Sage Journals: Discover world-class research

Abstract

Arterial disease is associated with elevated serum matrix metalloproteinase (MMP)-8 concentration. We studied the role of two promoter region single nucleotide polymorphisms (SNPs) of MMP-8 gene in the arterial disease. The population comprised patients with arterial disease (n = 124) and healthy blood donors (n = 100) as a reference group for MMP-8 SNPs (−799C/T and −381A/G) genotypes and serum concentrations. Genotype frequencies for MMP-8 −799C/T SNP in arterial disease were C/C (43.5%), C/T (32.3%) and T/T (24.2%), and in the reference group they were C/C (50.0%), C/T (40.0%) and T/T (10.0%; P = 0.012). The −799C allele frequency was lower in the patients (59.7%) than in the reference group (70.0%; P = 0.023). The −799C allele showed protective effects against the arterial disease with an odds ratio [95% confidence interval (CI)] of 0.372 (0.141–0.980, P = 0.045) after adjustment for age, gender, and serum MMP-8 and TIMP-1 concentrations. Only in the reference group and whole study population (n = 224), the −799TT genotype significantly associated with an increase in serum MMP-8 concentrations (P = 0.047, 0.025). The −799C allele appeared protective against the arterial disease. The genotype may have an effect on systemic MMP-8 levels which could not, however, be seen in the arterial disease patients probably as a result of the strong inflammation involved in the disease pathogenesis.

Keywords

Arterial disease human DNA matrix metalloproteinase-8 serum single nucleotide polymorphism

Introduction

Matrix metalloproteinases (MMPs) form an enzyme family composed of structurally related, but genetically distinct, zinc-dependent proteolytic enzymes that can process or degrade a variety of extracellular matrix and non-matrix bioactive proteins.^1,2 Collagenase-2 (MMP-8), also called neutrophil collagenase, is a member of the 23 human MMP-family and produced not only by neutrophils, but also by macrophages, endothelial cells, smooth muscle cells and fibroblasts.³ MMP-8 is catalytically the most competent type I collagenase³ present at inflammatory sites and plays an important role in extracellular degradation and tissue remodeling.^4,5 In addition to the surrogate classical function ofMMP-8 as a mediator in connective tissue destruction, its ability to decisively process various bioactive non-matrix substrates such as chemokines, cytokines, growth factors, hormone receptors and immune mediators can exert anti-inflammatory, defensive characteristics.^1,6^–¹²

Atherosclerosis is an inflammatory disease.¹³ Circulating leukocytes adhere to the vascular endothelium and penetrate into arterial intima where they differentiate into macrophages, take up modified lipoproteins and transform to lipid-laden foam cells. The foam cells are the hallmarks of atherosclerotic lesions.¹³ Atherosclerotic plaques also comprise of extracellular matrix proteins, for example type I and III collagens and proteoglycans, and vascular smooth muscle cells.¹³ Various MMPs participate in different steps of atherosclerotic plaque and aneurysm formations.¹⁴ Smooth muscle cells, endothelial cells and macrophages in atherosclerotic lesions can express MMP-8 thereby increasing their potential to rupture.^3,15 It has also been demonstrated that elevated serum MMP-8 concentrations are associated with the presence of atherosclerosis, arterial disease and cardiovascular outcome.¹⁶^–¹⁸

MMP-8 single nucleotide polymorphisms (SNP), in particular, have been reported to alter the promoter activity and subsequent gene expression in preterm premature rupture of membranes.¹⁹ The SNPs influence breast cancer prognosis²⁰ and decrease lung cancer risk.²¹ However, whether MMP-8 SNP affects the serum MMP-8 concentration is not known. Thus, we were primarily interested in examining in the present hypothesis generating study of: i) whether the variation is associated with arterial disease; ii) whether the variation affects the serum MMP-8 concentration in arterial disease; and, iii) whether SNPs or disease explain the high serum MMP-8 concentration associated with arterial disease.

Materials and methods

Patients

The sample was previously described in detail.¹⁷ Originally, the patients were collected in order to investigate a wide range of infection and inflammation associated parameters in arterial disease. Briefly, the population comprised 124 patients who underwent surgery because of symptomatic aorto-occlusive disease (n = 18), carotid artery stenosis (n = 65) or abdominal aortic aneurysm (n = 41) in the Department of Vascular Surgery, Helsinki University Central Hospital between 2002 and 2004. Pre-operative blood samples were collected from all patients before the induction of anesthesia. The vascular tissue samples were obtained during surgery. The mean age (±SD) and percentage of male patients were 67.55±9.7 years and 79.0% respectively.

