To enhance the anti-aging and anti-inflammatory effect of bakuchiol and retinol by combining a tripeptide via the PPAR-γ signaling pathway

Abstract

Objectives

To prevent skin aging that induced by chronic inflammation and collagen depletion, along with the consequent decline in elasticity and wrinkles formation.

Methods

A novel formulation was developed to counter inflammatory and prevent collagen losing with low cytotoxicity to human foreskin fibroblast (HFF) cells, comprising bakuchiol and retinol at a 9:1 ratio (each at 10 uM) and combined with 50 ppm Trifluoroacetyl Tripeptide-2 (Anti-Pr 100, a PPAR-γ inhibitor).

Results

Colift-A enhanced the transcription levels of COL1A1 to 338.01%, COL3A1 to 150.61% and ELN to 248.28% of control levels. Concurrently, it effectively downregulated the transcription levels of pro-inflammation genes, particularly MIP-1α and IL-8, to 44.96% and 47.37% compared to controls, respectively. Clinically, Colift-A significantly improved skin aging indicators in participants, the undereye wrinkles reduced by 15.43% at 28 d and 15.87% at 56 days, crow’s feet decreased by 13.23% at 28 days and 13.74% at 56 days, and nasolabial folds were reduced by 20.20% at 28 days and 20.71% at 56 days. Additionally, skin elasticity, as measured by R2 values, improved by 20.79% at 28 days and 6.02% at 56 days.

Conclusions

A potential anti-aging and anti-inflammation formula is suggested, which effectively mitigates the appearance of skin wrinkles and laxity while maintaining skin elasticity, by inhibiting the PPAR-γ signaling pathway. The research Registration Number is: 11915, and the preclinical study has received approval from the Shanghai Ethics Committee and complied with the ethical standards outlined in the Declaration of Helsinki with (No. SECCR2024-184-01).

Introduction

Aging is an intricate and irreversible biological process marked by the progressive deterioration of cellular components, tissue architecture, and physiological functions. As a direct manifestation of organismal aging, skin aging is clinically characterized by wrinkle formation, xerosis (dryness), dermal atrophy of various organs, hyperpigmentation, and diminished elasticity.^1–3 Skin aging affects not only facial aesthetics but is also linked to psychological depression and reduced self-esteem. ⁴ Although aging is inevitable, it is feasible to slow the progression and ameliorate age-related phenotypes, particularly the context of skin aging appearance.^2,5 Consequently, extensive researches into the underlying mechanisms has facilitated the development of targeted anti-aging strategies, and has achieved notable success in the cosmetic industry.^6,7

Numerous compounds have been screened to prevent or mitigate aging-related cellar changes, which are based on the understanding of target molecules. For instance, curcumin, extracted from the root of Curcuma longa, prolongs lifespan through multi-target regulation. Its core mechanisms include antioxidant effects via the elimination of reactive oxygen species (ROS), blockade of inflammatory signaling pathways such as nuclear factor-kB (NF-kB), inhibition ofinterleukin-6 (IL-6) release, and downregulation the expression levels of aging-related genes (e.g., dInR, Hsp68 and GstD1). However, its sensitivity to light and heat, coupled with low transdermal absorption efficiency, limits its application in cosmetics. ⁸ Ginsenoside K (CK), one kind of extract from ginsenoside, activates the AMPK pathway and promotes collagen IV synthesis. Additionally, CK inhibits the expression of matrix metalloproteinase-1(MMP-1), which is a key mediator of collagen degradation. Nevertheless, its scarcity and high cost restrict its application in the cosmetics industry. ⁹ Bakuchiol and the mitochondrial-targeted antioxidant ergothioneine have also been reported to possess anti-aging functions. Moreover, some additional novel compounds continue to be screened out. Wang et al. developed a nonapeptide that prevents skin photoaging by upregulating the expression level of Type-I collagen via inhibition of the mTOR pathway. ¹⁰ Thiazolidinediones (TZDs) prolonged the lifespan of model animals as PPAR-γ agonist by delaying age-associated disease, such as inflammation, diabetes, tissue atrophy, cognitive decline, and anxiety-or depression-like behaviors, without exerting adverse effects on cardiac and skeletal function. ¹¹ Among the reported anti-aging compounds, Vitamin A (also known as retinol) and its derivatives stand out as prominent anti-aging agents. Retinol exhibits diverse anti-aging and anti-inflammatory properties, including stimulating collagen synthesis, accelerating epidermal cell turnover, regulating sebaceous gland activity, and inhibiting melanogenesis. These actions collectively contribute to increased epidermal thickness.^12,13 However, achieving these benefits typically requires high concentrations of retinol (typically 0.3%) ¹⁴ which often leads to unforeseen adverse effects such as desquamation, erythema, and sensory discomfort, particularly in the Chinese population.^15–18 Despite these drawbacks, the excellent anti-aging and newly revealed anti-inflammatory properties, coupled with the stable chemical structure of retinoids, have driven their popularity and substantial demand in cosmetic formulations. ¹⁹ To mitigate the side effects of retinol, chemical modulation and the screening of functional retinol analogues have also been carried out and achieved notable advancements. Several promising compounds have been suggested, such as bakuchiol, retinyl palmitate, and hydroxypinacolone retinoate. ²⁰ Furthermore, to achieve effective anti-aging effects at safe retinol concentrations, two primary strategies have been proposed. The first utilizes advanced packaging and supramolecular technologies to stabilize retinol and prolong its sustained release at reduced concentrations. The second strategy focuses on chemical modulation or synergistic combinations of retinol with other compounds to enhance anti-aging or anti-inflammatory signaling pathways once retinol enters the nucleus.^20,21 Notably, the former approach is widely adopted in cosmetic formulations and protected by numerous patents, whereas the latter remains relatively underexplored. Consequently, significant efforts have been dedicated to investigating and elucidating the potential mechanisms underlying the synergetic interactions.

