Sage Journals: Discover world-class research

Abstract

Background:

Hepatocellular carcinoma (HCC) is the most common primary liver cancer and a leading cause of cancer-related mortality worldwide. Exploring novel preventive and therapeutic strategies is thus imperative. This study evaluated the therapeutic and protective effects of boswellic acid (BA), both alone and in combination with low-dose gamma radiation, against diethylnitrosamine (DEN)-induced HCC in male albino rats.

Methods:

A total of 90 rats were randomly assigned to 5 groups: Control, DEN, DEN + BA, DEN + Radiation, and DEN + Radiation + BA. Liver carcinogenesis was induced with DEN (20 mg/kg, administered orally for 6 weeks). BA (250 mg/kg) was administered orally for 8 weeks following cancer induction. Radiation (0.5 Gy, twice over 2 weeks) was applied to relevant groups after tumor induction. The study assessed serum biochemical markers, including colorimetric detection of liver enzymes (ALT and AST), oxidative stress markers (malondialdehyde, SOD activity), ELISA detection inflammatory cytokines Nuclear factor kappa-light-chain-enhancer of activated B cells, Tumor necrosis factor alpha (NF-κB and TNF-α), and the expression level of proliferation marker Janus kinase, Signal transducer and activator of transcription 3, Mitogen-activated protein kinase (JAK, STAT-3, and MAPK), via qRT-PCR, angiogenesis Vascular Endothelial Growth Factor, transforming growth factor beta (VEGFA, TGF-β), levels of apoptotic marker (Caspase-3, and Granzyme B) and Bax (Bcl-2-associated X protein), Bcl-2 (B-cell lymphoma 2) by ELISA. Histopathological examination was performed to evaluate tissue alterations.

Results:

Results demonstrated that BA, especially when combined with radiation, improved hepatic histopathology, reduced liver injury, suppressed oxidative stress and inflammation (NF-κB and TNF-α), and promoted apoptosis evidenced by increased Bax, caspase-3, granzyme B levels associated with significant decrease in Bcl-2 level. The combined treatment also inhibited tumor proliferation and angiogenesis by downregulating the expression levels of (JAK/STAT3, MAPK), VEGF-A, and TGF-β concentrations. These findings suggest that BA, synergistically with low-dose gamma radiation, offers a promising strategy for HCC therapy, supporting its potential as an adjuvant in HCC management.

Graphic Abstract

Boswellic acid (BA) with low-dose gamma radiation mitigates DEN-induced hepatocellular carcinoma in rats, improving liver histology, reducing oxidative stress and inflammation, promoting apoptosis, and inhibiting proliferation and angiogenesis (JAK/STAT3, MAPK, VEGF-A, TGF-β). BA + radiation shows strongest therapeutic potential.

Keywords

HCC DEN low dose radiation JAK/STAT3 MAPK VEGF-A and TGF-β

Introduction

Hepatic malignancies, predominantly hepatocellular carcinoma (HCC), remain among the most prevalent and lethal forms of cancer globally, accounting for approximately 80% of primary liver neoplasms. Established risk factors include chronic infections with hepatitis B virus (HBV) and hepatitis C virus (HCV), cirrhosis, excessive alcohol consumption, aflatoxin exposure, genetic and epigenetic alterations, dysregulation of microRNAs, disturbances in cell death pathways, epithelial-to-mesenchymal transition (EMT), and an expanding population of hepatic stem-like cells. These factors frequently operate within microenvironments characterized by chronic inflammation, contributing to hepatic carcinogenesis.^1,2 The increasing incidence emphasizes the urgent need for effective prophylactic strategies aimed at mitigating the progression of chronic liver disease to HCC.³

Experimental models utilizing chronic liver injury and environmental carcinogens—most notably diethylnitrosamine (DEN)—have been extensively employed to simulate human hepatocarcinogenesis. These models facilitate elucidation of molecular pathogenesis and serve as platforms for evaluating potential therapeutic agents.⁴ DEN, an N-nitroso alkyl compound, is a known potent hepatotoxin, mutagen, and carcinogen. DEN-induced HCC models have frequently been used in preclinical studies to elucidate the pathogenesis of HCC and for the testing of novel drugs. After administration in animals, DEN is transformed into bioactive intermediate metabolites in hepatocytes that react with DNA to form a complex with increased probability of carcinogenic modifications. Moreover, the metabolic pathways involved in DEN transformation cause the generation of reactive oxygen species (ROS) that induce inflammation, apoptosis, and necrosis in the liver. These hepatotoxic effects of DEN may contribute to the pathogenesis of liver cancer.⁵ Despite technological and therapeutic advances, the prognosis for HCC remains dismal, predominantly due to late-stage diagnosis, high rates of recurrence, and resistance to current treatment modalities.⁶ This underscores the critical importance of identifying novel therapeutic targets within the molecular pathways implicated in liver oncogenesis. Inflammatory processes play a pivotal role in HCC pathogenesis, promoting cellular proliferation, angiogenesis, and genetic mutations. Central mediators such as nuclear factor-kappa B (NF-κB) and tumor necrosis factor-alpha (TNF-α) facilitate early tumorigenic events, including immune evasion, neovascularization, and epithelial-to-mesenchymal transition.^7
-9 Therefore, targeted intervention at these signaling pathways presents a promising avenue for therapeutic development.

Receptor tyrosine kinases (RTKs) are integral to oncogenic processes, with genetic aberrations such as mutations, gene amplifications, and overexpression driving tumor proliferation and cell survival. Dysregulation of RTK signaling cascades is a common feature across various cancers, including HCC, and has catalyzed the development of targeted therapies aimed at inhibiting these pathways.^10
-12 Modulation of downstream signaling pathways, including the mitogen-activated protein kinase (MAPK) pathway and vascular endothelial growth factor (VEGF)-mediated angiogenesis, is essential for controlling tumor growth and metastatic dissemination by regulating tumor vascularization and nutrient supply, thereby suppressing oncogenic progression.^13,14

The increasing recognition of effective plant-based therapeutics characterized by minimal or absent adverse effects, has led to a growing application of phytomedicines in the management of complex diseases such as cancer. Among these, boswellic acids—compounds extracted from species within the Boswellia genus—are notable for their extensive pharmacological properties. Recent investigations have highlighted their selective cytotoxicity toward malignant cells, while sparing normal tissue, which is a promising characteristic for cancer therapeutics.¹⁵ Furthermore, boswellic acids are recognized for their anti-inflammatory, cytotoxic, anti-apoptotic, anti-arthritic, and anti-ulcerogenic properties.^16,17

In addition, low-dose radiation therapies have emerged as potential modulators of the tumor microenvironment, capable of inducing apoptosis and restricting tumor progression with comparatively fewer side effects.¹⁸ Specifically, low-dose gamma (γ) irradiation has shown promise as an adjunct to conventional therapies by enhancing immune responses and yielding beneficial outcomes across various preclinical models.¹⁹

Consequently, this study aims to investigate the hepatoprotective, anti-inflammatory, and anti-tumor effects of boswellic acid, both independently and in combination with low-dose gamma radiation, in a model of diethylnitrosamine (DEN)-induced hepatocellular carcinoma in male albino rats. The study specifically assesses the modulation of inflammatory pathways via NF-κB/TNF-α, the inhibition of mitogen-activated protein kinase (MAPK) and angiogenic pathways, and the induction of apoptosis through downstream JAK/STAT3 signaling. Elucidating these underlying molecular mechanisms may contribute to the development of more effective therapeutic strategies for hepatic carcinoma.

Materials and Methods

Materials

3-O-Acetyl-11-keto-β-boswellic acid (AKBA; synthetic, ≥95% purity, Product Number: A9855; CAS Number: 67416-61-9) was procured from Sigma-Aldrich Chemical Co., United States. All remaining chemicals and reagents utilized in the study, of high analytical purity, were also sourced from Sigma-Aldrich (St. Louis, MO, USA).

Radiation Facility and Irradiation Protocol

The experimental rats were subjected to whole-body gamma (γ) irradiation with a total dose of 1 Gy, administered in 2 fractions of 0.5 Gy each, with the doses delivered weekly over 2 consecutive weeks subsequent to the establishment of liver carcinoma. The irradiation procedures were conducted at the National Center for Radiation Research and Technology (NCRRT) utilizing a Canadian Gamma-Cell-40 (Cs-137) biological irradiator, manufactured by Canada Ltd., Ottawa, Ontario. Animals were positioned within a plastic sample tray equipped with a lid and supports inside the irradiation chamber. The irradiator features ventilation openings aligned with internal ventilation systems to ensure uniform dose distribution. The dose rate was calibrated at 0.403 Gy/min, adhering to the guidelines set forth by the Protection and Dosimetry Department.

Animals: The male adult Swiss albino rats, weighing between 120 and 150 g, were obtained from the breeding unit at the National Centre for Radiation Research and Technology. They were acclimated and maintained on a standard commercial pellet diet with ad libitum access to water for 1 week.

Ethics Approval Statement

The use and care of the laboratory rats adhered to the guidelines of the National Institute of Health (NIH No. 85:23, revised 1996) and the standards set by the Ethics Committee of the National Center for Radiation Research and Technology (NCRRT), Atomic Energy Authority, Cairo, Egypt. The study complied with the international principles outlined by CIOMS, ICLAS (2012), and the ARRIVE guidelines 2.0. The research protocol received approval in accordance with the 3Rs principles—replacement, reduction, and refinement—for animal experimentation. Serial number of approved protocol 4A/24 and approved at 04/02/2024.

Induction of Liver Cancer

Hepatocellular carcinoma was induced by orally administering 20 mg/kg body weight of Diethyl Nitrosamine (DEN) dissolved in 0.9% saline, five5 times weekly for 6 consecutive weeks, following the method of Mansour et al⁴

To confirm establishment of DEN-induced hepatocellular carcinoma (HCC) prior to intervention, a dedicated confirmatory step was performed at the end of the DEN induction period. One representative rat from each experimental group (n = 1 per group) was sacrificed for histopathological assessment of the liver to verify malignant lesions consistent with DEN-induced HCC. Liver tissue was fixed and examined by hematoxylin and eosin staining for histological features of hepatocarcinogenesis. In parallel, serum liver enzymes (ALT and AST) and hepatic expression of proliferation marker MAPK as well as apoptosis marker caspase-3 were measured to corroborate tumor establishment. Treatment was initiated only after a formal confirmation of DEN-induced HCC.