Reference group

The samples of the reference group were provided by healthy blood donors (n = 100) collected by the Finnish Red Cross, Oulu, Finland, as previously described.¹⁷ Any of the following clinical characteristics were not accepted for blood donation: diabetes mellitus; strong allergies; neurologic diseases; any acute infections; rheumatoid arthritis; recent oral, or any other, operations; cancer; chronic liver or kidney disease; Crohn's disease; tendency to bleed; or sexually transmitted diseases; as well as asthma or hypertension not in treatment balance. Subjects with the following cardiovascular diseases were also excluded: stroke, acute myocardial infarction, coronary artery disease, eye thrombus, angina pectoris, frequent arrhythmia, aorto-occlusive disease, phlebitis, or rheumatic fever. The donors were between 18 and 65 years old, and their haemoglobin levels were 135–195 and 125–175 g/l for males and females, respectively. The mean age (±SD) and percentage of male reference subjects were 58.41±4.4 years and 53.0% respectively. The only data available from reference group was age and gender. Therefore, performing the combined effect of genetic and non-genetic factors in the patients was impossible with respect to reference group.

All patients and healthy blood donors gave their informed consent. The Local Ethics Committee at Helsinki University Central Hospital and the Finnish Red Cross, Oulu, Finland approved the study protocol.

DNA extractions

Vascular tissue samples were collected during the surgical procedure, were snap–frozen in liquid nitrogen and stored at −70°C for later DNA extraction. DNA was extracted as previously described using QIAamp DNA mini kit (QIAGEN, Crawley, UK) tissue protocol according to the manufacturer's instructions.²² For the reference group, buffy coats were separated and the cells were stored at −80°C until the DNA extraction done with the QIAamp DNA mini Kit (Qiagen) tissue protocol according to the manufacturer's instructions. After extraction, the DNA concentrations and purity were determined photometrically.

MMP-8 and TIMP-1 serum concentrations

Serum MMP-8 and TIMP-1 concentrations¹⁷ were determined both in the patients with arterial disease and the reference groups using ELISA kit (GE Healthcare, Buckinghamshire, UK) according to the manufacturer's instructions. All samples were analyzed in duplicate. Intra-assay co-efficient of variations for MMP-8 was2.5% (n = 12) and inter-assay co-efficient of variations was 4.8% (n = 12). The detection limit for MMP-8 was 0.032 ng/ml and for TIMP-1 it was 1.25 ng/ml.

Genotyping

Genotyping for two SNPs at positions −799C/T (rs11225395) and −381A/G (rs1320632) of the MMP-8 promoter region (accession number AF059679) was performed using allelic discrimination Taqman chemistry in the Mx 3005P QPCR System (Stratagene, Agilent Technologies, Santa Clara, CA, USA). Primer and probe sequences were designed and synthesized by Sigma Aldrich (St Louis, MO, USA) (Table 1). Probes were fluorescently labeled with either HEX or FAM to detect the different alleles in the presence of ROX as areference dye. Reaction mixture (25 µl) contained 30–50 ng genomic DNA, 12.5 µl 2x Brilliant® II QPCR Master mix (Stratagene), 200 nM forward and 400 nM reverse primers, and 200 nM of each probe. The thermal cycle conditions consisted of 1 cycle at 95°C for 10 min, 50 cycles at 95°C for 15 s and at 58°C for 1 min. MxPro QPCR software for allele discrimination (Stratagene) was used to analyze fluorescence. Water control, previously genotyped samples and a synthetic gene with known allele (GeneArt, Frankfurt, Germany) were included on each plate to adjust the reaction threshold and to ensure the accuracy of allele discrimination. Genotyping was unsuccessful in patients (n = 12) and reference group (n = 9) because of low DNA quantity.

Table 1.