Peroxisome proliferator-activated receptors (PPARs) are a class of nuclear receptors that play a crucial role in various biological processes, including cell differentiation, lipid metabolism, and inflammation regulation.^22–24 Specifically, PPAR-γ forms a functional heterodimer with retinoic acid receptor RXR to regulate the transcriptional programs that involved in metabolism and stress responses, and it engages in dynamic crosstalk with Sirt1 and mTOR related signaling pathways. Dysregulation of the network leads to metabolic disorders, mitochondrial dysfunction, impaired lipid homeostasis, and cellular senescence. ²⁵ Similarly, retinoic acid receptor (RARs or RXRs) binds the metabolites of retinol and initiate anti-aging effects by upregulating collagen production genes through related signaling pathways, thereby promoting skin rejuvenation. ²⁶ Moreover, retinol can activate PPARs, stimulating anti-aging effects that include the upregulation on the expression level of antioxidant-related proteins, collagen synthesis, and anti-inflammatory factor production.^27,28

It is reasonable to exploit anti-aging agents by targeting PPARs and aging-related signaling pathways, including some bioactive peptides. ²⁹ Notably, compound combinations often exhibit synergistic bioactivity even at concentrations below their individual IC₅₀ values. ³⁰ Therefore, combining retinol with PPAR-modulating peptides may enhance the anti-aging properties of naturally derived compounds while minimizing side effects.

In this study, we developed a novel anti-aging formulation that demonstrated enhanced anti-aging and anti-inflammatory bioactivities through synergistic effects, primarily via the activation of the PPAR-γ signaling pathway.

Methods and materials

Materials

Bakuchiol (≥95.0% HPLC pure) obtained from Syntheon (Tokyo, Japan). Retinol (RA, ≥95.0% HPLC pure), hydroxypinacolone retinoate (HPR, ≥95.0% HPLC pure) and retinyl propionate (RP, ≥98.0% HPLC pure) were purchased from Sigma Co., Ltd. The CCK-8 kit was purchased from Beyotime (Shanghai, China). DMEM was purchased from Viva Cell, USA. Fetal bovine serum (FBS) and penicillin–streptomycin was purchased from Gibco (USA). RNA Reverse Transcription Mix and the qPCR Probe were purchased from Adamas Life (China). The Trizol Reagent, QuantiGene TM Plex Assay Kit, TaqMan probes were purchased from Thermo Fisher Scientific (USA). ZPC®Repairs012P (Copper Tripeptide-1, Re 012), ZPC®Creasend011P (Palmitoyl Tripeptide-5, Cr 011), ZPC®Creasend077P (Palmitoyl Tripeptide-8, Cr 077), ZPC®Eyepep001P (Acetyl Tripeptide-5, Ey 001), ZPC®Eyelash006P (Myristoyl Tripeptide-4, Ey 006), ZPC®Melanopep090P (Me 090), ZPC-Collagen045P (Hexapeptide-9, Co 045), ZPC-Anti-protease100P (Trifluoroacetyl Tripeptide-2, Anti-Pr 100) and ZPC®Wrinklend008P (Acetyl Hexapeptide-8, Wr 008) were obtained from Shanghai Peptide Biotechnology Co. Ltd., PR China. Primary antibodies used in the immunofluorescence assay included Anti-Collagen I antibody and Anti-PPAR antibody, both purchased from Abcam (Cambridge, UK, ab260043 and ab45036). Each primary antibody was diluted at a ratio of 1:250 with appropriate antibody diluent to prepare the working concentration. The secondary antibody was Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488), which was also obtained from Abcam (Cambridge, UK, ab150077). It was diluted to the optimal working concentration at a ratio of 1:1000 in antibody diluent to specifically bind to the primary antibodies. The QuantiGene™ Plex Assay Kit (catalog number: QP1013 with a linkage of https://documents. thermosifher.cn/TFS-Asset%2FBID%2Fmanuals%2FTFS-assets_BID_manual_ Man0017269_Quantigen- PlexAssay) and TaqMan probes (catalog number: QGP-143), along with Trizol Reagent, were purchased from Thermo Fisher Scientific (USA).The instruments used in the experiment included the Luminex 200 Suspension Bead Array Multiplex Detection System and the Bio-Plex Pro Automated Washer, both manufactured by BIO-RAD. The model of the Luminex 200 Suspension Bead Array Multiplex Detection System was Bio-Plex 200 (catalog number: 171000201), and the model of the Bio-Plex Pro Automated Washer was Bio-Plex PRO (catalog number: 30034376).

Cell culture and viability assay

The viability of human foreskin fibroblast cells (HFF) (CRL2429, ATCC) was assessed using CCK-8 kit. Briefly, cells were seeded at a density of 6×10³ cells/well in 96-well plate using DMEM (Viva Cell, China) with 10% FBS (Gibco, USA), added 1% penicillin and streptomycin (Gibco, USA). After incubation for 24 h at 37 °C in a 5% CO₂ incubator(Thermo Fisher Scientific 160i), cells were exposed to various concentrations of test compounds or combinations for another 24 h. Cell viability was assayed using CCK-8 kit following the manufacturer’s instructions. The brand of the microplate reader is Molecular Devices, and its model is SpectraMax iD3. Relative cell viability (%) = (absorbance of OD₄₅₀ of the experimental group/OD₄₅₀ of the control group) × 100%.