Experimental Design

A total of 90 male albino rats were randomly divided into 5 groups:

Group 1 (C): Normal control (10 rats), receiving oral isotonic saline 5 times per week for 6 weeks.

Group 2 (DEN): 20 rats, receiving DEN at 20 mg/kg body weight for 6 weeks.

Group 3 (DEN + BA): 20 rats, receiving DEN then daily oral injection of BA at 250 mg/kg for 8 weeks, starting 1 week after liver cancer induction.²⁰

Group 4 (DEN + R): 20 rats, receiving DEN and then exposed to fractionated low-dose gamma radiation (0.5 Gy) twice over 2 successive weeks, totaling 1 Gy.

Group 5 (DEN + R + BA): 20 rats, receiving DEN, gamma radiation exposure, and BA treatment as described.

At the end of 14 weeks, animals were euthanized under urethane anesthesia (1.2 g/kg.b.wt) for sample collection.

Serum and Tissue Collection, and Preparation of Crude Tissue Homogenates

At the end of the experiment (24 hours post-treatment), rats were anesthetized with urethane. Blood samples were collected via cardiac puncture into anticoagulant tubes, then centrifuged at 4000g at 4°C for 15 minutes using a Hettich Universal 32A centrifuge (Germany). The serum obtained was stored at −20°C for subsequent analyses. Liver tissues were dissected, washed with normal saline, weighed, and homogenized in ice-cold phosphate buffer (0.1 M, pH 7.4) at a ratio of 1:10 (w/v) using a Teflon homogenizer (Universal Laboratory Aid, Type MPW-309, Poland). Cytoplasmic and nuclear proteins were extracted using the NE-PER kit from Thermo Scientific (Cat # 78833). The supernatants were separated by centrifugation at 10 000×g for 15 minutes, and aliquots were prepared for biochemical assays. Total protein content was measured following the Lowry et al. (1951) method. Additionally, representative liver tissue sections from each group were fixed in 10% formaldehyde for histopathological analysis.

Histopathological Analysis

Liver tissues were fixed in 10% neutral-buffer formalin for at least 48 hours, then washed, dehydrated through ascending ethanol concentrations, cleared in xylene, and embedded in paraffin blocks. Sectioned tissues (5 μm thick) were stained with hematoxylin and eosin (H&E) for standard histopathological examination.²¹ A pathologist, blinded to the treatment groups, examined the sections under a light microscope, capturing images with a Leica ICC50 HD digital camera attached to a Leica motorized system. Hepatic lesions were scored in 4 to 5 random fields using a semi-quantitative grading system based on the methods of Kleiner et al²² and Mitchell et al,²³ with modifications. The scoring system details are outlined in Table 2, which categorizes hepatic injury severity.

Assessment of Liver Function

Serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured using colorimetric assays based on the method of Reitman and Frankel.²⁴ Commercial kits from Biodiagnostic (Egypt; CAT# AL 1031 for ALT and CAT# AS 1061 for AST) were used. Briefly, serum samples were mixed with 2,4-dinitrophenylhydrazine (1 mmol/L) and incubated at 37°C for 30 minutes. The absorbance was read at 505 nm using a double-beam spectrophotometer (Thermo Electron UV-Visible Spectrophotometers, England).

Biochemical Assays

Oxidative status in serum was assessed by measuring malondialdehyde (MDA), a lipid peroxidation marker, using the thiobarbituric acid reactive substances (TBARS) assay at 532 nm, following Yoshioka et al²⁵ Total superoxide dismutase (SOD) activity was determined using the method of Sun et al,²⁶ based on the enzyme’s ability to inhibit the reduction of Nitro Blue Tetrazolium (NBT) by superoxide generated in the xanthine-xanthine oxidase system. SOD activity was expressed as units per milligram of protein (U/mg). Total protein content was measured according to Lowry et al²⁷

Quantification of Inflammatory Cytokines

Liver levels of NF-κB and TNF-α were measured using rat-specific ELISA kits (MyBioSource, San Diego, USA; CAT # MBS287521 for NF-κB and MBS175904 for TNF-α), following the manufacturer’s protocols.

Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted from liver tissue homogenates using the RNeasy Plus Mini Kit (Qiagen, Venlo, Netherlands), as per the manufacturer’s instructions. Reverse transcription was performed using the First Strand cDNA Synthesis Kit (Thermo Scientific, USA). The qRT-PCR assays utilized RNA-direct SYBR Green Master Mix (Invitrogen™) on an Mx3000P qPCR system (Agilent Technologies, California, USA). Primers for murine JAK, STAT-3, and MAPK were listed in Table 1. Cycle threshold (Ct) values were normalized to the housekeeping gene β-actin. Relative gene expression levels were calculated using the 2−ΔΔCT method.²⁸

Table 1.

Primers Used for QRT-PCR.

Primer	Sense (5′-3′)	Antisense (5′-3′)	Accession number
JAK	AGGAGGAGCTGAGGACTTGA	CAGGAGGTTGAGGAGGAAGT	NM_012855.2
STAT-3	ATGGCAGCCTTCTGACTTCA	TGCAGTCTCATCCAGGGTTC	NM_001430048.1
MAPK	AGGGCGATGTGACGTTT	CTGGCAGGGTGAAGTTGG	NM_001106945
β-actin	CGAGTACAACCTTCTTGC	TTCTGACCCATACCCACCAT	NM_031144.3

Estimation of VEGFA, TGF-β, Caspase-3, Granzyme B, Bax and Bcl-2 Levels

Hepatic levels of VEGFA were measured using a rat-specific VEGFA ELISA kit (Abcam, Cambridge, UK; CAT# ab100786). TGF-β levels were assessed with a kit from ThermoFisher Scientific (Waltham, USA; CAT# BMS623-3). Caspase-3, Granzyme B, Bax and Bcl-2 levels were determined using respective kits from MyBioSource (San Diego, CA, USA; CAT # MBS018987 for Caspase-3, CAT # MBS289114 for Granzyme B, CAT # MBS2522405 for Bax and CAT # MBS2515143 for Bcl-2). All measurements were performed according to the manufacturers’ instructions, using an ELISA reader (Bio-Tek Instruments Inc., Winooski, VT, USA).

Statistical Analysis

Results are expressed as mean ± SEM. Differences among groups were evaluated using one-way ANOVA, followed by Tukey-Kramer post hoc tests for multiple comparisons. Analyses were conducted with Prism version 8 (GraphPad Software, La Jolla, CA). Statistical significance was accepted at P < .05.

Results

Macroscopic Examination of Liver Tissue

The macroscopic evaluation of liver tissue across the study groups generally shows a progression from healthy tissue in the control group to varying degrees of tumor burden and morphological alterations in the cancer and treatment groups. The effectiveness of treatments using boswellic acid and or low-dose radiation is often assessed based on their ability to enhance liver architecture, and improve overall liver health as shown in Figure 1. In the normal control group, healthy liver tissue exhibited a smooth, intact surface, normal coloration (pinkish to light brown), and well-defined vascular structures (Panel A). Conversely, DEN exposure produced gross liver lesions with irregular surfaces and nodularity (Panel B). Boswellic acid treatment (Panel C) is associated with fewer lesions and smaller gross tumor areas compared with Panel B. Low-dose radiation (Panel D) appears to promote tissue repair and vascular remodeling. Radiation plus boswellic acid (Panel E) suggests a trend toward reduced tumor burden and improved architectural normalization relative to other DEN group (Panel E).

Figure 1.

Macroscopic examination of liver tissue across experimental groups. Panels: A = Control, B1, B2 DEN, C = DEN + boswellic acid (BA), D = DEN + low-dose radiation (R), E = DEN + R + BA. The control liver tissue exhibited a smooth, intact surface with normal coloration and well-defined vascular structures (panel A). In contrast, liver tissues from diethylnitrosamine-injected rats showed irregular surfaces with nodules, color changes, and altered textures as shown in (pane B1, B2). Treatment with boswellic acid resulted in reduced tumor size, and fewer lesions (Panel C). Low-dose radiation exposure demonstrated signs of tissue repair, regeneration, and vascular changes (Panel D). The combined treatment group exhibited synergistic effects, with further reduced tumor burden and signs of improved liver function (Panel E). a = Significant change compared to the control group. b = Significant change compared to DEN group. c = Significant change compared to DEN + R.

Figure 1 depicts that DEN administered rats displayed 100% tumor incidence (TI) while markedly enhanced (P < .05) the formation of visible tumor nodule (TN) as compared to the control set. On the other hand, BA treatment (Panel C) is associated with pronounced decrease in tumor incidence to (60%) associated with decrease in the formation of visible tumor nodule (14) compared with Panel B. Radiation plus boswellic acid (Panel E) suggests a trend toward reduced tumor incidence to (40%) and accompanied by more pronounced downregulation in the formation of visible tumor nodule (7) relative to other DEN group (Panel B).

These observations in Figure 1 are currently qualitative; quantitative analyses (lesion counts/sizes, histology scores) are underway to confirm these trends.).

Histopathological Hepatic Alterations

The histopathological findings across the study groups demonstrate a clear progression from normal liver architecture to varying degrees of tissue damage in the DEN group. Microscopic examination of the untreated control rat liver revealed a normal histological hepatic lobular structure, with regularly arranged hepatic cords separated by sinusoids lined by Kupffer cells. In contrast, the liver from rats treated with diethylnitrosamine (DEN) exhibited severe histopathological changes, characterized by a disrupted lobular structure and the formation of multiple nodules within the hepatic parenchyma (Figure 2 and Table 2), alongside diffuse vacuolization of hepatocytes. The nodular formations consisted either of hepatocellular adenomas with dysplastic features or low-grade hepatocellular carcinoma (HCC) of eosinophilic and clear cell types. Generally, the neoplastic cells displayed karyomegaly, hepatocyte hypertrophy, and loss of normal hepatic arrangement, nuclear pleomorphism, and an increased nuclear-to-cytoplasmic ratio, indicating marked dysplasia. Multiple altered foci, predominantly of the clear cell type, were identified. Additionally, the formation of multilocular biliary structures was noted, along with cholangiofibrosis, oval cell proliferation, and bridging fibrosis.

Figure 2.

