Abstract
Objective
This study aimed to investigate the role of RAB32 in glioblastomas and its molecular mechanisms that regulate gliomas.
Methods
The expression and prognostic value of RAB32 were evaluated using western blotting and the Gene Expression Profiling Interactive, Chinese Glioma Genome Atlas, and The Cancer Genome Atlas databases. Lentivirus containing sh-RAB32 or OE-RAB32 was used to manipulate RAB32 expression in glioma cells. The effects of RAB32 on cell proliferation, migration, and invasion were determined by western blotting, cell counting kit-8, plate cloning, wound healing, and transwell assays. Gene set enrichment analysis was used to screen for associations between the JAK/STAT3 signaling pathway and RAB32. The role of this pathway was verified using JAK/STAT3 inhibitors.
Results
RAB32 expression was significantly upregulated in patients with glioma and in glioma cell lines. The expression level was positively correlated with the glioma grade and served as an independent prognostic factor. In vitro experiments revealed that RAB32 knockdown inhibited glioblastoma cell proliferation, migration, and invasion, while the opposite effects were observed with overexpression and could be inhibited by the JAK/STAT3 inhibitor BP-1-102.
Conclusion
RAB32 promotes malignant progression of glioblastoma cells through the JAK/STAT signaling pathway, providing new possibilities for therapeutic targets for glioblastoma.
Introduction
Glioma is the most common primary malignant brain tumor in adults. Because of the presence of enriched stem cells and extensive angiogenesis, gliomas are characterized as having both intra- and inter-tumor heterogeneity. 1 According to the World Health Organization (WHO) classification, gliomas can be classified into grades I-IV. Grades I and II are commonly defined as low-grade gliomas (LGG), with longer survival, and grades III and IV are used to designate high-grade gliomas, which exhibit a poor prognosis. 2 In particular, grade IV glioma, also known as glioblastoma (GBM), is the most malignant type of glioma. The optimal treatment for GBM is complete surgical resection followed by radiotherapy, which serves as the gold standard in clinical practice. The median overall survival of GBM patients is only 12 to 15 months, and the overall survival rate is less than 10%.3–5 Although surgery combined with radiotherapy and chemotherapy can improve the prognosis of certain LGG patients, more than 50% eventually progress to highly aggressive gliomas.6,7 Therefore, it is very important to explore novel therapeutic approaches for glioma to improve the curative effect and prognosis of glioma patients.
RAB proteins belong to the Ras superfamily and are a class of small molecule GTP enzymes with a molecular weight ranging from 20 to 30 kD. At present, scientists have identified more than 60 RAB proteins in humans, which are actively involved in vesicle transport, protein transport, membrane localization, and fusion.8–10 In addition to their roles in development and physiology, RAB proteins are closely related to the occurrence and development of cancer. Specifically, mutation of RAB proteins alters their interaction efficiency with effector molecules, thus disrupting the material transport network and affecting cell growth and behavior. Ultimately, this aberration promotes the malignant progression of cancer cells. 11 RAB32, a member of the RAB family, is localized in the cytoplasm, mitochondria, Golgi apparatus, and lysosome-associated organelles (melanosomes and autophagosomes). 12 RAB32 plays crucial roles in biogenesis processes related to lysosome-associated organelles, apoptosis, and autophagic intracellular vesicle trafficking.13–15 Suppression of RAB32 expression can inhibit the proliferation of human ovarian cancer cells. 16 Zheng He et al. demonstrated that RAB32 is involved in the progression of hepatocellular carcinoma and acts as an effector that mediates miR-30c-5p-associated cell proliferation and invasion. 17 In addition, elevated levels of RAB32 indicated a poor prognosis in patients with hepatocellular carcinoma. 18 Although RAB32 exhibits the potential to promote various tumors, the role of RAB32 in GBMs has rarely been reported.
In this study, we aim to illustrate the role of RAB32 in glioma proliferation, invasion, and apoptosis and reveal its underlying mechanisms.
Methods
The patient data used in this study were obtained from public databases, which were previously granted ethical approval. Researchers can freely download the data for research and publication purposes. Therefore, no institutional review board approval or informed consent was required.
Bioinformatics analysis
The Gene Expression Profiling Interactive (GEPIA) database (http://gepia.cancer-pku.cn/) was utilized to analyze the expression levels of RAB32 in glioma and normal brain tissues. Glioma patient information was downloaded through the Chinese Glioma Genome Atlas (CGGA, http://www.cgga.org.cn/) and The Cancer Genome Atlas (TCGA, https://portal.gdc.cancer.gov/) databases. The prognostic value of RAB32 in glioma patients was examined using Kaplan-Meier and Cox regression analyses. The relevant pathways enriched for RAB32 expression were explored by gene set enrichment analysis.
Culture and treatment of cell lines
The U251, U87, and A172 human glioma cell lines were purchased from the National Center for the Preservation of Certified Cell Cultures (https://www.cellbank.org.cn/). The SVG p12 normal human astrocyte line was purchased from the American Typical Culture Collection (https://www.atcc.org/). These cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum at 37°C with 95% CO2 and 70% to 80% humidity. The cell medium was replaced every 48 hours. The sh-RAB32 (GGCAACATGACCCGAGTATAC) and sh-NC (TTCTCCGAACGTGTCACGT) sequences were purchased from Genepharma Biotechnology Co. (Suzhou, China). OE-NC (no-load virus control group) and OE-RAB32 (transcript No. NM 006834) were purchased from Jintuosi Biological Co. (Wuhan, China). Upregulated RAB32 transfection was performed according to the standard procedure of the cell transfection kit (JTS Scientific, Wuhan, China). Downregulated RAB32 transfection was performed according to a cell transfection kit (Genepharma Biotechnology Co.).