Gene quantification assay using QuantiGene Plex assay

HFF cells were seeded at a density of 6×10⁴ cells/well in 24-well plates. After adherence, varying concentrations of test compounds or combinations were added to the wells and incubated for 24 h. Then the cell pellets were lysed with 0.2 mL of cell lysis buffer and used for the QuantiGeneTM Plex Assay according to the manufacturer’s instructions (QuantiGeneTM Plex Assay Kit, Thermo Fisher Scientific, USA). Briefly, 80 μL of cell lysates/diluted lysate was mixed with 20 μL working bead solution per well and incubated at 54±1°C with shaking at 600 rpm for 20 h. The hybridization plate was then centrifuged, and the supernatant was transferred onto a magnetic separation plate and incubated for 1 min. Amplification was performed by adding preamplifier solution, followed by the addition of label probe solution and SAPE binding. after the reaction, the plates were washed three times with 130 μL of SAPE wash buffer. Finally, the results were detected and analyzed using the Luminex200 Suspension Multiple Array Detection System (BIO-RAD, Bio-Plex PROTM, USA). A schematic representation of the QuantiGene Plex protocol is shown in Figure 1.

Figure 1.

Schematic of QuantiGene Plex protocol for gene expression detection in human foreskin fibroblast (HFF) cells.

Real-time PCR assay

The transcription levels of anti-aging and anti-inflammation related genes were analyzed using real-time PCR as follows: cellular RNA was isolated from 6.0x10⁸ HFF cells after 24 h treated with varying concentrations of the test compounds using Trizol Reagent (Thermo Fisher Scientific, USA) according to the manufacturer’s recommended protocol. RNA concentration was measured using a multimode microplate reader (Molecular Devices). Then, 1 µg of total RNA was reverse-transcribed into cDNA using 5× Reverse Transcription Mix (Adamas life, China) in a 20 µL reaction volume under the following conditions: 42 °C for 15 minutes, followed by 30 s at 95 °C. primer sequences used for RT-qPCR are listed in Table 1.

Table 1.

Primer sequences for RT-qPCR analysis.

Gene symbol	Probe sequence
COL1A1	Forward primer: CCTGGAAAGAATGGAGATGATG
	Reverse primer: CAAACCACTGAAACCTCTGTGTC
COL3A1	Forward primer: CCTAATGGTCAAGGACCTCAAG
	Reverse primer: CAGTAGGGCATGATTCACAGATT
ELN	Forward primer: CAGGGGTTGTGTCACCAGAAG
	Reverse primer: CTCCAACCCCGTAAGTAGGAAT
IL17A	Forward primer: CCCAAATTCTGAGGACAAGAAC
	Reverse primer: GTGAGGTGGATCGGTTGTAGTAA
HAS2	Forward primer: GCTCGATCTAAGTGCCTTACTGA
	Reverse primer: TGTACAGCCATTCTCGGAAGTAG
PPAR-γ	Forward primer: TCTTAACTGTCGGATCCACAAAA
	Reverse primer: GCATTATGAGACATCCCCACT
GADPH	Forward primer: GAAGGCTGGGGCTCATTT
	Reverse primer: CAGGAGGCATTGCTGATGAT

The transcription levels of candidate genes were quantified using qPCR Master Mix (Adamas Life, China) and TaqMan probes (Thermo Fisher Scientific, USA) according to the suggestion of the manufacturer. Briefly, real-time qPCR was performed on a QuantStudio™ 5 real-time PCR System (Thermo Fisher Scientific, USA) with the following cycling conditions: 95 °C for 5 min (initial denaturation), followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The expression levels of target mRNA were normalized to the internal reference gene GAPDH using the 2^−ΔΔCt method.

Protein microarray analysis

Protein expression levels were quantified using a protein microarray assay (catalog number:12007283). Cell lysate samples were prepared and analyzed following manufacturer’s instruction. The Bio-Plex multiplex immunoassay system (Bio-Rad, Hercules, CA, USA) was preheated for 30 min and calibrated with 1x wash buffer. For standard curve preparation, 750 μL of standard diluent HB served as blank control. A mixture consisting of 250μL standard diluent HB and 500μL cell lysate was prepared in a control vial, vortexed at 150 rpm for 5 s, and incubated at 4 °C for 30 min. The detection procedure was performed as follows: First, the filter plate was wetted with 1x Bio-Plex assay buffer, followed by the addition of 1x beads. Then, 500μL of samples were added to the reaction system, alongside the simultaneous preparing of standard, blank and control groups. After incubation for 30 min at 30°C, the plate was washed with 1x wash buffer. Subsequently, 1xdetection antibodies and 1x streptavidin-phycoerythrin (SA-PE) were added, and incubated the plate at 30°C for another 30 min. After a final wash, assay buffer was added, the Bio-Plex operating system was configured by inputting the standard S1 value and setting as the specified unit for the reagent. Upon completion of detection, sample values were analyzed using SPSS software.

Immunofluorescence staining assay

The expression levels of the candidate proteins were detected using immune-fluorescence staining. Briefly, HFF cells were seeded into 24-well plates at a density of 1×10⁵ cells/well in 0.2 mL culture medium and incubated for 24 h at 37 °C in a humidified atmosphere containing 5% CO₂. Negative control, positive control and sample groups were established, with three replicate wells per sample. Cells were then collected and rinsed for thrice with PBS, fixed with 100% methanol, followed by three additional PBS rinses, and blocked with 1% BSA (1 mL per well) for 1 h. After removing the blocking solution, 5 µg/mL primary antibody was added to each well and incubated overnight at 4°C. Following removal of the primary antibody, the cells were washed three times with PBS. Secondary antibody was then added to each well and incubated for an additional 2 h, followed by three additional washes after discarding the secondary antibody. The determination of PPAR-γ expression levels via immunofluorescence staining method was performed by quantitative analysis of PPAR fluorescence intensity using Image Pro Plus software (Version 6.0, Media Cybernetics, USA), following the standard operating procedures. Specifically, immunofluorescence images of HFF cells were acquired under a fluorescence microscope with fixed exposure time and gain settings to ensure the comparability of fluorescence intensity among different groups. After Images were imported into Image Pro Plus software, background correction was conducted by measuring the average gray value of the cell-free regions and subtracting the value from the target area to eliminate the interference of non-specific fluorescence and uneven illumination. Subsequently, regions of interest (ROI) were manually selected using the tracing tool to enclose the HFF cells in each image, and 5-10 random visual fields were selected for each sample to minimize subjective bias. The integrated optical density (IOD) and area of each ROI were measured, and the mean fluorescence intensity (MFI) was calculated as IOD divided by the area to reflect the relative expression level of PPAR-γ.