Photomicrographs of rat liver sections stained with hematoxylin and eosin showing C: a normal hepatic tissue section showing polyhedral cells with centrally located vesicular nuclei arrow (H&Ex200). DEN-1: DEN treated rat showing nest of neoplastic cells comprising the HCC, the neoplastic cells showing hepatocytomegaly (black arrow), karyomegaly (yellow arrow), anisokaryosis and increase N:C ratio indicating dysplasia. DEN-2: DEN treated rat showing trabecular arrangement of neoplastic cells comprising the HCC, note the nuclei have dense chromatin with prominent nucleoli, frequent mitosis (brown arrow) and high N:C ratio. DEN+BA: DEN+ boswellic acid treated rat showing moderate distortion of hepatic lobular architecture with frequent number of apoptotic bodies and binuclear hepatocytes (green arrow). DEN+R: Photomicrograph of hepatic tissue section showing degenerated pleomorphic hepatocytes with minimal nuclear atypia (red arrow. Histological liver H&E stained section, DEN+radiation+Boswelic acid treated rat showing low grade of dysplasia of neoplastic cells comprising the HCC denoting uniform nuclear sizes, reduced N:C ratio associated with marked apoptosis with formation of multiple apoptotic bodies (blue arrow). (H&Ex200).

Table 2.

Hepatic Lesions Score in Different Experimental Groups.

Groups	Deg.hepat.	Steatosis	Oval hyperp	Anisokaryosis	Cystic bile duct deg.	Dysplastic heap	Altered hep. Foci	Fibrosis	Inflamm	Tumor form.	Sum	Apoptosis
DEN	5 ± 0.00^b	5 ± 0.00^c	2.62 ± 0.18^b	4.25 ± 0.36^c	2.5 ± 0.56^b	2.12 ± 0.35^b	4.5±0.18^c	2.25 ± 0.25^b	1.37 ± 0.18^b	3.25 ± 0.36^b	34.37 ± 1.71^c	1.5 ± 0.18^a
D + BA	4.5 ± 0.22^a,b	4.6 ± 0.21^c	2.66 ± 0.33^b	2.66 ± 0.21^b	0.16 ± 0.16^a	0.83 ± 0.30^a	2.16 ± 0.40^a,b	1.9 ± 0.40a	1 ± 0.00^a,b	1.33 ± 0.49^a	25.83 ± 2.93^b	3.66 ± 0.55^b
D + R	4.8 ± 0.20^b	4.8 ± 0.20^c	2.2 ± 0.20^b	1.4 ± 0.40^a	0.8 ± 0.20^a	1.2 ± 0.20^a,b	2.8 ± 0.20^b	1.8 ± 0.48^a,b	1.4 ± 0.24^b	0.6 ± 0.24^a	22.8 ± 1.46^{a b}	1 ± 0.00^a
DR + BA	4 ± 0.44^a	3.33 ± 0.30^b	2.16 ± 0.60^b	1.16 ± 0.30^a	0.66 ± 0.42^a	0.66 ± 0.42^a	1.5 ± 0.50^a	1.33 ± 0.33^a,b	1.66 ± 0.33^b	0.5 ± 0.34^a	20.33 ± 3.94^a,b	3.33 ± 0.61^b

Data are presented as mean ± standard error (SE) per histological field/section per animal.

Abbreviations: Hep., hepatocellular; Deg., degeneration; Oval hyperp., oval cell hyperplasia; Anisokaryosis; Dysplastic hepatocytes; Altered hepatocytes; Fibrosis; Inflammation; Tumor form.

Superscripts a, b, c denote statistically significant differences. Post-hoc comparisons: a = versus DEN; b = versus DEN+BA; c = versus DEN+R+BA, etc. Significance threshold: P < .05.

Treatment of the DEN-exposed liver with boswellic acid significantly reduced the hepatic histopathological alterations, leading to a decreased number of hepatocellular neoplasms that exhibited reduced dysplastic changes and extensive apoptosis. It was also characterized by reduction of mitotic activity and partial 51% to 99% tumor necrosis with frequent number of apoptotic bodies. Several numbers of binuclear hepatocytes seem to preferentially undergo unconventional cell division.

In the DEN group treated with low-dose radiation, there was a reduction in tumor size, with both viable and necrotic areas of tumor tissue observed, alongside signs of tissue repair, such as hepatocyte proliferation in adjacent regions. The combined administration of both BA and radiation led to the most significant improvement in histopathological characteristics among the treatment groups, evidenced by reduced hepatic alterations, including a decrease in the number and size of hepatocellular neoplasms, diminished dysplasia, less oval cell proliferation, and reduced hepatic fibrosis. Additionally, there was a marked increase in the apoptosis of neoplastic hepatocytes, comprising the HCC.

Table 2 summarizes hepatic lesion scores, including degenerated hepatocytes, oval cell hyperplasia, dysplastic hepatocytes, and altered hepatocytes, across various experimental groups. DEN markedly increased degeneration, oval cell hyperplasia, anisokaryosis, dysplastic hepatocytes, and overall lesion burden compared with control. DEN + BA and DEN + R groups showed reductions in several lesion types, with the combination DEN + R+BA producing the most pronounced normalization (Table 2; P < .05 vs DEN for multiple categories).

Effect of Boswellic Acid and γ-Irradiation on Liver Function

This study evaluated the effects of diethylnitrosamine (DEN) treatment and subsequent interventions on liver enzymes, specifically ALT and AST, which serve as important biomarkers for liver function and integrity. Normal levels of ALT and AST were observed in control group, indicating healthy liver function. ALT and AST levels increased markedly after DEN treatment. Compared with the normal control group, ALT and AST were significantly elevated in the DEN-treated liver DEN group (P < .05) by approximately 700% and 550%, respectively. These values underscore substantial hepatocellular injury induced by DEN. On the other hand, marked reduction in ALT and AST levels were detected in the DEN group treated with boswellic acid (P < .05) decreased by 46.1% and 34% respectively, compared to the untreated DEN group indicating partial restoration of liver function and reduced hepatocellular injury. A noticeable decrease in ALT and AST levels was observed in DEN + R compared to the untreated group (P < .001) decreased by 51.5% and 30.6%, reflecting improved liver integrity. The most significant reduction among all treatment groups in ALT and AST levels in DEN group treated with BA and low dose radiation by 66.4% and 64.8% respectively, suggesting optimal liver recovery and improved cellular health (Figure 3a and b).

Figure 3.

Effect of BA and γ-irradiation on liver enzymes (A) ALT activity, (B) AST activity. C: control, DEN: Diethylnitrosamine injected rat, DEN+BA: Diethylnitrosamine injected rat and treated with boswellic acid, DEN+R: Diethylnitrosamine injected rat and exposed to low dose gamma irradiation, DEN+R+BA: Diethylnitrosamine injected rat exposed to low dose gamma irradiation and treated with boswellic acid, Values are the mean ± SEM (n = 6). a = Significant change compared to the control group. b = Significant change compared to DEN group. C = Significant change compared to DEN+R.

Defensive Effects of Boswellic Acid and Low Dose Gamma Irradiation Against Oxidative and Antioxidant Status Induced in DEN Treated Rats

Oxidative stress in liver cancer cells was evaluated based on enzymatic (SOD) antioxidants and MDA (lipid peroxidation end-product) measurement. The data illustrated in Figure 4 showed a remarkable restoration of the regular redox tone. The levels of MDA were considerably raised in DEN liver DEN group, associated with a marked decrease in SOD activities. This effect was significantly improved with concurrent BA treatment, showed by significant decrease (P < .0001) in MDA (by 50%) with significant increase (P < .01) in SOD activities by 87% respectively compared to untreated liver DEN group. More pronounced amelioration was observed after irradiation of DEN-treated group. What is more, exposure of DEN group to γ-irradiation in combination with BA produced a significant recovery in redox tone where MDA noteworthy decreased by (70%) concomitant with significant increase in SOD activities by 248% with respect to liver DEN group (Figure 4).

Figure 4.

Effect of BA and γ-irradiation on oxidative stress, (A) SOS activity, (B) MDA level. C: control, DEN: Diethylnitrosamine injected rat, DEN+BA: Diethylnitrosamine injected rat and treated with boswellic acid, DEN+R: Diethylnitrosamine injected rat and exposed to low dose gamma irradiation, DEN+R+BA: Diethylnitrosamine injected rat exposed to low dose gamma irradiation and treated with boswellic acid, Values are the mean ± SEM (n = 6). a = Significant change compared to the control group. b = Significant change compared to DEN group. c = Significant change compared to DEN+R.

BA and LDR Abates Cancer Triggered Inflammatory Response via Hampering NF-κB/TNF-α Signaling

To ascertain the role of inflammatory response, further determinations revealed that BA induced NF-κB/TNF-α signal suppression in addition to inflammatory mediators. The concentrations of NF-κB, and TNF-α were considerably elevated in liver DEN group. On contrary, BA administration to DEN + R group negatively regulated NF-κB, and TNF-α level by 40.6%, and 39.5%, respectively compared to untreated DEN group. Comparable results were observed in DEN group subjected to low dose gamma irradiation diminution, respectively compared to control DEN group. Intriguingly, DEN group co-treated with BA + R demonstrated a discernible improvement in the inflammatory response by down regulating NF-κB, and TNF-α concentrations by 79.6%, and 70.4%, respectively (P < .001) compared with untreated cancer group (Figure 5).

Figure 5.

BA and/or IR restrain inflammatory response evoked by (A) NFKB and (B) TNF-α level. C: control, DEN: Diethylnitrosamine injected rat, DEN+BA: Diethylnitrosamine injected rat and treated with boswellic acid, DEN+R: Diethylnitrosamine injected rat and exposed to low dose gamma irradiation, DEN+R+BA: Diethylnitrosamine injected rat exposed to low dose gamma irradiation and treated with boswellic acid, Values are the mean ± SEM (n = 6). a = Significant change compared to the control group. b = Significant change compared to DEN group. c = Significant change compared to DEN+R.

Impact of BA and/or γ-Irradiation Exposure on Janus Kinase (JAK) and Signal Transducer, Activator of Transcription-3 (STAT3) and Mitogen Activator Protein Kinase (MAPK)

To find out the role of inflammatory response in cancer we further determined JAK-STAT3 and MAPK. The JAK-STAT pathway is a series of cell proteins interactions that plays a vital role in the development of cancer. The data exemplified in Figure 6 displayed that there were substantial increase in p-JAK, STAT3 and MAPK gene expression levels in DEN group. Current study results demonstrated significant alterations in inflammatory response parameters upon treatment of DEN group with BA where p-JAK gene expression was significantly decreased (P < .05) by 58.6%, STAT3 and MAPK declined by 40.6% and 54% with the respective DEN group. Just about the same issue, our experimental results upon irradiation of DEN-treated group identify a notable decrease in p-JAK, STAT-3 and MAPK gene expressions with values equivalent to DEN group. Nevertheless, both treatment modalities combination (DEN + R+BA) revealed the most observable decrease in p-JAK and STAT-3 gene expression by 83.1% and 69% followed by a noticeable decline in MAPK gene expression by 81.8% compared to liver DEN group (Figure 6).