Primer and probe sequences used in the detection of MMP-8 SNPs

SNP	Primers/probes	Sequence (5' to 3')
−799C/T
	forward	CAGCCAGAGACTCAAGTG
	reverse	GAGGGTATGTTTAGAGAGACTG
	probe 1	(6-Fam) ct+Act+Ata+Ggc+Tct+Gcatgg (BHQ1)
	probe 2	(Hex) ct+Act+At+A+Agc+Tct+Gcatgg (BHQ2)
−381A/G
	forward	ATAACACAGTCACTCATTCTCTC
	reverse	ACCAAGGAGCCCAACTAG
	probe 1	(6-Fam) tctg+Tactt+A+T+Cc+Tcc+Ctcatt (BHQ1)
	probe 2	(Hex) tct+G+Tactt+A+Ccctccct+Catt (BHQ2)

Statistical analyses

The genotype and allele frequencies were calculated using the direct genotype or gene counting method. The significance of the differences in the frequencies between the patients and the healthy blood donors wascompared using the Chi-square test producing odds ratio (OR) and 95% confidence intervals (95% CI).

The significances of the differences between the patients and the healthy blood donors in continuous variables, e.g. serum MMP-8 concentration were compared using the Mann-Whitney U test. Continuous data are presented as median [interquartile range (IQR) 25%–75%].

Logistic regression analyses were applied to study the potential association of the SNPs with the arterial disease. For this, four different models were performed. In the first models, only the allele data were used. In the multivariate models, in addition to the allele data, confounding factors, i.e. age, sex and serum MMP-8 and TIMP-1 concentrations, were added with forward stepwise method. Data are presented with the OR, 95% CI and P value.

Data were analyzed using the SPSS 15.0 statistical package (SPSS Inc., Chicago, IL, USA). For all statistical tests lower than 0.05, P-values were considered as statistically significant.

Results

Two functionally important SNPs, −799C/T and −381A/G, from the promoter region of the MMP-8 gene were typed from the patients with arterial disease and the reference group of healthy blood donors. When compared with the reference subjects (n = 100), the patients (n = 124) were older (58.41 ± 4.4 versus 67.55 ± 9.7 years, P < 0.001) and more frequently male (53.0% versus 79.0%, P < 0.001). The genotype and allele frequencies are presented in the Table 2. The −799CC genotype in the promoter region of the MMP-8 gene was less frequent in the patients when compared with the reference group (OR = 0.36, 95% CI = 0.16–0.81, P = 0.012, Table 2). Similarly, when the gene numbers were calculated, the patients with arterial disease showed a lower number of the −799C allele when compared with the reference group (OR = 0.63, 95% CI = 0.43–0.94, P = 0.023, Table 2). No significant differences were found in the −381A/G, neither in the genotype (P = 0.66), nor in the allele frequencies (P = 0.86) (Table 2).

Table 2.

Genotype and allele distributions of MMP-8 SNPs among patients with arterial disease and healthy blood donors

			MMP-8 (−799C/T) SNP
	CC (%)	CT (%)	TT (%)	C (%)	T (%)
Patients (n = 124)	54 (43.5)	40 (32.3)	30 (24.2)	148 (59.7)	100 (40.3)
Healthy (n = 100)	50 (50.0)	40 (40.0)	10 (10.0)	140 (70.0)	60 (30.0)
Odds ratio (95% CI)	0.36 (0.16–0.81)^*			0.63 (0.43–0.94)^†
P value	0.012			0.023
			MMP-8 (−381A/G) SNP
	AA (%)	AG (%)	GG (%)	A (%)	G (%)
Patients (n = 112)^¶	99 (88.4%)	11 (9.8%)	2 (1.8%)	209 (93.3%)	15 (6.7%)
Healthy (n = 91)^**	81 (89.0%)	7 (7.7%)	3 (3.3%)	169 (92.9%)	13 (7.1%)
Odds ratio (95% CI)	1.83 (0.30-11.24)^‡			1.07 (0.50-2.31)^§
P value	0.66			0.86

Odds ratios and P-values for arterial disease in: ^*CC vs TT; ^†C vs T; ^‡AA vs GG; and ^§A vs G; DNA samples consumed in ^¶patients n = 12 and ^**healthy n = 9.