As for nuclear staining, 1.43 µM DAPI was added into each sample and incubated for 10 min. After discarding the staining solution, the cells were washed thrice with PBS, and images were captured using fluorescence microscope (Leica, Germany).

Human efficacy testing

(1) study design and participants

A double-blind, placebo-controlled clinical trial was conducted from January to March 2025, involving 97 Chinese female participants aged 30-60 years (mean age: 49.6± 3 years). Of these, 94 participants completed the study, with two discontinuing due to mild irritation caused by the test substance and one withdrawing for personal reasons.

All participants underwent eligibility screening by dermatologists. Comprehensive information regarding the study’s benefits and risks was provided, and written informed consents were obtained. The study protocol (No. SECCR2024-184-01) received approval from the Shanghai Ethics Committee and complied with the ethical standards outlined in the Declaration of Helsinki.

(2) inclusion and exclusion criteria

Eligible participants exhibited baseline clinical score of ≥2 for crow’s feet, ≥1 for under-eye wrinkles, and ≥1 for nasolabial folds was assessed by the Lesulis scale. The exclusion criteria included: pregnancy or plans for pregnancy, breastfeeding, known allergies to cosmetics products, severe systemic allergies, chronic systemic diseases, and significant dermatological conditions. Additionally, participants were also required to avoid retinol-containing products for 3 months prior to the study enrollment and maintain consistent use of Colift-A containing day and night serum emulsions‌ during the study period.

(3) intervention groups

Participants were divided into three treatment groups randomly and evaluated the effect of the emulsions:

① Group II (n=30): 0.3% Retinol serum emulsion applied‌‌.

② Group I (n=33): Colift-A serum emulsion applied‌.

③ Group III (n=31): Placebo serum emulsion‌ applied‌.

Phase 1: Patch test evaluation of anti-aging serum emulsion

A controlled patch-test study was conducted to assess potential cutaneous allergic responses (e.g., contact dermatitis) associated with Colift-A formulations in 30 healthy participants (aged 18-65 years). Four Finn Chambers were affixed to each participant’s upper back that were filled with the following test materials: (1) 0.3% Retinol serum emulsion, (2) Colift-A serum emulsion, (3) placebo emulsion, and (4) blank control (vehicle only). After 24 h of occlusive exposure, the chambers were removed and cutaneous reactions were assessed at 30 min, 24h, and 48h post-removal according to the scoring criteria specified in the Safety and Technical Standards for Cosmetics.

Phase 2: Clinical safety and efficacy assessment of Colift-A serum emulsion

All enrolled participants followed a standardized application protocol. Briefly, following daily facial cleansing, a predetermined amount dose of one fingertip unit (FTU is 0.5 g) of the assigned serum emulsion‌ was evenly applied to the entire face once daily throughout the 8-week intervention period. Clinical assessments were performed at three timepoints: baseline (day 0), interim (week 4), and endpoint (week 8). Prior to each evaluation, participants followed a standardized preparation protocol comprising: (1) gentle facial cleansing, (2) pat-drying with lint-free paper towels, and (3) a 30-min acclimatization period in a climate-regulated chamber (20-22 °C, 40-60% relative humidity) to minimize environmental variability.

The biomechanical properties of facial skin were assessed using the Cutometer® MPA580 (Courage + Khazaka GmbH), a non-invasive suction-based device that evaluates cutaneous viscoelasticity through dynamic deformation-recovery cycles, with R₂ (Gross Elasticity Ratio) as the primary parameter. Crow’s feet and undereye wrinkles were analyzed using a PRIMOS-Lite 3D Roughness Analyzer (LMI Technologies), with data expressed as wrinkle area percentage (ratio of wrinkled surface to total region of interest). standardized clinical photographs were captured using VISIA® Complexion Analysis System (Canfield Scientific) under cross-polarized lighting, while nasolabial fold area was quantified using an integrated morphometric algorithm.

This study was registered post-study at the Research Registry (https://www.researchregistry.com/), and the registration number is: 11915 and all the preclinical study has received approval from the Shanghai Ethics Committee and complied with the ethical standards outlined in the Declaration of Helsinki with (No. SECCR2024-184-01). The reporting of this study conforms to CONSORT guidelines.

Statistical analysis

All statistical analysis were performed using GraphPad Prism soft version 8.0.2 (GraphPad Software Inc.) and IBM SPSS version 25.0. Data were presented as mean ± standard deviation (SD). Statistical significance was evaluated using one-way ANOVA with Tukey’s post-hoc test for multiple comparisons, and indicated with *p<0.05, **p<0.01, while p≥0.05 was considered not statistically significant.

Results

Optimization of bakuchiol, retinol derivatives and their combinations on cytotoxicity

The cytotoxicity of retinol, bakuchiol, RP, and HPR against HFF cells was evaluated at concentrations of 1 μM, 10 μM, and 100 μM using the CCK-8 assay. At concentrations below 10 μM, all compounds exhibited minimal cytotoxicity to HFF cells, the viability exceeds 95%. Even at 100 μM, the cell viability remained at 87.5%, 69.3%, 88.5% and 91.2% for retinol, bakuchiol, RP and HPR respectively, as Figure 2 (a-d) shown. The results indicate that these compounds are safe for HFF cells within a concentration of 100 μM. Therefore, a concentration of 10 μM for each compound was selected for subsequent formulation optimization.