Figure 6.

Effect of BA and or gamma irradiation on (A) p-JAK, (B) STAT3 and (C) MAPK gene expressions. C: control, DEN: Diethylnitrosamine injected rat, DEN+BA: Diethylnitrosamine injected rat and treated with boswellic acid, DEN+R: Diethylnitrosamine injected rat and exposed to low dose gamma irradiation, DEN+R+BA: Diethylnitrosamine injected rat exposed to low dose gamma irradiation and treated with boswellic acid, Values are the mean ± SEM (n = 6). a = Significant change compared to the control group. b = Significant change compared to DEN group. c = Significant change compared to DEN+R.

Boswellic Acid Down Regulates Tumor Angiogenesis Through Targeting VEGFA and TGF-β Signal

Boswellic acid demonstrates a clear ability to down regulate angiogenesis via VEGF and TGF-β pathways, leading to reduced tumor growth and vascularity. This highlights its potential as a therapeutic agent in the management of hepatocellular carcinoma. The data illustrated in Figure 7 demonstrated that the level of VEGFA and TGF-β were significantly increased in DEN group. On the other hand, DEN group treated with BA resulted in a noticeable (P < .01) decline in VEGFA level by 33.8% and TGF-β level by 45.35% compared to its corresponding DEN group. Upon irradiation of DEN-treated group our experimental results identify a significant decrease in VEGFA associated with a pronounced decrease in TGF-β level paralleled to liver DEN group. However, exposure of DEN injected rat to γ-irradiation in combination with BA produced a significant down regulation in VEGFA by 62% and TGF-β level by 63.38% compared to untreated liver DEN group (Figure 7).

Figure 7.

Effect of BA and or gamma irradiation on (A) VEGFA and (B) TGF beta signaling. C: control, DEN: Diethylnitrosamine injected rat, DEN+BA: Diethylnitrosamine injected rat and treated with boswellic acid, DEN + R: Diethylnitrosamine injected rat and exposed to low dose gamma irradiation, DEN+R+BA: Diethylnitrosamine injected rat exposed to low dose gamma irradiation and treated with boswellic acid, Values are the mean ± SEM (n = 6). a = Significant change compared to the control group. b = Significant change compared to DEN group. c = Significant change compared to DEN + R.

Boswellic Acid and or Gamma Irradiation Induce Apoptosis in Diethylnitrosamine Induce Liver Cancer in Rat Through Targeting Caspase3 and Granzyme B

In the current work, the imbalance between proliferation and apoptosis was further illustrated by diminishing the level of the proapoptotic caspase-3 and granzyme B in liver DEN group. Apoptosis enhancement was observed due to treatment of liver cancer cells with BA as presented by the remarkable elevation (P < .0001) in caspase-3 level by 887% and granzyme B by 1190% compared to untreated DEN group. It worth mention that irradiation of DEN-treated group reveals a significant increase in cleaved caspase-3 and granzyme B related to untreated liver DEN group. Further, exposure of DEN injected rats in combination with BA treatment to γ-irradiation induces significant (P < .0001) noteworthy increase in cleaved caspase-3 level by 1977% and granzyme b level by 2695% compared to its equivalent value in untreated DEN group (Figure 8).

Figure 8.

Effect of BA and or gamma irradiation on (A) caspase-3 and (B) granzyme b signaling. C: control, DEN: Diethylnitrosamine injected rat, DEN+BA: Diethylnitrosamine injected rat and treated with boswellic acid, DEN + R: Diethylnitrosamine injected rat and exposed to low dose gamma irradiation, DEN+R+BA: Diethylnitrosamine injected rat exposed to low dose gamma irradiation and treated with boswellic acid, Values are the mean ± SEM (n = 6). a = Significant change compared to the control group. b = Significant change compared to DEN group. c = Significant change compared to DEN + R.

Boswellic Acid and γ-Irradiation Ppromote Apoptosis in DEN-Induced Hepatocellular Carcinoma in Rats via Modulation of Bax/Bcl-2 Ratio

The study evaluated the effects of Boswellic Acid) on the expression of Bax and Bcl-2 and the resulting Bax/Bcl-2 ratio across experimental groups. Bax is a pro-apoptotic effector, whereas Bcl-2 is an anti-apoptotic regulator; thus, the Bax/Bcl-2 ratio serves as a major determinant of cellular susceptibility to apoptosis.

DEN-induced hepatocellular carcinoma (HCC) altered the apoptotic balance toward anti-apoptosis, evidenced by an ≈80% decrease in Bax and an ≈300% increase in Bcl-2 relative to untreated controls. In the control group, Bax and Bcl-2 levels were 4 and 5, respectively, yielding a Bax/Bcl-2 ratio of 0.80.

BA treatment markedly enhanced pro-apoptotic signaling, indicated by a substantial increase in Bax (P < .05; ≈650% relative to untreated cancer) and a concomitant reduction in Bcl-2 (≈35% relative to untreated cancer). DEN irradiation alone increased Bax and decreased Bcl-2 compared with untreated cancer, consistent with enhanced pro-apoptotic signaling after γ-irradiation. Notably, rats bearing DEN-induced tumors treated with BA and exposed to γ-irradiation exhibited a pronounced rise in Bax (≈900% vs untreated cancer) and a substantial decline in Bcl-2 (≈70% vs untreated cancer), corresponding to a robust shift toward apoptosis. All data refer to Figure 9.

Figure 9.

Effect of BA and or gamma irradiation on (A) Bax, (B) Bcl-2 and (C) Bax/Bcl-2 ratio. C: control, DEN: Diethylnitrosamine injected rat, DEN+BA: Diethylnitrosamine injected rat and treated with boswellic acid, DEN + R: Diethylnitrosamine injected rat and exposed to low dose gamma irradiation, DEN+R+BA: Diethylnitrosamine injected rat exposed to low dose gamma irradiation and treated with boswellic acid, Values are the mean ± SEM (n = 6). a = Significant change compared to the control group. b = Significant change compared to DEN group. c = Significant change compared to DEN + R.

Quantitatively, DEN treatment reduced Bax to 0.8 and increased Bcl-2 to 20, producing a Bax/Bcl-2 ratio of 0.04, indicating a marked anti-apoptotic state. In the DEN + BA group, Bax rose to 6 and Bcl-2 fell to 13.5, yielding a Bax/Bcl-2 ratio of 0.44. In the DEN + R+BA group, Bax further increased to 8 and Bcl-2 declined to 6, increasing the Bax/Bcl-2 ratio to 1.33, consistent with a shift toward pro-apoptosis. Collectively, BA modulates the Bax/Bcl-2 axis, promoting pro-apoptotic signaling and potentially contributing to anti-tumor activity.

Discussion

Hepatocellular carcinoma (HCC) is a primary liver cancer characterized by intricate molecular pathways and often linked to chronic inflammation, oxidative stress, and disrupted cellular signaling.²⁹ In this study, diethylnitrosamine (DEN) was used to induce liver tumors, a widely accepted model that replicates many human HCC features, including elevated liver enzymes, oxidative damage, and inflammatory responses.⁵ To improve therapeutic strategies against cancer, it was essential to explore subtle underlying mechanisms and develop innovative treatment approaches.

Histopathological analysis of liver tissues supported the biochemical findings, showing significant structural changes in the DEN-induced HCC model. The untreated DEN group displayed distorted liver architecture, characterized by irregular hepatic cords, cellular dysplasia, and the formation of neoplastic nodules—key indicators of HCC progression.⁴ These nodules included hepatocellular adenomas with dysplastic features and early carcinoma, evidenced by nuclear pleomorphism, increased nuclear-to-cytoplasmic ratios, and cellular hypertrophy. Additionally, fibrosis, oval cell proliferation, and cholangiofibrosis indicated ongoing liver injury and regenerative efforts typical of carcinogenesis.³⁰ Treatment with boswellic acid (BA) significantly alleviated these histopathological changes, reducing neoplastic nodules and restoring liver tissue closer to normal. The decrease in fibrosis and normalization of hepatic architecture suggest that BA exerts protective antioxidant and anti-fibrotic effects, potentially halting or reversing early cancer development.³¹ This study aimed to assess the therapeutic potential of BA, both alone and combined with gamma irradiation, on DEN-induced HCC in rats.

Histopathological examination across all groups demonstrated the progression from normal liver structure to notable tissue alterations associated with carcinogenesis, as well as the restorative effects of BA and radiation. Notably, combined BA and low-dose radiation therapy showed the most significant histopathological improvements. Liver sections from HCC rats displayed regions of anaplastic hepatocytes, acini formation, fibroblastic proliferation, and areas of necrosis, aligning with findings from Abdalla et al³² DEN-induced tissue damage ranged from vacuolar degeneration and spotty necrosis to confluent necrosis, ghost necrotic tumor nodules, and solid HCC nodules containing enlarged, binucleated hepatocytes—corroborating previous reports.⁴ Similar findings of hepatocyte degeneration, focal necrosis, and inflammatory infiltration following low-dose gamma radiation were documented by Moawed et al³³ Additionally, widespread Kupffer cell proliferation was observed within the hepatic parenchyma. The reduction in fibrosis aligns with evidence suggesting that phytochemicals like BA have anti-fibrotic properties through modulation of hepatic stellate cell activation.³¹ The increased apoptosis seen in neoplastic hepatocytes further highlights the synergistic effects of combined therapy; BA is known to promote apoptosis via modulation of apoptotic pathways, while radiation enhances tumor cell sensitivity to apoptotic signals.³⁴

The histopathological findings supported the biochemical data, illustrating the connection between structural liver changes and molecular markers. Under normal conditions, liver enzymes like ALT and AST are contained within healthy hepatocytes; however, during carcinogenesis, damage to liver cell membranes causes these enzymes to leak into the bloodstream, making them sensitive indicators of hepatic dysfunction.³⁵ Elevated serum ALT and AST levels in the DEN-treated group (Figure 3) validate the presence of liver injury and impaired function, consistent with previous studies showing that hepatocarcinogens promote enzyme leakage into circulation.³² The significant reduction of these enzymes following boswellic acid (BA) treatment suggests an amelioration of liver damage, likely due to its anti-inflammatory and hepatoprotective effects.³⁶ Restoring near-normal levels of ALT and AST highlights BA’s potential to protect the liver and support functional recovery, an essential aspect of comprehensive therapies for HCC.³⁷