We examined the serum MMP-8 concentration in relation to SNP variations studied. We compared the serum MMP-8 concentrations separately between −799CC and −799TT genotypes and between −381AA and −381GG genotypes separately in the reference group and in the patients. In the patients, we found no significant differences (Table 3). Within the reference group, the subjects having the −799TT genotype (median = 5.10, IQR = 3.08–14.54) had higher MMP-8 serum concentrations when compared with the subjects whohad the −799CC genotype (median = 3.26, IQR = 1.93–6.36) (Mann-Whitney U Test, P = 0.047, Table 3). Similarly, in the whole study population, the subjects that had the −799TT genotype (median = 8.91, IQR = 6.25–19.60) had a higher MMP-8 serum concentration when compared with the subjects who had the −799CC genotype (median = 7.51, IQR = 3.16–12.23) (Mann-Whitney U Test, P = 0.025) (Figure 1). No other significant differences were noticed. We further analyzed the serum MMP-8 concentration within subgroups of the SNP variations. The patients had a significantly higher serum MMP-8 concentration when compared with the reference group, when analyses were made separately within the −799CT, CC genotypes, or C and T alleles, but not in the TT genotype (Table 3). Similar results were observed when analyses were made separately within the −381AA, AG genotypes, or A and G allele, but not in the GG genotype. However, no statistically significant differences in patients with the −799TT or the −381GG genotypes were observed (Table 3).

Figure 1.

Analysis of serum MMP-8 concentrations and MMP-8 (−799C/T) SNP by box plot graph. The figure includes the whole study population (n = 224) as indicated. P-value indicated significance as compared between serum MMP-8 concentrations and MMP-8 (−799C/T) genotypes.

Table 3.

Association of MMP-8 gene promoter SNP and serum MMP-8 concentration

	Median (IQR), ng/ml (n)
Promoter SNPs	Healthy blood donors	Patients	P-value^*
MMP-8 (−799C/T)
CC	3.26 (1.93–6.36) (n = 50)	11.46 (7.43–17.45) (n = 54)	<0.001
CT	3.82 (1.74–7.74) (n = 40)	11.74 (7.32–23.06) (n = 40)	<0.001
TT	5.10 (3.08–14.54) (n = 10)	9.87 (7.36–23.06) (n = 30)	0.061
C allele (CC + CT)	3.58 (1.84–7.33) (n = 90)	11.46 (7.54–18.74) (n = 94)	<0.001
T allele (TT + CT)	3.85 (2.08–8.13) (n = 50)	11.29 (7.41–23.04) (n = 70)	<0.001
P-value (CC vs TT)^†	0.047	0.98
MMP-8 (−381A/G)^‡
AA	3.74 (2.00–7.88) (n = 81)	12.22 (7.77–20.40) (n = 99)	<0.001
AG	2.00 (1.35–4.66) (n = 7)	6.19 (2.64–11.31) (n = 11)	0.021
GG	2.63 (n = 3)	8.51 (n = 2)	0.248
A allele (AA + AG)	3.64 (1.74–7.38) (n = 88)	11.36 (7.41–19.45) (n = 110)	<0.001
G allele (GG + AG)	2.32 (1.45–5.03) (n = 10)	6.24 (3.83–11.05) (n = 13)	0.011
P-value (AA vs GG)	0.81	0.28

Values indicate median (IQR) (number of individuals).

P-value for Mann-Whitney U test.

Comparisons made between the healthy blood donors and the patients within the given genotype or allele.

†

Comparisons made within healthy blood donors or patients.

‡

DNA samples consumed in healthy blood donors n = 91 and patients n = 112.

The association of the SNPs with the arterial disease was analyzed by multiple logistic regression analyses. Advancing age (OR = 1.192/year, 95% CI = 1.128–1.259, P < 0.001) and high serum MMP-8 concentration (OR = 1.161/ng/ml, 95% CI = 1.099–1.227, P < 0.001) were associated with an increased risk for arterial disease, whereas the MMP-8 −799C allele (OR = 0.372, 95% CI = 0.141–0.980, P = 0.045) appeared protective (Table 4).

Table 4.

Analysis of arterial disease risk estimation^*

	Unit	Odds Ratio (95% CI)	P-value
MMP-8 (−799C/T)
Model I
C allele (CC + CT)		0.333 (0.144–0.772)	0.010
T allele (TT + CT)		0.962 (0.517–1.659)	0.796
Model II
C allele (CC + CT)		0.372 (0.141–0.980)	0.045
T allele (TT + CT)		1.197 (0.534–2.688)	0.662
Age	year	1.192 (1.128–1.259)	<0.001
Sex		2.142 (0.948–4.841)	0.067
MMP-8	ng/ml	1.161 (1.099–1.227)	<0.001
TIMP-1	ng/ml	1.001 (0.989–1.013)	0.894
MMP-8 (−381A/G)
Model III
A allele (AA + AG)		2.357 (0.311–17.852)	0.407
G allele (GG + AG)		1.286 (0.477–3.467)	0.62
Model IV
A allele (AA + AG)		2.644 (0.190–36.878)	0.470
G allele (GG + AG)		3.325 (0.861–12.837)	0.081
Age	year	1.180 (1.114–1.250)	<0.001
Sex		2.062 (0.907–4.687)	0.084
MMP-8	ng/ml	1.154 (1.091–1.221)	<0.001
TIMP-1	ng/ml	0.998 (0.987–1.010)	0.776