Figure 2.

Cell viability of different concentration of bakuchiol, retinol, RP, and HPR.Cell viability was measured by Cell Counting Kit-8 (CCK-8) assay. HFF cells were seeded at 6×10³ cells/well and treated with test compounds for 24 h. Data are presented as mean ± standard deviation (SD) from 3 independent experiments with 3 replicates per group. The negative control (NC) was defined as HFF cells treated with an equal volume of solvent only.

Pairwise combinations of the compounds demonstrated synergistic effects and enhanced bioactivity compared to individual components. The cell viability of HFF cells treated with bakuchiol: retinol at ratios of 9:1, 5:5, and 1:9 (each at 10 μM) was 102.8%, 102.3%, and 89.9%, respectively as Figure 3(a) shown. Similarly, combinations of bakuchiol with RP at the same ratios yielded cell viabilities of 104.9%, 95.5%, and 99.6% (Figure 3(b)), while bakuchiol combinations resulted in viabilities of 101.4%, 104.9% and 105.2% (Figure 3(c)). These results indicated that all the tested combination of bakuchiol with retinol, RP and HPR at the selected ratio and concentration (10 μM) were non-cytotoxic to HFF cells. Notably, reducing the retinol proportion to below 5:5 in the mixture mitigated its inherent cytotoxicity, as evidenced by the higher cell viability observed in the 9:1 ratio group compared to the 5:5 and 1:9 ratios as Figure 3(a) shown.

Figure 3.

Cell viability of bakuchiol combined with retinol derivatives using CCK-8 test.HFF cells were seeded at 6×10³ cells/well and treated with test combinations for 24 h. All ratios refer to molar ratios, with each component at a final concentration of 10 uM. Data are presented as mean ± SD from 3 independent experiments with 3 replicates per group. NC: HFF cells treated with an equal volume of solvent only.

Quantitative detection of anti-aging and anti-inflammation related genes

QuantiGene Plex assay results demonstrated that the compounds combination significantly upregulated the transcription level of anti-aging-related genes in HFF cells, including COL1A1, AQP 3, FN1 and HAS3, IL1, IL6, HMOX1 and TIMP3. Notably, the 9:1 bakuchiol: RA combination at 10 μM each markedly up-regulated the transcription levels of COL1A1 (p<0.01), AQP 3 (p<0.05) and HAS 3. This modulation is likely to enhance the ability of skin cells retain hydration and elasticity. Concurrently, the combination downregulated the transcription level of MMP 1 gene (p<0.01), which prevents collagen and matrix protein degradation, thereby to maintain skin elasticity and a youthful appearance. Similarly, both the 1:9 and 5:5 bakuchiol: retinol ratios significantly upregulate significantly the transcription level of COL1A1 gene (p<0.01) and downregulate MMP 1 gene (p<0.01) (Fig. 4a). These findings collectively indicated that the combination of bakuchiol and retinol effectively modulated the transcription of aging-related genes.

When bakuchiol mixed with RP at a ratio of 1:9 (10 μM each), the mRNA levels of COL1A1 (p<0.05), TIMP 3 (p<0.01) and HMOX 1(p<0.05) gene were all enhanced in HFF cells. The 5:5 bakuchiol: RP ratio (10 μM each) decreased the transcription levels of IL1A and IL1B genes (p<0.01) while increasing TIMP3 (p<0.05). The ratio of 9:1 group of bakuchiol to RP did not show the same excellent results as the above two groups as Figure 4(b) shown. when compared with the 9:1 ratio of bakuchiol to RP group, there has no statistically significant difference in the expression levels of target genes. Given the high price of RP, we selected the 9:1 ratio as the optimal choice.

Figure 4.

Gene expression levels modulated by bakuchiol combined with retinol derivatives.HFF cells were seeded at 6×10⁴ cells/well and treated with test combinations for 24 h. All ratios refer to molar ratios, with each component at a final concentration of 10 μM. Statistical analysis was performed by one-way ANOVA followed by Tukey’s post-hoc test. Data are presented as mean ± SD from 3 independent experiments with 3 replicates per group.

As for the combination of bakuchiol: HPR at a ratio of 9:1(10 μM each), it could also induce the transcription of collagen-related genes, such as COL7A1, COL1A1 and AQP3 as well as the anti-oxidant and anti-inflammatory gene HMOX1, as Figure 4(c) shown, the mRNA level were 1.9-fold higher than the negative control group. Additionally, it significantly reduced the mRNA level of the inflammation-related gene IL1B (p<0.05) and matrix degradation-related MMP3 and MMP1 genes (p<0.05).

A total of 41 genes exhibited statistically changes in transcription levels in HFF cells following incubation with the compound combination, as measured by the QuantiGene Plex assay. Five genes demonstrated the most pronounced transcriptional differences when bakuchiol was mixed with each of the three other retinols (RA, HPR, RP) at a ratio of 9:1 at 10 μM each, as Figure 4(d) shown, compared to the negative control. These included upregulated collagen synthesis-related TIMP2, AQP3 and COL1A1 genes (p<0.05) as well as the downregulated matrix degradation related FN1 and MMP1 genes (p<0.01).

Enhanced effect of combined compounds on anti-aging and anti-inflammation related genes expression

To further quantify the expression levels of the selected genes after incubation with 10 μM bakuchiol mixed with retinoids (RA, HPR, and RP) at a 9:1 ratio in HFF cells, qPCR detection was performed using the high throughput QuantiGene Plex assay.