Our results also showed that the DEN group exhibited markedly decreased superoxide dismutase (SOD) activity and increased levels of malondialdehyde (MDA), as well as elevated expressions of NF-κB, TNF-α (Figures 4 and 5), and genes such as JAK, STAT-3, and MAPK (P < 0.05; Figure 6). Hepatocarcinogenesis is closely linked to oxidative stress, persistent inflammation, abnormal cellular proliferation, and increased angiogenesis.³⁸ Elevated MDA indicates increased lipid peroxidation and oxidative damage, while decreased SOD activity reflects weakened antioxidant defenses.³⁹ Oxidative stress plays a pivotal role in inducing DNA damage and mutations that drive tumor initiation and progression.⁴⁰ The upregulation of inflammatory mediators like NF-κB and TNF-α emphasizes the role of inflammation in promoting tumor growth through activation of survival and proliferation pathways.⁴¹ NF-κB, in particular, sustains hepatic inflammation, facilitating HCC development.⁴² The activation of JAK/STAT3 and MAPK pathways further supports tumor proliferation and survival, with overexpression of STAT3 being especially critical for cancer cell growth, immune evasion, and invasiveness.²⁹ Cytokines like IL-6 produced within the tumor microenvironment can activate STAT3, which translocates to the nucleus to promote oncogenic gene expression, including Cyclin D1.⁴³ Dysregulation of the JAK/STAT pathway is common in HCC, contributing to oxidative stress, growth factor signaling, and inflammation.⁴⁴

Additionally, the study revealed increased levels of VEGFA and TGF-β, key factors involved in angiogenesis and tumor vascularization, which are crucial for tumor growth and metastasis.⁴⁵ Angiogenesis, initiated by cytokines such as VEGF and bFGF, facilitates tumor expansion and invasion.⁴⁶ The early stages involve vasodilatation mediated by nitric oxide (NO) and increased vascular permeability in response to VEGF, which is overexpressed alongside TNF-α, as it promotes neovascularization.⁴⁷ The elevated TNF-α level can activate NF-κB, partly through hydrogen peroxide involvement.⁴⁸ TNF-α also stimulates changes in endothelial cell gene expression, including adhesion molecules, integrins, and matrix metalloproteinases (MMPs), thereby acting as a growth factor that supports tumor angiogenesis.⁴⁹

In terms of apoptosis, both caspase-3 and granzyme-B levels markedly decreased in the DEN group (P < .05; Figure 8), indicating evasion of programed cell death—a characteristic of cancer cells.⁵⁰ Apoptosis is a controlled form of cell death, and its suppression allows accumulation of genetically damaged cells, fostering tumor progression. The reduction in caspase-3, a key executioner in apoptosis, highlights cancer’s ability to bypass cell death mechanisms.^18,51 The imbalance between proliferation—evidenced by increased JAK, STAT-3, and MAPK expression—and apoptosis—evidenced by reduced granzyme-B and caspase-3—drives tumor growth and expansion.⁵² Additionally, oxidative stress, through excess reactive oxygen species (ROS), damages DNA and promotes chromosomal abnormalities, contributing to hepatocarcinogenesis.⁵³ ROS also activate signaling pathways like NF-κB, Wnt/β-catenin, and MAPK, further promoting angiogenesis, proliferation, and survival while inhibiting apoptosis.⁵⁴

Exposure of rats injected with DEN to low-dose gamma irradiation significantly delayed tumor development, primarily by downregulating inflammatory mediators, suppressing proliferation signaling pathways, inhibiting angiogenic regulators, and inducing apoptosis. DNA damage caused by radiation activates various signaling pathways, with the intrinsic apoptotic pathway being the main mechanism driving radiation-induced cell death, thereby halting tumor cell proliferation and growth.¹⁸

Currently, standard cancer treatments include surgical resection, radiation therapy, and chemotherapy. However, these approaches are often limited by side effects and the eventual development of drug resistance in tumor cells.¹⁹ As a result; there is an urgent need to develop novel strategies, such as combination therapies, to overcome these limitations. Growing evidence suggests that natural compounds hold promise due to their safety profiles and potential to circumvent chemoresistance. In this context, we evaluated the effects of boswellic acid (BA), alone and combined with low-dose gamma irradiation, on DEN-induced liver cancer. Notably, BA treatment suppressed STAT3 activation in both irradiated and non-irradiated groups, reducing pro-inflammatory mediators like TNF-α and NF-κB, which are critical for malignant proliferation and inflammatory responses. BA also decreased the expression of survival markers such as JAK and MAPK, inhibited angiogenesis by downregulating VEGFA and TGF-β, and promoted apoptosis through increased levels of granzyme B and caspase-3, along with restoring cellular redox balance. These findings highlight BA’s potential as an effective anticancer agent.

BA has numerous therapeutic properties, including anti-inflammatory, antiseptic, expectorant, anxiolytic, antineurotic, analgesic, and tranquilizing effects.⁵⁵ Multiple preclinical and clinical studies have demonstrated its efficacy in managing inflammatory conditions such as asthma, arthritis, cerebral edema, chronic bowel diseases, pain syndromes, and cancer.⁵⁶ Recent research indicates that BA directly interacts with IκB kinases, suppressing NF-κB-driven gene expression.⁵⁷ BA and its derivatives target a range of enzymes involved in cancer progression, including those regulating angiogenesis and others such as topoisomerases, 5-lipoxygenase (5-LO), cytochrome P450, and MAPK pathways.⁵⁸

The modulation of JAK/STAT3 and MAPK signaling pathways by Boswellic Acid (BA) has been implicated in its anti-cancer effects. Specifically, BA has been shown to inhibit the phosphorylation of STAT3, a key transcription factor involved in cell survival and proliferation, in various cancer cell types.^59,60 This inhibition is associated with the suppression of upstream JAK kinases, which are responsible for STAT3 activation.⁶¹ Furthermore, BA has been found to modulate the MAPK pathway, which plays a crucial role in cell growth, differentiation, and apoptosis. Studies have demonstrated that BA can inhibit the activation of ERK1/2, JNK, and p38 MAPK, leading to the induction of apoptosis and inhibition of cell proliferation.⁵⁷ The combined effects of BA on JAK/STAT3 and MAPK pathways contribute to its anti-cancer properties, “making it a promising agent for cancer therapy.”

Huang et al⁶² reported that naturally occurring boswellic acids and their derivatives have been part of traditional medicine for cancer treatment. Both alpha- and beta-keto boswellic acids inhibit topoisomerases I and IIa, thereby restricting cell proliferation and inducing apoptosis through caspase-8-dependent pathways in various cancers, including leukemia, hepatoma, and colon cancer.^63,64 Additionally, chemoproteomic studies using mass spectrometry suggest that beta-boswellic acids interact with ribosomal proteins, inhibiting protein synthesis and further modulating cancer progression.⁶⁵ In A549 lung cancer cells, BA caused cell cycle arrest at G0/G1, suppressed clone formation, and promoted apoptosis, partly by reducing LC3A/B and Beclin-1 expression and inhibiting the PI3K/Akt signaling pathway.⁶⁶ The latest derivative, 11-keto-boswellic acid (KBA), demonstrated cytotoxic effects against treatment-resistant triple-negative breast cancer cell lines and induced apoptosis in vivo.⁶⁷ In liver cancer cells (Hep G2), keto-BA derivatives decreased viability, caused cell cycle arrest, and activated apoptotic pathways, highlighting their potential for liver cancer therapy.³⁰ AKBA, a prominent boswellic acid derivative, has also been shown to inhibit the growth of gastric carcinoma via p53 activation and caspase cascade induction, as well as suppress pancreatic tumor metastasis by modulating NF-κB–regulated genes such as COX-2, MMP-9, CXCR4, and VEGF.⁶⁸ Moreover, AKBA reduces pro-inflammatory cytokines like IL-1, IL-2, IL-6, IFN-γ, and TNF-α, which can cause tissue damage, with NF-κB being a key target.⁶⁹

In addition to histological confirmation, the observed changes in key angiogenic mediators provide mechanistic support for modulation of tumor angiogenesis. VEGFA is a primary driver of endothelial proliferation, vascular permeability, and new vessel formation. In our study, VEGFA and TGF beta levels were significantly decreased after BA treatment, which would be expected to reduce endothelial sprouting and neovascularization and thus impair angiogenesis. VEGF is a key pro-angiogenic factor that promotes the formation of new blood vessels, while TGF-β can also contribute to angiogenesis and tumor progression.⁷⁰ Studies have demonstrated that BA can inhibit the expression of VEGF and TGF-β, leading to reduced angiogenesis and tumor growth.^71,72 For example, a study by Huang et al⁷³ found that BA inhibited VEGF expression and angiogenesis in human prostate cancer cells, resulting in reduced tumor growth and vascularity Similarly, another study by Takada et al showed that BA suppressed TGF-β-induced angiogenesis and tumor growth in a mouse model of breast cancer.⁷⁴ The anti-angiogenic effects of BA are thought to contribute to its anti-cancer properties, making it a promising agent for cancer therapy.

Historically, boswellic acids have been used to treat acute and chronic inflammatory diseases.⁷⁵ They decrease inflammatory cytokines like IL-6 and TNF-α in a dose-dependent manner and exhibit uroprotective effects by reducing urinary bladder weight, MDA, NO, and inflammatory markers

Boswellic acids have been proposed as potential uroprotective agents, notably demonstrated in their ability to prevent cyclophosphamide-induced interstitial cystitis.⁷⁶ They exert protective effects by restoring antioxidant enzyme levels such as superoxide dismutase (SOD), catalase, and glutathione peroxidase, and can also activate the nuclear factor erythroid 2-related factor-2 (Nrf2)/antioxidant response element pathway, thereby enhancing cellular defense mechanisms.⁶⁸

In vivo studies have shown that AKBA significantly alleviates liver damage, including steatosis, inflammatory cell infiltration, and fibrosis in models of non-alcoholic steatohepatitis (NASH).⁷⁷ Its hepatoprotective effects may also involve modulation of fibroblast growth factor 21 (FGF21), which inhibits the ALOX15/15-HETE pathway and reduces pro-inflammatory responses.⁷⁸ Similar to tetramethylpyrazine (TMP), which enhances antioxidant capacity by increasing SOD activity and lowering malondialdehyde (MDA) levels, AKBA appears to mitigate oxidative stress—a key contributor to liver injury.⁷⁹ Furthermore, AKBA has been reported to decrease TGF-β levels and suppress liver inflammation, supporting its potential as a therapeutic agent in liver disease and cancer prevention.⁸⁰

The present study demonstrates the impact of Boswellic Acid (BA) treatment on the Bax/Bcl-2 pathway, a critical regulator of apoptosis. The results show that BA treatment modulates the Bax/Bcl-2 ratio, shifting the balance toward pro-apoptotic signaling and potentially exerting anti-cancer effects. The Bax/Bcl-2 ratio is a crucial determinant of apoptosis, with a higher ratio indicating a greater propensity for cell death.⁸¹ In this study, DEN treatment significantly decreased the Bax/Bcl-2 ratio, suggesting an anti-apoptotic effect. However, BA treatment increased the Bax/Bcl-2 ratio in the DEN + BA and DEN + R+BA groups, indicating a shift toward pro-apoptotic signaling.