Dependent variable was presence (patients, n = 124) and absence (n = 100) of arterial disease.

Discussion

To the best of our knowledge, this is the first study inarterial disease that examines the functionally-important MMP-8 SNPs variations in relation to the serum MMP-8 concentrations. Our finding is the first to indicate that the C allele of the MMP-8 −799C/T exerts a protective effect against arterial disease that persisted after adjustment for age, gender and serum MMP-8 and TIMP-1 concentrations. This was supported by the univariate analysis and later confirmed by the multivariate analyses. Interestingly, we also showed, for the first time, that, in the reference group, −799TT genotype associated significantly with the increased serum MMP-8 concentrations. Similarly, in the whole study population, the −799TT genotype significantly associated with the increased serum MMP-8 concentrations. In patients, serum MMP-8 concentrations did not differ significantly between MMP-8 genotypes. In the recent studies, high serum MMP-8 concentration has been shown to associate with an increased risk for cardiovascular diseases¹⁶ and arterial disease.¹⁷ However, the reasons for these associations have remained unknown. Certain SNPs in the promoter region of the MMP-8 gene have been shown to exert a higher promoter activity and subsequent gene activation.¹⁹ It is not fully known if these MMP-8 SNPs affect serum MMP-8 concentrations.

The MMP-8 gene is located on chromosome 11 and codes for the MMP-8 protein. Three SNPs have been identified in this gene.¹⁹ Two of these (−799C/T and −381A/G) are located in the MMP-8 promoter region and have putative functional significance, increasing the promoter activity and subsequent gene activation.¹⁹ MMP-8 plays an important role in proteolytic degradation and remodeling of various extracellular matrix components in both physiologic and pathologic conditions, including tissue repair, angiogenesis, and tumor cell invasion and metastasis. MMP-8 can also, by processing the non-matrix bioactive molecules, modify the immune responses and participate in anti-inflammatory defensive processes.^1,6^–^8,10,12

Under normal physiologic conditions, MMP-8 isexpressed at very low levels, whereas enhanced expression and activation has been found in various tumors²³^–²⁶ and cardiovascular diseases.^15,27 It has been shown that MMP-8 can be produced by endothelial cells, plasma cells, smooth muscle cells and macrophages in atherosclerotic plaques³, and elevated levels of serum MMP-8 are associated with atherosclerosis¹⁶ and arterial disease.¹⁷ In vitro experiments in breast cancer have demonstrated that the T allele of −799C/T is associated with higher promoter activity compared with the C allele²⁰ and in preterm premature rupture of membrane¹⁹. However, no association has been demonstrated between MMP-8 SNP and head and neck squamous cell cancer²⁸, hepatocellular carcinoma²⁹, bronchiectasis³⁰ or metabolic syndrome.⁴ Compared with the reference group, our patient population had a low frequency of the −799C allele, indicating a high probability of increased promoter activity and subsequent gene activation. In previous studies, the frequency of the −799C allele in patients with bronchiectasis was 66.8%³⁰ and in metabolic syndrome was 66.5%.⁴ In our study, the allele frequencies were of the same magnitude in patients (59.7%) and in the reference group (70.0%). On the other hand, patients with arterial disease had a high serum MMP-8 concentration compared with the reference group, when the analyses were made separately within the different genotypes or alleles. Therefore, we were unable to demonstrate a direct relationship between the serum MMP-8 concentrations and the MMP-8 genotypes in the patients with arterial diseases. Similar findings were found by Aquilante et al.⁴ when they investigated the association of MMP-8 −799C/T and −381A/G and metabolic syndrome.