The expression level of COL1A1 gene was significantly upregulated (p<0.01) in all three combinations, as Figure 5 shown. Additionally, the expression levels of COL3A1 and ELN genes were elevated to 3.38 and 2.48-fold, s, respectively, compared to controls in the bakuchiol: retinol (9:1) combination group (p<0.01). These results indicated that the bakuchiol: RA (9:1) combination at 10 μM exhibited superior anti-aging efficacy among the tested formulations.

Figure 5.

Relative gene expression levels confirmed with real-time PCR of bakuchiol with RA, RP, and HRP at 10 μM with 9:1 ratio.HFF cells were treated with 9:1 (molar ratio) bakuchiol-RA, bakuchiol-RP and bakuchiol-HPR combinations (10 μM each) for 24 h. GAPDH was used as the internal reference gene, and relative gene expression was calculated using the 2^-ΔΔCt method. Statistical analysis was performed by one-way ANOVA followed by Tukey’s post-hoc test. Data are presented as mean ± SD from 3 independent experiments with 3 replicates per group.

Screening of PPAR-γ agonist

Peroxisome proliferator-activated receptors (PPARs) are members of the ligand-activated nuclear hormone receptor family, which play crucial roles in skin barrier repair, autoimmune regulation, and the modulation of inflammatory diseases. Molecules targeting the PPARs pathway have been proposed as potential anti-aging therapeutic candidates. ³¹ Nine kinds of peptides (Re 012, Cr 011, Cr 077, Ey 001, Ey 006, Me 090, Co 045, Anti-Pr 100, Wr 008) were screened out from the peptide library based on their significant bioactivity in enhancing PPAR-γ protein expression at a concentration of 50 ppm, as assessed by real-time PCR. Among these, the peptides Cr 077 and Anti-Pr100 exhibited remarkable agonist efficacy on PPAR-γ, as Figure 6(a) shown. The upregulation effect of Cr 077 and Anti-Pr100 on the expression levels of PPAR-γ was further validated using immunofluorescence assays. The relative fluorescence intensity increased by 26.1%, 22.3% and 15.7%, respectively, after incubation with the positive control (TGF-β), Anti-Pr 100, Cr 077 and the negative in HFF cells as Fig. 6(b), 6(c) shown. The results indicate that the Trifluoroacetyl Tripeptide Anti-Pr 100 has superior efficacy in initiating PPAR-γ expression.

Figure 6.

The nine screened out PPAR-γ agonists from a peptide library and inhibition confirmation.HFF cells were treated with 50 ppm of each candidate peptide for 24 h. Statistical analysis was performed by one-way ANOVA followed by Tukey’s post-hoc test. Data are presented as mean ± SD from 3 independent experiments with 3 replicates per group. NC: HFF cells treated with an equal volume of solvent only.

Synergistic effect of bakuchiol and retinol combinations with PPAR-γ agonist peptide

To investigate whether the combination of bakuchiol and retinol with the selected PPAR-γ agonist peptide (anti-Pr 100) had superior anti-aging efficacy, a novel formulation was optimized and designated as Colift-A. It contains 10 μM bakuchiol: retinol at a 9:1 ratio, supplemented with 50 ppm anti-Pr 100. The cell viability of Colift-A was 95.2% in HFFs, as Figure 7(a) shown, indicating minimal cytotoxicity. The transcription levels of COL1A1, COL3A1 and ELN genes were all upregulated after incubation with Colift-A (p<0.01), as Figure 7(b) shown. Protein microarray analysis results further demonstrated that Colift-A effectively suppressed the expression of pro-inflammatory cytokines, such as GM-CSF, FGF basic, MIP-1α, and IL-8 (Figure 7(c)). Notably, its anti-inflammatory efficacy surpassed that of the positive control (TGF-β), highlighting the superior therapeutic potential of the formulation.

Figure 7.

Synergistic anti-aging and anti-inflammation effects induced by Colift-A.Colift-A consists of bakuchiol and retinol at a 9:1 molar ratio (10 uM each) supplemented with 50 ppm Trifluoroacetyl Tripeptide-2. HFF cells were treated with Colift-A for 24 h. Primary and secondary antibodies were diluted according to the manufacturer’s instructions for immunofluorescence assays. Statistical analysis was performed by one-way ANOVA followed by Tukey’s post-hoc test. Data are presented as mean ± SD from 3 independent experiments with 3 replicates per group. NC: HFF cells treated with an equal volume of solvent only.

To further validate the anti-aging effects of Colift-A, immunofluorescence analysis was performed to assess the COL1A1 protein level. As Figures 7(d) and 7(e) showed, Colift-A treatment resulted in the highest fluorescence intensity among the negative control (NC), positive control (PC), bakuchiol: retinol (9:1) and Colift-A groups. Colift-A exhibited a 1.2-fold higher intensity than the bakuchiol: retinol (9:1) group, underscoring its potential anti-aging properties.

Anti-aging analysis in volunteer cohort

Phase 1: Cutaneous irritation assessment of anti-aging emulsion patch

In the occlusive patch test, none of the participants exhibited cutaneous irritation after treatment with Colift-A emulsion. In contrast, mild erythema was noted in 16.7% of participants (5/30) exposed to the 0.3% retinol formulation and 3.3% (1/30) of those in the placebo group. These transient reactions resolved spontaneously within 48 h without intervention.

Phase 2: Safety and efficacy evaluation of anti-aging serum emulsion

As illustrated in Figure 8 and Table 2, assessment of skin aging parameters before and after application of the Colift-A serum emulsion revealed significant improvements in the Colift-A group compared to the negative control, positive control, and placebo groups at both 28 and 56 days.

Figure 8.