The increase in Bax levels and decrease in Bcl-2 levels observed in this study (Figure 9) are consistent with previous reports on the pro-apoptotic effects of BA.⁸² BA’s ability to modulate the Bax/Bcl-2 pathway may contribute to its anti-cancer properties, making it a potential therapeutic agent for cancer treatment. Boswellic Acid has been shown to modulate apoptosis through multiple mechanisms, including upregulating caspase-3 and granzyme B. Caspase 3 is a key executioner caspase in the apoptotic pathway. BA’s ability to increase Caspase-3 activity contributes to its pro-apoptotic effects.⁸² Granzyme B is a serine protease that induces apoptosis through the cleavage of various cellular substrates. BA’s ability to increase Granzyme B expression may also contribute to its pro-apoptotic effects.⁶² The modulation of apoptosis by BA through Caspase-3 and Granzyme B may indeed contribute to an increase in the Bax/Bcl-2 ratio. Activated Caspase-3 can cleave and inactivate Bcl-2, leading to a decrease in Bcl-2 levels.⁸³ This would increase the Bax/Bcl-2 ratio. : Granzyme B can also cleave and activate Bax, leading to an increase in Bax levels and a subsequent increase in the Bax/Bcl-2 ratio.⁸⁴ Therefore, BA’s ability to modulate apoptosis through Caspase-3 and Granzyme B may indeed contribute to an increase in the Bax/Bcl-2 ratio, shifting the balance toward pro-apoptotic signaling.

These findings position boswellic acid as a promising adjunct therapy capable of targeting multiple tumor-promoting pathways, especially those involving inflammation, angiogenesis, and cell survival signaling. By inhibiting STAT3 and its downstream mediators, BA may help overcome resistance to standard treatments and reduce tumor aggressiveness.

When combined with radiation, BA markedly decreases oxidative stress markers, suppresses inflammatory cytokines, and downregulates proliferative signaling pathways, thereby disrupting the tumor-supportive microenvironment.⁸⁵ This synergistic effect enhances antioxidant defenses and aligns with studies by Jit et al,⁸⁶ which showed that phytochemicals can potentiate radiation-induced oxidative damage in tumor cells while protecting normal tissues. The combination therapy effectively promotes apoptosis and simultaneously inhibits angiogenesis and proliferation, impeding tumor growth and progression.¹⁹ These results highlight the potential of BA, especially in combination with radiation, as a multi-targeted approach for managing hepatocellular carcinoma.

Supporting this, Mansour et al⁴ demonstrated that BA synergizes with low-dose ionizing radiation to mitigate bisphenol-induced lung toxicity in rats by inhibiting the JNK/ERK/c-Fos pathway and exerting antioxidant and anti-inflammatory effects. Overall, BA combined with low-level radiation exhibits free-radical scavenging properties that confer protection against cancer progression through anti-inflammatory mechanisms. Additionally, recent evidence suggests that combined BA and low-dose radiation therapy may offer hepatoprotective effects against hepatic encephalopathy-related hyperammonemia and associated liver and brain damage by modulating inflammatory cytokines and improving liver histology.³⁷ Early clinical insights also indicate benefits of BA in managing cerebral edema during radiotherapy, providing an alternative to corticosteroids, with a favorable safety profile and low cost—although these findings are largely anecdotal.⁸⁷

Overall, the combination of BA and low-dose radiation holds promising clinical potential for liver cancer treatment, representing a novel strategy to enhance the efficacy of conventional therapies through multi-faceted mechanisms, including anti-inflammatory, antioxidant, and pro-apoptotic effects.

Study Limitation

Despite the promising findings, this study has several limitations. First, survival outcomes were not assessed, and the long-term clinical relevance remains to be established. Second, pharmacokinetic and biodistribution data were not collected, which limits interpretation of exposure–response relationships. Third, the experimental design did not include BA-only or radiation-only controls, making it difficult to disentangle the contributions of each modality and assess potential interactions. Fourth, validation in human-relevant systems was not performed; thus, translational extrapolation requires caution. A potential limitation of this study is the absence of histological confirmation of angiogenesis modulation, such as CD31 immunostaining and microvessel density assessment, which may limit confidence in interpreting changes in neovascularization. We plan to address these gaps in future work by conducting PK/PD studies, incorporating additional control groups, evaluating survival endpoints, and validating findings in human-derived models (eg, patient-derived xenografts or organoids).

Future research should focus on conducting clinical trials to evaluate the safety, efficacy, and optimal dosing of boswellic acid in patients with hepatocellular carcinoma. Investigating the molecular mechanisms underlying its anti-tumor effects will enhance understanding of its therapeutic potential. Additionally, exploring combination therapies with other chemotherapeutic agents or targeted treatments may improve outcomes. Long-term studies are needed to assess the durability of the treatment effects and potential toxicity. Ultimately, this research paves the way for developing novel, less invasive, and more effective approaches for HCC management, potentially improving survival and quality of life for affected patients.

Conclusion

In a DEN-induced HCC rat model, boswellic acid (BA) exhibited therapeutic potential, strongest when combined with low-dose gamma irradiation, suggesting a synergistic effect in mitigating hepatocarcinogenesis. BA improved liver histology, reduced liver injury, decreased oxidative stress and inflammation (NF-κB, TNF-α), and promoted apoptosis (↑ Bax, caspase-3, granzyme B; ↓ Bcl-2).

The combination therapy downregulated proliferative and angiogenic signaling (JAK/STAT3, MAPK; VEGF-A,TGF-β), contributing to reduced tumor proliferation and vascularization. Taken together, BA, particularly in combination with low-dose gamma irradiation, exerts multi-faceted effects that address critical hallmarks of cancer in this model: suppression of inflammation and oxidative stress, inhibition of proliferative and angiogenic signaling, and activation of apoptotic pathways. These combined actions culminate in improved liver histology, reduced tumor-promoting signals, and a more favorable therapeutic response. Further studies are needed to translate these results to humans, optimize dosing, and assess long-term safety and efficacy.

Footnotes

Acknowledgements

I would like to express my gratitude to Pro. Dr. Faten. F. Mohammed, Pathology department, Faculty of Veterinary Medecine, Cairo University, Giza, Egypt, for the performance of histopathological investigation, which enriching this study.

ORCID iDs

Nermeen M. Elbakary

Mohamed Khairy Abdel-Rafei

Ethical Considerations

This study was done in accordance with guidelines adopted by the NCRRT Ethics Committee and the ARRIVE protocol.

Consent to Participate

There are no human subjects in this article and informed consent is not applicable.

Authors Contributions

Nermeen M Elbakary was the study’s designer, Conceptualization, Methodology. For the practical work, Nermeen M Elbakary, Mansour I Mansour, Mohamed Khairy Abdel-Rafei and Mostafa A Elbahnsawey were responsible. The data analysis and paper draught were completed by Nermeen M Elbakary, Kayed AE, Mohamed Khairy Abdel-Rafei rewrote and thoroughly examined the work, Data curation, Writing—Original draft preparation. The manuscript was approved by all authors Every writer has read and approved the final manuscript. The authors confirm that no paper mill and artificial intelligence was used.

Funding

The authors received no financial support for the research, authorship, and/or publication of this article.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

References

Yüregir

Kaçaroğlu

Yaylacı

Regulation of hepatocellular carcinoma epithelial-mesenchymal transition mechanism and targeted therapeutic approaches. Adv Exp Med Biol. 2024;1450:93-102. doi:10.1007/5584_2023_781

Arrè

Negro

Giannelli

The role of inflammasomes in hepatocellular carcinoma: mechanisms and therapeutic insights. Ann Hepatol. 2025;30(1):101772. doi:10.1016/j.aohep.2024.101772

Yeo

Abdelmalek

Khan

, et al. Current and emerging strategies for the prevention of hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol. 2025;22(3):173-190. doi:10.1038/s41575-024-01021-z

Mansour

Elbahnasawy

Mahgoub

Elbakary

Antitumor impact of Clostridium sporogenes endospores against diethyl nitrose amine induce hepatocellular carcinoma in rats. Microbes Infect Dis. 2024;5(3):1164-1175.

Sotty

Bablon

Weiss

Soussan

Diethylnitrosamine induction of hepatocarcinogenesis in mice. Methods Mol Biol. 2024;2769:15-25. doi:10.1007/978-1-0716-3694-7_2

Singal

Kanwal

Llovet

JM.

Global trends in hepatocellular carcinoma epidemiology: implications for screening, prevention and therapy. Nat Rev Clin Oncol. 2023;20(12):864-884. doi:10.1038/s41571-023-00825-3

Wen

Zhu

Zhang

, et al. Chronic inflammation, cancer development and immunotherapy. Front Pharmacol. 2022;13:1040163. doi:10.3389/fphar.2022.1040163

Zhang

Miao

Zhang

Targeting neutrophil extracellular traps in cancer progression and metastasis. Theranostics. 2025;15(12):5846-5869. doi:10.7150/thno.111096

Khan

Zhang

Shi

Hou

NF-κB role on tumor proliferation, migration, invasion and immune escape. Cancer Gene Ther. 2024;31(11):1599-1610. doi:10.1038/s41417-024-00811-6

10.

Tomuleasa

Tigu

Munteanu

, et al. Therapeutic advances of targeting receptor tyrosine kinases in cancer. Signal Transduct Target Ther. 2024;9(1):201. doi:10.1038/s41392-024-01899-w

11.

