the secondary antibody for 0.5 hours at room temperature. Hoechst was used to stain nuclei for 5 minutes. Primary antibodies were purchased from Abcam and secondary antibodies from Life Technology. The images were captured by a Leica DMi8 fluorescence microscope.
Western Blot
Proteins prepared in Laemmli buffer were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, after which they were transferred to polyvinylidene difluoride membranes (Millipore) and blocked in 3% BSA. Membranes were probed with the primary antibodies overnight. Akt, phospho-Akt, CEBPβ, pGSK3β, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were purchased from Abcam. Western blot membranes were incubated with corresponding secondary antibodies that were conjugated to horseradish peroxidase (HRP) and developed using enhanced chemiluminescence HRP substrate from Thermo. Images of the membranes were taken with the chemiluminescence imager (GE Healthcare), and densitometry analysis was performed using Image J.
Quantitative Real-Time PCR
Ribonucleic acid (RNA) was extracted using TRIzol Reagent (Invitrogen, #15596026), and genomic deoxyribonucleic acid (DNA) was digested using amplification grade DNase (Takara). RNA extract was reverse-transcribed using a complementary DNA Reverse Transcription kit (Takara) according to the manufacturer’s instructions. Primers and TB green premix (Takara) were used for quantitative real-time PCR using the Roche Light Cycler PCR system. GAPDH was used as the normalizing control gene and results were analyzed by the ΔΔCt method. Sequences of the primers were: ANP TGGGACCCCTCCGATAGATC (forward) and AGCGAGCAGAGCCCTCAGT (reverse); BNP CCTGGCCCATCGCTTCT (forward) and CATCTGGGACAGCACCTTCA (reverse); GAPDH AGGTCGGTGTGAACGGATTTG (forward) and TGTAGACCATGTAGTTGAGGTCA (reverse); β-MHC TCTCCTGCTGTTTCCTTACTTGCTA (forward) and GTACTCCTCTGCTGAGGCTTCCT (reverse).
Statistical Analyses
Data are expressed as means ± SE. A one-way analysis of variance was used to determine the statistical significance across multiple groups. When significant differences were found, Tukey’s multiple comparison tests were used to examine differences between groups (GraphPad Prism 7.0). A P < 0.05 was considered statistically significant.
Footnotes
Declaration of Conflicting Interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the National Natural Science Foundation of China (No. 81330007 and U1601227 to Yu XY, No.81903607 to Li S), and the China Postdoctoral Science Foundation (No.2018M633035 to Li S).