The MMP-8 gene is probably activated as a result of continuously activated inflammatory cascades.^3,15,27 It has been previously unknown whether the increment in MMP-8 concentration is affected by promoter polymorphisms. In this regard, our report is the first to show the direct association between serum MMP-8 concentrations and the −799TT genotype in the reference group. The previously known putative functional significance^19,20 of the SNPs studied can probably be extendable, i.e. the effects of the −799TT genotype in serum MMP-8 concentrations can only be seen in healthy subjects, where normal biology is still intact, but not in patients with arterial diseases where normal biology is disturbed and a high degree of inflammation is present. Arterial diseases are such as a complex group of diseases where one phenomenon cannot be solely explained by one risk factor, and several component or markers collectively affect the disease outcome. Arterial disease is strongly associated with inflammation. Certain inflammatory markers are always found to be high; MMP-8 is one of them.^1,16,18 MMPs are a complex family where one proteolytic enzyme may activate or inactivate another in cascades. On the other hand, MMPs also exist in different forms, e.g. latent and active forms.³¹ Thus, we suggest that the increased serum MMP-8 concentration in patients with arterial diseases could be caused by the strong inflammation cascades typical for the arterial diseases. Furthermore, investigating the association between the SNPs and the degree of MMP-8 activation could be informative in understanding the exact role of MMP-8 SNP in the etiology of arterial disease. Additionally, the association between the MMP-8 SNP and differences in serum MMP-8 concentrations in the reference group has captured the attention for further investigation in larger, case-control studies.

Study limitations

First, our study population was relatively small. Second, the study population was enrolled from hospitals and reference subjects were collected from the healthy blood donors. Thus, inherent selection bias cannot becompletely excluded. Third, as we could receive only age and gender data from the healthy blood donors, we were unable to perform the combined effect of genetic and non-genetic factors in the diseases with regards to reference group.

Conclusions

The C allele of MMP-8 −799C/T appeared protective against arterial disease. Compared with the reference group, serum MMP-8 concentrations were higher in patients with arterial diseases; the genetic variations in the promoter region may have an effect in the gene activations. In the reference group, an association between the MMP-8 −799C/T SNP and serum MMP-8 concentrations was observed. However, at the level of serum concentration studies, the genetic effect may be shadowed by the strong inflammatory response found in patients with arterial disease. Our results warrant further investigation in larger, population-based studies.

Funding

This study was funded by grants from the Academy of Finland [#1130408 for TS], the Sigrid Juselius Foundation (PJP), Finnish doctoral program in oral sciences (PP-P) and grants from the Helsinki University Central Hospital Research Foundation.

Conflict of interest statement

None declared.

References

Sorsa

Tjaderhane

Konttinen

. Matrix metalloproteinases: contribution to pathogenesis, diagnosis and treatment of periodontal inflammation. Ann Med 2006; 38: 306–321.

Page-McCaw

Ewald

Werb

. Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol 2007; 8: 221–233.

Herman

Sukhova

Libby

. Expression of neutrophil collagenase (matrix metalloproteinase-8) in human atheroma: a novel collagenolytic pathway suggested by transcriptional profiling. Circulation 2001; 104: 1899–1904.

Aquilante

Beitelshees

Zineh

. Correlates of serum matrix metalloproteinase-8 (MMP-8) concentrations in nondiabetic subjects without cardiovascular disease. Clin Chim Acta 2007; 379: 48–52.

Galis

Sukhova

Lark

Libby

. Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques. J Clin Invest 1994; 94: 2493–2503.

Owen

Lopez-Otin

Shapiro

. Membrane-bound matrix metalloproteinase-8 on activated polymorphonuclear cells is a potent, tissue inhibitor of metalloproteinase-resistant collagenase and serpinase. J Immunol 2004; 172: 7791–7803.

Gueders

Balbin

Rocks

. Matrix metalloproteinase-8 deficiency promotes granulocytic allergen-induced airway inflammation. J Immunol 2005; 175: 2589–2597.

Kuula

Salo

Pirila

. Local and systemic responses in matrix metalloproteinase 8-deficient mice during Porphyromonas gingivalis-induced periodontitis. Infect Immun 2009; 77: 850–859.

Korpi

Kervinen

Maklin

. Collagenase-2 (matrix metalloproteinase-8) plays a protective role in tongue cancer. Br J Cancer 2008; 98: 766–775.

10.

Korpi

Astrom

Lehtonen

. Healing of extraction sockets in collagenase-2 (matrix metalloproteinase-8)-deficient mice. Eur J Oral Sci 2009; 117: 248–254.