De Meyts

. Receptor tyrosine kinase signal transduction and the molecular basis of signalling specificity. In: Wheeler

Yarden

(eds) Receptor Tyrosine Kinases: Structure, Functions and Role in Human Disease. New York, NY: Springer; 2015;51-76. doi:10.1007/978-1-4939-2053-2_4

12.

Aveic

Tonini

GP.

Resistance to receptor tyrosine kinase inhibitors in solid tumors: can we improve the cancer fighting strategy by blocking autophagy?

Cancer Cell Int. 2016;16:62-68.

13.

Bahar

Kim

DR.

Targeting the RAS/RAF/MAPK pathway for cancer therapy: from mechanism to clinical studies. Signal Transduct Target Ther. 2023;8(1):455. doi:10.1038/s41392-023-01705-z

14.

Liu

Zhang

, et al. Decoding tumor angiogenesis: pathways, mechanisms, and future directions in anti-cancer strategies. Biomark Res. 2025;13:62. doi:10.1186/s40364-025-00779-x

15.

Zhang

Men

Lei

Review on anti-tumor effect of triterpene acid compounds. J Cancer Res Ther. 2014;10(5):14-19. doi:10.4103/0973-1482.139746

16.

Hussain

Ali

Wang

, et al. Boswellic acids: privileged structures to develop lead compounds for anticancer drug discovery. Expert Opin Drug Discov. 2021;16(8):851-867. doi:10.1080/17460441.2021.1892640

17.

Hussain

Wang

El-Seedi

, et al. Therapeutic potential of boswellic acids: an update patent review (2016-2023). Expert Opin Ther Pat. 2024;34(8):723-732. doi:10.1080/13543776.2024.2369626

18.

El Bakary

Alsharkawy

Shouaib

Barakat

EMS.

Role of bee venom and melittin on restraining angiogenesis and metastasis in γ-irradiated solid ehrlich carcinoma-bearing mice. Integr Cancer Ther. 2020;19:1534735420944476. doi:10.1177/1534735420944476

19.

ElBakary

Hagag

Ismail

El-Sayed

WM.

New thiophene derivative augments the antitumor activity of γ-irradiation against colorectal cancer in mice via anti-inflammatory and pro-apoptotic pathways. Discover Oncol. 2022;13(1):119. doi:10.1007/s12672-022-00583-1

20.

Barakat

Ahmed

Bahr

Elbahaie

AM.

Protective effect of boswellic acids against doxorubicin-induced hepatotoxicity: impact on Nrf2/ho-1 defense pathway. Oxid Med Cell Longev. 2018;2018:8296451.

21.

Bancroft

Stevens

Turner

(eds.). Theory and practice of histological techniques, 4th ed. Churchill Livingstone; 1996.

22.

Kleiner

Brunt

Van Natta

, et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology. 2005;41(6):1313-1321. doi:10.1002/hep.20701

23.

Mitchell

Jollow

Potter

Davis

Gillette

Brodie

BB.

Acetaminophen-induced hepatic necrosis. I. Role of drug metabolism. J Pharmacol Exp Ther. 1973;187(1):185-194.

24.

Reitman

Frankel

A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am J Clin Pathol. 1957;28(1):56-63. doi:10.1093/ajcp/28.1.56

25.

Yoshioka

Kawada

Shimada

Mori

Lipid peroxidation in maternal and cord blood and protective mechanism against activated-oxygen toxicity in the blood. Am J Obstet Gynecol. 1979;135(3):372-376.

26.

Sun

Oberley

A simple method for clinical assay of superoxide dismutase. Clin Chem. 1988;34(3):497-500.

27.

Lowry

Rosebrough

Farr

Randall

RJ.

Protein measurement with the folin phenol reagent. J Biol Chem. 1951;193(1):265-275.

28.

Livak

Schmittgen

TD.

Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402-408.

29.

Elbakry

MMM

ElBakary

Hagag

Hemida

EHA

. Pomegranate peel extract sensitizes hepatocellular carcinoma cells to ionizing radiation, induces apoptosis, and inhibits MAPK, JAK/STAT3, β-catenin/Notch, and SOCS3 signaling. Integr Cancer Ther. 2023;22:15347354221151021. doi:10.1177/15347354221151021

30.

Liu

J-J

Nilsson

Oredsson

Badmaev

Duan

R-D.

Keto- and acetyl-keto-boswellic acids inhibit proliferation and induce apoptosis in Hep G2 cells via a caspase-8 dependent pathway. Int J Mol Med. 2002;10(4):501-505. doi:10.3892/ijmm.10.4.501

31.

Eltahir

Fawzy

Mohamed

Alrehany

Shehata

Abouzied

MM.

Antioxidant, anti-inflammatory and anti-fibrotic effects of Boswellia serrata gum resin in CCl4-induced hepatotoxicity. Exp Ther Med. 2020;19(2):1313-1321. doi:10.3892/etm.2019.8353

32.

Abdalla

El-Mahdy

ESM

Mansour

Elsonbaty

Hussien

MA.

Anticancer redox action of gallium nanoparticles combined with a low dosage of γ-radiation against hepatocellular carcinoma in male rats. Egypt Pharm J. 2022;21:328-337.

33.

Moawed

FSM

El-Sonbaty

Mansour

. Gallium nanoparticles along with low-dose gamma radiation modulate TGF-β/MMP-9 expression in hepatocellular carcinogenesis in rats. Tumor Biol. 2019;41:1-9.

34.

Khan

Ali

Parveen

Najmi

Ahmad

Pharmacological evidences for cytotoxic and antitumor properties of boswellic acids from Boswellia serrata. J Ethnopharmacol. 2016;191:315-323. doi:10.1016/j.jep.2016.06.053

35.

Kalas

Chavez

Leon

Taweesedt

Surani

Abnormal liver enzymes: a review for clinicians. World J Hepatol. 2021;13(11):1688-1698. doi:10.4254/wjh.v13.i11.1688

36.

Cui

Wang

Meng

Shi

Ding

Boswellic acids: a review on its pharmacological properties, molecular mechanism and bioavailability. Tradit Med Res. 2024;9(10):60.

37.

Saad

Mansour

Kandil

Hassan

Moawed

FSM

Elbakry

MMM

. Boswellic acid synergizes with low-dose ionizing radiation to mitigate thioacetamide-induced hepatic encephalopathy in rats. BMC Pharmacol Toxicol. 2025;26:6. doi:10.1186/s40360-024-00831-w

38.

Zheng

Wang

Xia

, et al. Hepatocellular carcinoma: signaling pathways and therapeutic advances. Signal Transduct Target Ther. 2025;10(1):35. doi:10.1038/s41392-024-02075-w

39.

Zheng

Xue

Yun

WJ.

An overview of mouse models of hepatocellular carcinoma. Infect Agent Cancer. 2023;18(1):49.

40.

ElBakary

Anees

Said Shahat

Mesalam

NM.

A promising natural red pigment “Prodigiosin” sensitizes colon cancer cells to ionizing radiation, induces apoptosis, and impedes MAPK/TNF-α/NLRP3 signaling pathway. Integr Cancer Ther. 2025;24:1534735425134.

41.

Guo

Jin

Chen

, et al. NF-κB in biology and targeted therapy: new insights and translational implications. Signal Transduct Target Ther. 2024;9(1):53. doi:10.1038/s41392-024-01757-9

42.

Shen

, et al. Sorafenib inhibits LPS-induced inflammation by regulating Lyn-MAPK-NF-kB/AP-1 pathway and TLR4 expression. Cell Death Discov. 2022;8:281.

43.

Hin Tang

Hao Thng

Lim

Toh

TB.

JAK/STAT signaling in hepatocellular carcinoma. Hepat Oncol. 2020;7(1):HEP18. doi:10.2217/hep-2020-0001

44.

Karin

NF-κB and STAT3 - key players in liver inflammation and cancer. Cell Res. 2011;21(1):159-168.

45.

Yancopoulos

Davis

Gale

Rudge

Wiegand

Holash

Vascular-specific growth factors and blood vessel formation. Nature. 2000;407(6801):242-248. doi:10.1038/35025215

46.

Huh

Baek

Lee

Choi

Park

Lee

JD.

Bee venom inhibits tumor angiogenesis and metastasis by inhibiting tyrosine phosphorylation of VEGFR-2 in LLC-tumor-bearing mice. Cancer Lett. 2010;292(1):98-110.

47.

Kumar

Kuttan

Nomilin inhibits tumor-specific angiogenesis by downregulating VEGF, NO and proinflammatory cytokine profile and also by inhibiting the activation of MMP-2 and MMP-9

Eur J Pharmacol. 2011;668(3):450-458.

48.

Kobayashi

Nishikawa

Hyoudou

Yamashita

Hashida

Hydrogen peroxide-mediated nuclear factor kappaB activation in both liver and tumor cells during initial stages of hepatic metastasis. Cancer Sci. 2008;99(8):1546-1552.

49.

Song

Zhu

Zhang

Shang

ZJ.

Tumor necrosis factor-α enhanced fusions between oral squamous cell carcinoma cells and endothelial cells via VCAM-1/VLA-4 pathway. Exp Cell Res. 2012;318(14):1707-1715.

50.

Fritsch

Finke

Grüllich

Suppression of granzyme B activity and caspase-3 activation in leukaemia cells constitutively expressing the protease inhibitor 9. Ann Hematol. 2013;92(12):1603-1609. doi:10.1007/s00277-013-1846-6

51.

Azab

El Fatih

El Tawill

ElBakary

NM.

Pro-apoptotic and anti-neoplastic impact of luteolin on solid Ehrlich carcinoma-bearing mice exposed to gamma radiation. J Cancer Res Ther. 2020;16(6):1506-1516.

52.

Loftus

Amend

Pienta

KJ.

Interplay between cell death and cell proliferation reveals new strategies for cancer therapy. Int J Mol Sci. 2022;23(9):4723. doi:10.3390/ijms23094723

53.

Bishayee

Bhatia

Thoppil

Darvesh

Nevo

Lansky

EP.

Pomegranate-mediated chemoprevention of experimental hepatocarcinogenesis involves Nrf2-regulated antioxidant mechanisms. Carcinogenesis. 2011;32(6):888-896.

54.

El-Ashmawy

Khedr

El-Bahrawy

Abd El-Fattah

EE.

Effect of pomegranate hull extract on liver neoplastic changes in rats: more than an antioxidant. Nutr Cancer. 2016;68(6):1044-1051.

55.