Analysis of the efficacy of different anti-aging serum emulsions‌. Clinical assessments were performed at baseline (D0), day 28 (D28) and day 56 (D56). Statistical analysis was performed by paired t-test (intra-group comparison) and one-way ANOVA followed by Tukey’s post-hoc test (inter-group comparison).

Table 2.

A summary of skin aging parameters before and after usage of the serum emulsion.

Parameter	Colif-Agroup (n=33)	p-value	0.3% A group(n=30)	p-value	Placebo group(n=31)	p-value
Crow’s feet
D0	70.67±17.96	-	77.81±20.22	-	58.95±40.22	-
D28	64.31±16.09	***	67.90±19.03	***	55.83±38.34	n.s.
D56	60.95±16.81	***	67.51±19.18	***	56.31±40.70	n.s.
Under-eye wrinkles
D0	85.83±24.84	-	81.57±24.07	-	31.13±22.39	-
D28	72.59±21.15	***	69.54±20.27	***	30.35±20.25	n.s.
D56	72.21±22.03	***	69.37±19.89	***	30.34±20.18	n.s.
Nasolabial fold
D0	22.30±10.7	-	23.88±11.37	-	22.10±11.60	-
D28	17.80±8.73	**	22.36±12.5	n.s.	23.34±12.2	n.s.
D56	17.68±7.53	**	22.10±13.9	n.s.	24.03±12.2	n.s.
Skin elasticity (R2)
D0	50.46±8.10	-	53.08±6.83	-	54.31±8.75	-
D28	60.95±8.21	***	61.65±10.09	***	58.74±9.80	n.s.
D56	53.50±6.88	*	57.07±7.79	*	51.25±7.84	n.s.

*p≤0.05.

**p≤0.01.

***p≤0.001.

In the Colift-A emulsion cohort, the mean reduction in under-eye wrinkle area was 15.43% at day 28 and 15.87% at day 56. Additionally, crow’s feet dryness and elasticity improved by 13.23% and 13.74%, respectively, while nasolabial fold depth decreased by 20.20% at day 28 and 20.71% at day 56. These changes were accompanied by increased elasticity values in R2, reaching 20.79% at day 28 and 10.02% at day 56, as Figure 9 shown. These findings suggest that the Colift-A emulsion has the potential to maintain a youthful skin appearance, with notable reductions in wrinkles, particularly in the undereye area, crow’s feet, and nasolabial fold after 56 days of treatment. The volunteer cohort also exhibited visible periocular and mid-facial rejuvenation.

Figure 9.

Examples of in vivo anti-aging efficacy after 56 d of Colift-A usage.All images were captured using the VISIA® Complexion Analysis System under cross-polarized lighting. The images shown are from the same participant before and after treatment. The study was approved by the Shanghai Ethics Committee, and all participants provided written informed consent.

No treatment-related adverse events were reported in the Colift-A group during the trial. In the 0.3% retinol group, a single participant reported facial acne, which confirmed the favorable safety profile of the Colift-A formulation. Nonetheless, further investigation into individual susceptibility factors is warranted to ensure clinical safety.

In the placebo group, no statistically significant improvements were observed in key anti-aging biomarkers, consistent with the expected lack of efficacy of non-active formulations. Notably, one participant in the placebo group reported transient facial dryness during the trial, which was likely attributable to the vehicle formulation rather than to any therapeutic activity.

Discussion

Retinol (RA) exerts anti-aging effects through multiple mechanisms, including the maintenance of epidermal homeostasis, promoting collagen synthesis, and attenuating wrinkle formation.^14,31 However, its clinical application is limited by three major drawbacks: pronounced dermal irritation, poor chemical stability, and notable photosensitivity.^24,32,33 To mitigate the shortcomings of retinol, researchers have made considerable efforts to structurally modify retinol and improve its application strategies, among which combination with other functional compounds has shown particular advantages. ³⁴ In this study, we found that the combination of bakuchiol with retinol and its derivatives (HPR, RP) significantly modulated the transcription of skin anti-aging related genes, which is highly consistent with the established biological functions of retinoids. As previously reported, HPR can bind to retinoic acid receptors (RAR/RXR) to promote cell proliferation and extracellular matrix synthesis, aligning with our findings that the bakuchiol-HPR combination significantly upregulated collagen-related genes (COL1A1, COL7A1) and the barrier-related gene AQP3. Meanwhile, RP, another retinol derivative, has been shown to possess superior antioxidant, anti-inflammatory and collagen synthesis-promoting activities, with lower irritation and phototoxicity than native retinol.^35–37 This explains the significant upregulation of HMOX1 and TIMP3, as well as the downregulation of pro-inflammatory genes IL1A/IL1B in the bakuchiol-RP treatment group in our experiments. Collectively, the inherently low-irritation and high-efficiency anti-aging properties of retinol derivatives provide a biological basis for the synergistic effect of the compound combination developed in this study.^35,36

Recent research has identified novel compounds with retinol-like activity but improved safety profiles. Among these, bakuchiol has been found to exhibit similar bioactivity and mechanisms to retinol. More specifically, bakuchiol activates a kind of lipid chaperon that mediates the transport of retinoids and initiate their bioactivity. ³⁶ Bakuchiol targets certain retinoic acid-like cell signaling pathways and upregulates collagen and extracellular matrix synthesis, however, it displays lower anti-aging bioactivity than retinol.^37,38 Compared to retinol, bakuchiol is more stable and less irritating. Notably, synergistic combinations of bakuchiol with retinol have been shown to mutually enhance the stability of RA while maintaining therapeutic efficacy. ¹⁶

To optimize the favorable therapeutic index of retinols while mitigating their drawbacks, researchers have proposed leveraging their synergistic effects with other compounds. ³⁸ In this study, an innovative multi-component formulation was developed to evaluate its anti-aging efficacy and the irritate side-effects. Bakuchiol was combined with RA, HPR and RP at various ratios. Systematic evaluation identified that a 9:1 molar ratio (10 μM each) exhibited significant anti-aging effects without cytotoxicity. Mechanistic studies revealed that the combination upregulated the gene transcription levels of COL1A1 (P < 0.01), the extracellular matrix integrity-related gene TIMP2, and hydration pathways related genes AQP3, and FN1 (p<0.05), while concurrently suppressing the expression of the matrix metalloproteinase activity gene MMP1 and the pro-inflammatory cytokine gene IL17α (p<0.01). These results established the dual functionality of the formulation in protecting the dermal regeneration while inhibiting inflammatory cascades, as Figures 4 and 5 shown, suggesting promising clinical applications for skin anti-aging and anti-inflammatory conditions.