11.

Van Lint

Libert

. Matrix metalloproteinase-8: cleavage can be decisive. Cytokine Growth Factor Rev 2006; 17: 217–223.

12.

Sorsa

Tjaderhane

Salo

. Matrix metalloproteinases (MMPs) in oral diseases. Oral Dis 2004; 10: 311–318.

13.

Libby

. Inflammation in atherosclerosis. Nature 2002; 420: 868–874.

14.

Busti

Falcinelli

Momi

Gresele

. Matrix metalloproteinases and peripheral arterial disease. Intern Emerg Med 2010; 5: 13–25.

15.

Turu

Krupinski

Catena

. Intraplaque MMP-8 levels are increased in asymptomatic patients with carotid plaque progression on ultrasound. Atherosclerosis 2006; 187: 161–169.

16.

Tuomainen

Nyyssonen

Laukkanen

. Serum matrix metalloproteinase-8 concentrations are associated with cardiovascular outcome in men. Arterioscler Thromb Vasc Biol 2007; 27: 2722–2728.

17.

Pradhan-Palikhe

Vikatmaa

Lajunen

. Elevated MMP-8 and decreased myeloperoxidase concentrations associate significantly with the risk for peripheral atherosclerosis disease and abdominal aortic aneurysm. Scand J Immunol 2010; 72: 150–157.

18.

Momiyama

Ohmori

Tanaka

. High plasma levels of matrix metalloproteinase-8 in patients with unstable angina. Atherosclerosis 2010; 209: 206–210.

19.

Wang

Parry

Macones

. Functionally significant SNP MMP8 promoter haplotypes and preterm premature rupture of membranes (PPROM). Hum Mol Genet 2004; 13: 2659–2669.

20.

Decock

Long

Laxton

. Association of matrix metalloproteinase-8 gene variation with breast cancer prognosis. Cancer Res 2007; 67: 10214–10221.

21.

Gonzalez-Arriaga

Lopez-Cima

Fernandez-Somoano

. Polymorphism +17C/G in matrix metalloprotease MMP8 decreases lung cancer risk. BMC Cancer 2008; 8: 378–378.

22.

Lajunen

Vikatmaa

Ikonen

. Comparison of polymerase chain reaction methods, in situ hybridization, and enzyme immunoassay for detection of Chlamydia pneumoniae in atherosclerotic carotid plaques. Diagn Microbiol Infect Dis 2008; 61: 156–164.

23.

Nagase

Woessner

Jr, . Matrix metalloproteinases. J Biol Chem 1999; 274: 21491–21494.

24.

Kahari

Saarialho-Kere

. Matrix metalloproteinases in skin. Exp Dermatol 1997; 6: 199–213.

25.

McCawley

Matrisian

. Matrix metalloproteinases: multifunctional contributors to tumor progression. Mol Med Today 2000; 6: 149–156.

26.

Werb

. Matrix metalloproteinases: effectors of development and normal physiology. Genes Dev 2000; 14: 2123–2133.

27.

Laxton

Duchene

. A role of matrix metalloproteinase-8 in atherosclerosis. Circ Res 2009; 105: 921–929.

28.

Pradhan-Palikhe

Vesterinen

Tarkkanen

. Plasma level of tissue inhibitor of matrix metalloproteinase-1 but not that of matrix metalloproteinase-8 predicts survival in head and neck squamous cell cancer. Oral Oncol 2010; 46: 514–518.

29.

Qiu

Zhou

Zhai

. No association of MMP-7, MMP-8, and MMP-21 polymorphisms with the risk of hepatocellular carcinoma in a Chinese population. Cancer Epidemiol Biomarkers Prev 2008; 17: 2514–2518.

30.

Lee

Kim

Min

. Lack of association between matrix metalloproteinase 8 promoter polymorphism and bronchiectasis in Koreans. J Korean Med Sci 2007; 22: 667–671.

31.

Nagase

Visse

Murphy

. Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res 2006; 69: 562–573.

Single nucleotide polymorphism –799C/T in matrix metalloproteinase-8 promoter region in arterial disease

Abstract

Keywords

Introduction

Materials and methods

Patients

Reference group

DNA extractions

MMP-8 and TIMP-1 serum concentrations

Genotyping

Statistical analyses

Results

Discussion

Study limitations

Conclusions

Funding

Conflict of interest statement

References