Al-Yasiry

Kiczorowska

Frankincense–therapeutic properties. Postepy Hig Med Dosw. 2016;70:380-391. doi:10.5604/17322693.1200553

56.

Roy

Parama

Banik

, et al. An update on pharmacological potential of boswellic acids against chronic diseases. Int J Mol Sci. 2019;20(17):4101. doi:10.3390/ijms20174101

57.

Trivedi

Soni

Dhyani

, et al. Anti-cancer properties of boswellic acids: mechanism of action as anti-cancerous agent. Front Pharmacol. 2023;14:1187181.

58.

Iram

Khan

Husain

Phytochemistry and potential therapeutic actions of boswellic acids: a mini-review. Asian Pac J Trop Biomed. 2017;7(6):513-523. doi:10.1016/j.apjtb.2017.05.001

59.

Kunnumakkara

Nair

Sung

Pandey

Aggarwal

BB.

Boswellic acid blocks signal transducers and activators of transcription 3 signaling, proliferation, and survival of multiple myeloma via the protein tyrosine phosphatase SHP-1. Mol Cancer Res. 2009;7(1):118-128. doi:10.1158/1541-7786.MCR-08-0154

60.

Yang

Wang

Guan

Qin

J-J.

Inhibiting STAT3 signaling pathway by natural products for cancer prevention and therapy: in vitro and in vivo activity and mechanisms of action. Pharmacol Res. 2022;182:106357.

61.

Sun

Huang

, et al. Acetyl-11-keto-β-boswellic acid inhibits proliferation and induces apoptosis of gastric cancer cells through the phosphatase and tensin homolog /Akt/ cyclooxygenase-2 signaling pathway. World J Gastroenterol. 2020;26(38):5822-5835. doi:10.3748/wjg.v26.i38.5822

62.

Safayhi

Mack

Sabieraj

Anazodo

Subramanian

Ammon

. Boswellic acids: novel, specific, nonredox inhibitors of 5-lipoxygenase. J Pharmacol Exp Ther. 1992;261(3):1143-1146.

63.

Xia

Chen

Han

Fang

Waxman

Jing

Boswellic acid acetate induces apoptosis through caspase-mediated pathways in myeloid leukemia cells. Mol Cancer Ther. 2005;4(3):381-388. doi:10.1158/1535-7163.MCT-03-0266

64.

Suhail

Cao

, et al. Boswellia sacra essential oil induces tumor cell-specific apoptosis and suppresses tumor aggressiveness in cultured human breast cancer cells. BMC Complement Altern Med. 2011;11:129. doi:10.1186/1472-6882-11-129

65.

Casapullo

Cassiano

Capolupo

, et al. β-boswellic acid, a bioactive substance used in food supplements, inhibits protein synthesis by targeting the ribosomal machinery. J Mass Spectrom. 2016;51(9):821-827. doi:10.1002/jms.3819

66.

Shao

Zhang

Zhuang

Qiao

Acetyl-11-keto-β-boswellic acid exerts the anti-cancer effects via cell cycle arrest, apoptosis induction and autophagy suppression in non-small cell lung cancer cells. Onco Targets Ther. 2020;13:733-744. doi:10.2147/OTT.S236346

67.

Schmiech

Ulrich

Lang

, et al. 11 -Keto- α-boswellic acid, a novel triterpenoid from Boswellia spp. With chemotaxonomic potential and antitumor activity against triple-negative breast cancer cells. Molecules. 2021;26(2):366. doi:10.3390/molecules26020366

68.

Rajabian

Farzanehfar

Hosseini

Arab

Nikkhah

Boswellic acids as promising agents for the management of brain diseases. Life Sci. 2023;312:121196. doi:10.1016/j.lfs.2022.121196

69.

Ammon

HP.

Boswellic acids and their role in chronic inflammatory diseases. Adv Exp Med Biol. 2016;928:291-327. doi:10.1007/978-3-319-41334-1_13

70.

Folkman

Angiogenesis. Annu Rev Med. 2006;57:1-18.

71.

Huang

, et al. Inhibitory effects of boswellic acid on human prostate cancer cells. Cancer Res. 2000;60(13):3434-3439.

72.

Jeong

Bae

. Anti-inflammatory effects of triterpenoids; naturally occurring and synthetic agents. Mini-Rev Org Chem. 2014;11(3):316-329.

73.

Pathania

Wani

Guru

Kumar

Bhushan

Korkaya

Malik

. The anti-angiogenic and cytotoxic effects of the boswellic acid analog BA145 are potentiated by autophagy inhibitors. Mol Cancer. 2015;14(1):6.

74.

Alipanah

Zareian

. Anti-cancer properties of the methanol extract of Boswellia serrata gum resin: cell proliferation arrest and inhibition of angiogenesis and metastasis in BALB/c mice breast cancer model. Physiol Pharmacol. 2018;22(3):183-194.

75.

Solanki

Gupta

Chellappan

, et al. Boswellic acids: a critical appraisal of their therapeutic and nutritional benefits in chronic inflammatory diseases. Endocr Metab Immune Disord Drug Targets. 2024;24(1):116-129. doi:10.2174/1871530323666230512154634

76.

Fatima

Anjum

Abdullah

Abid

Malik

MNH

. Boswellic acids, pentacyclic triterpenes, attenuate oxidative stress and bladder tissue damage in cyclophosphamide-induced cystitis. ACS Omega. 2022;7(16):13697-13703. doi:10.1021/acsomega.1c07292

77.

Luan

Fan

Yang

, et al. Acetyl-11-keto-β-boswellic acid alleviates hepatic metabolic dysfunction by inhibiting MGLL activity. J Lipid Res. 2025;66:100812.

78.

Yang

Chen

Shen

, et al. FGF21 modulates immunometabolic homeostasis via the ALOX15/15-HETE axis in early liver graft injury. Nat Commun. 2024;15(1):8578.

79.

, et al. Bibliometric analysis of research progress on tetramethylpyrazine and its effects on ischemia-reperfusion injury. Pharmacol Ther. 2024;259:108656.

80.

Kachouei

Doagoo

Jalilzadeh

, et al. Acetyl-11-Keto-Beta-Boswellic Acid has therapeutic benefits for NAFLD rat models that were given a high fructose diet by ameliorating hepatic inflammation and lipid metabolism. Inflammation. 2023;46(5):1966-1980. doi:10.1007/s10753-023-01853-y

81.

Putri

Nurfatihah

ZZ.

Bax/Bcl-2 ratio as the golden marker of apoptosis: molecular mechanisms and regulatory pathways. Int J Cell Biomed Sci. 2025;4(10):309-317.

82.

Al-Bahlani

Burney

Al-Dhahli

Al-Kharusi

Al-Kharousi

Al-Kalbani

Ahmed

. Boswellic acid sensitizes gastric cancer cells to Cisplatin-induced apoptosis via p53-mediated pathway. BMC Pharmacology and Toxicology. 2020;21(1):64.

83.

Cheng

Wei

Weiler

, et al. Bcl-2, Bcl-XL sequester Bh3 domain-only molecules preventing Bax- and Bak-mediated mitochondrial apoptosis. Mol Cell. 2001;8(3):705-711.

84.

Thomas

Scorrano

Putcha

Korsmeyer

Ley

. Granzyme B can cause mitochondrial depolarization and cell death in the absence of BID, BAX, and BAK. Proc Natl Acad Sci U S A. 2001;98(26):14985-14990.

85.

Thabet

Abdel-Rafei

Moustafa

EM.

Boswellic acid protects against bisphenol-A and gamma radiation induced hepatic steatosis and cardiac remodelling in rats: role of hepatic PPAR-α/P38 and cardiac Calcineurin-A/NFATc1/P38 pathways. Arch Physiol Biochem. 2022;128(3):767-785. doi:10.1080/13813455.2020.1727526

86.

Jit

Pradhan

Dash

, et al. Phytochemicals: potential therapeutic modulators of radiation induced signaling pathways. Antioxidants. 2021;11(1):49.

87.

Dejonckheere

Scafa

Käsmann

, et al. Boswellia serrata for the management of radiation-induced cerebral edema and necrosis: a systematic meta-narrative review of clinical evidence. Adv Radiat Oncol. 2025;10(4):101732. doi:10.1016/j.adro.2025.101732

Boswellic Acid and Low-Dose Radiation Attenuate Hepatic Carcinogenesis induced in Rats by Suppressing NF-κB/TNF-α/MAPK Signaling,Blocking Angiogenesis,and Inducing Apoptosis via JAK/STAT3 Downstream Granzyme-B and Caspase-3 Pathways

Abstract

Background:

Methods:

Results:

Keywords

Introduction

Materials and Methods

Materials

Radiation Facility and Irradiation Protocol

Ethics Approval Statement

Induction of Liver Cancer

Experimental Design

Serum and Tissue Collection, and Preparation of Crude Tissue Homogenates

Histopathological Analysis

Assessment of Liver Function

Biochemical Assays

Quantification of Inflammatory Cytokines

Quantitative Real-Time PCR (qRT-PCR)

Estimation of VEGFA, TGF-β, Caspase-3, Granzyme B, Bax and Bcl-2 Levels

Statistical Analysis

Results

Macroscopic Examination of Liver Tissue

Histopathological Hepatic Alterations

Effect of Boswellic Acid and γ-Irradiation on Liver Function

Defensive Effects of Boswellic Acid and Low Dose Gamma Irradiation Against Oxidative and Antioxidant Status Induced in DEN Treated Rats

BA and LDR Abates Cancer Triggered Inflammatory Response via Hampering NF-κB/TNF-α Signaling

Impact of BA and/or γ-Irradiation Exposure on Janus Kinase (JAK) and Signal Transducer, Activator of Transcription-3 (STAT3) and Mitogen Activator Protein Kinase (MAPK)

Boswellic Acid Down Regulates Tumor Angiogenesis Through Targeting VEGFA and TGF-β Signal

Boswellic Acid and or Gamma Irradiation Induce Apoptosis in Diethylnitrosamine Induce Liver Cancer in Rat Through Targeting Caspase3 and Granzyme B

Boswellic Acid and γ-Irradiation Ppromote Apoptosis in DEN-Induced Hepatocellular Carcinoma in Rats via Modulation of Bax/Bcl-2 Ratio

Discussion

Study Limitation

Conclusion

Footnotes

Acknowledgements

ORCID iDs

Ethical Considerations

Consent to Participate

Authors Contributions

Funding

Declaration of Conflicting Interests

References