PPARs are a class of nuclear receptors that regulate cellular development and regeneration. They have been identified as target molecules in the initiation of skin barrier repair processes. ³⁹ PPARs participate in various biological functions, including cell regeneration, differentiation, regulation of inflammatory factors and lipid metabolism.^40–42 The regulatory role of PPAR genes in keratinocyte proliferation and differentiation was confirmed using PPAR-knockout mouse models. ⁴³ PPAR gene expression levels have been shown to increase rapidly following hair plucking or cutaneous injury. In PPAR heterozygous mice, the skin wound-healing period was prolonged due to disrupted proliferation-apoptosis balance and impaired collagen metabolism. Based on these findings, strategies and compounds that target PPAR have spurred interest in the development of related cosmetic products. Furthermore, reduced expression levels of the PPAR-γ gene have been found to promote myofibroblast accumulation, leading to organ fibrosis and skin stiffening. ⁴⁴ Recently, rosiglitazone, a type of PPAR-γ agonist, was shown to induce the expression of retinaldehyde dehydrogenase (Raldh) 1 and 2 in dendritic cells and to ameliorated cellular senescence indicators. ⁴⁵ Studies also suggest that the PPAR signaling pathway may modulate retinoid bioactivity, offering potential targets for anti-aging products development. a complex derived from sandalwood bark and gum significantly elevated the expression levels of skin barrier components, such as ceramides, filaggrin, and transglutaminase-1, thereby accelerating the repair of the impaired skin barrier via enhancement of the PPAR-γ pathway. ⁴⁶

To further investigate the anti-aging potential of the candidate combinations, two PPAR-γ agonist peptides, Creasend-077 and Anti-protease100P, were selected based on direct assessment of the transcription levels of senescence and inflammation associated genes. The addition of these selected PPAR-γ agonist peptides to a combination of bakuchiol and retinol further confirmed the synergistic effects in modulating aging and inflammation-related genes. Especially the formulation of bakuchiol and retinol at a 9:1 molar ratio (10 µM each) supplemented with 50 ppm Anti-protease100P (designated as Colift-A) significantly upregulated the transcription levels of key collagen metabolism related genes (p<0.05), including COL1A1, COL3A1 and ELN. Colift-A also significantly reduced the transcription levels of MMP3 and MMP1 (p<0.05), which encode matrix metalloproteinases involved in extracellular matrix degradation, and thereby affecting the maintenance of skin elasticity and moisture. Moreover, as shown in Figure 7, treatment with Colift-A downregulated the expression of multiple inflammatory factor–related genes such as GM-CSF, FGF basic, MIP-1α and IL-8, thereby counteracting inflammation associated aging processes.

Cell immunofluorescence analysis results further confirmed the synergistic effect of Colift-A on promoting COL1A1 gene expression level, as indicated by the significant increase in optical density value (p < 0.05), as Figures 7d and 7(e) shown. Therefore, it can be deduced that Colift-A enhances the expression levels of type I collagen-related proteins, surpassing the promoting effects of individual components (bakuchiol, retinol and Anti-protease 100P) or the binary bakuchiol: retinol (9:1) combination.

The activity of Colift-A was subsequently validated in volunteer-based skin tests, as Figure 9 shown. Among the 28 known types of human collagen proteins, types I and II constitute over 90% of the total and are critical for maintaining skin structural integrity. ⁴⁷ The upregulation of collagen synthesis-related genes, together with the downregulation of inflammatory and matrix-degradation related genes, supports the potential role of Colift-A in resisting skin aging. There have some limits exist in this study that the authors did not perform a sample size calculation, and the limited number of samples may affect the statistical significance of the results. Furthermore, Post-study registration may have introduced bias into the results and represents a limitation of this study. ⁴⁸

In summary, Colift-A exhibited the most pronounced effects in upregulating the expression level of key anti-aging genes while concurrently suppressing the expression of inflammatory-associated genes. These findings provide valuable insights for the future development of skin anti-aging strategies. However, the safety and applicability of Colift-A, as well as the precise synergic mechanisms through which it enhances PPAR-γ signaling pathway, require further investigation.

Conclusion

This study aimed to address the skin irritation associated with high-concentration retinol in anti-aging applications and to develop a novel, low-irritation, and high-efficacy formulation with both anti-aging and anti-inflammatory properties. To this end, the Colift-A composite system was successfully constructed, consisting of bakuchiol and retinol at a 9:1 molar ratio (10 uM each) combined with 50 ppm Trifluoroacetyl Tripeptide-2. This formulation exhibited low cytotoxicity in human foreskin fibroblast (HFF) cells, significantly upregulated collagen, and elastin synthesis-related genes, and inhibited pro-inflammatory factor transcription. Double-blind clinical trials confirmed that 56-day continuous use significantly improved facial wrinkles and skin elasticity, with markedly lower irritation compared to 0.3% retinol. This effect is attributed to the regulation of the PPAR-γ pathway, thereby providing a new basis for the development of low-irritation anti-aging cosmetics.