Western blotting
Cells were lysed to extract the protein with radio immunoprecipitation buffer (containing protease inhibitor), and the protein concentration was measured using the bicinchoninic acid assay method. Equal amounts of cell lysate (20 μg protein/lane) were electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel and transferred to a cellulose nitrate membrane, which was then blocked in 5% powdered skimmed milk for 1 hour. Next, membranes were incubated at 4°C overnight with the following primary antibodies: RAB32 (ab251764, Abcam, Cambridge, UK, 1:1000), Bax (SZ3-07, Haobio, Hangzhou, China, 1:1000), Bcl-2 (JF104-8, Haobio, 1:1000), MMP9 (JA80-73, Haobio, 1:1000), c-myc (HA721182, Haobio, 1:1000), STAT3 (9139S, CST, MA, USA, 1:2000), p-STAT3 (5031S, CST, 1:2000), JAK3 (8863S, CST, 1:1000), p-JAK3 (5031S, CST, 1:1000), and GAPDH (TA-08, Zsbio, Beijing, China, 1:1000). Subsequently, the membranes were washed with Tris-buffered saline with Tween 20 and incubated with secondary antibodies for 2 hours. The experiment was repeated three times. Finally, the membranes were detected and analyzed using a chemiluminescent imager (ChemiDoc MP, Image Lab, CA, USA), photographed, and analyzed for grayscale values using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Cell proliferation measurement using a cell counting kit-8 (CCK-8) assay
For the CCK-8 assay, different groups of cells were inoculated in 96-well plates at 5000 cells/well. In cases where the adhering cells were in good condition and the density was greater than 50%, the original cell suspension was discarded at 0, 24, 48, or 72 hours, 100 μL of complete medium and 10 μL of CCK-8 reagent were added to each well, and the cells were mixed well and incubated for 2 to 3 hours under warm conditions. The experiment was repeated three times. Then, optical density values at 450 nm were measured using an enzyme labeler (Thermo Fisher Scientific).
Colony formation assay
Cells in the logarithmic growth phase were digested with trypsin and diluted to a single-cell suspension. Then, they were inoculated in six-well plates at 500 cells/well and cultured in DMEM containing 10% fetal bovine serum. The experiment was repeated three times. The medium was changed every 2 to 3 days, and the culture was incubated for 10 to 14 days, until most colonies consisted of more than 50 cells. When the culture was terminated, the cells were washed three times with phosphate-buffered saline (PBS). Then, the cells were fixed at room temperature using 4% paraformaldehyde (1 mL/well) and allowed to stand at room temperature for 20 minutes. The cells were washed two to three times with PBS to remove formaldehyde, stained with crystal violet by adding 0.1% crystal violet solution (1 mL/well), and allowed to stand at room temperature for 30 minutes. Finally, PBS was used to wash off the crystal violet solution at room temperature and cells were allowed to dry naturally. The plates were placed on an A4 paper background, and the formation of colonies was photographed for each group in the six-well plates.
Transwell assay
Cell migration and invasiveness were evaluated in a Transwell chamber (NEST, Wuxi, China). The suspension was diluted using serum-free DMEM, with an adjusted cell count of 5.0 × 105 cells/mL, and inoculated into the upper layer of a Transwell chamber (100 µL/well, 5000 cells per well), with (invasion assay) or without Matrigel (migration assay). The lower section contained DMEM (600 μL) supplemented with 10% fetal bovine serum as a chemical attractant, and the experiment was repeated three times. After incubation for 24 hours, the upper and lower levels of the chambers were washed three times with PBS. Then, 500 μL of 4% paraformaldehyde was added to the lower level of the cell chamber, which was then fixed for 15 minutes. Next, the lower level of the chamber was washed three times with PBS. After drying, the cells were stained with 0.1% crystal violet for 15 minutes under light-avoidance conditions and were washed three times with PBS. The crystal violet solution was washed off, and cells were allowed to dry naturally. After drying, the chamber was photographed, and cells were counted under a microscope. ImageJ software was used to analyze the count results.
Cell scratch assay
A cell scratch assay was performed to detect the cell migration ability. A cell suspension was obtained from each group, and the cell number was adjusted to 5 × 105 cells/mL, with 1 mL per well. After the cells adhered to the wall and grew, a 1000-μL pipette tip was used to scratch the adherent cell layer along the middle of each well. After aspirating the cell culture and washing the cells three times with PBS to remove detached cells and debris, the complete medium was replaced. The experiment was repeated three times. The cells were then observed and photographed under a microscope, and images of the cell scratches were recorded at 0 and 24 hours.
Statistical analysis
The data were statistically analyzed using GraphPad Prism 8 (Boston, MA, USA) and IBM SPSS Statistics Version 26 (IBM Corp., Armonk, NY, USA). Data from two groups were compared using a t-test. Data from three or more groups were compared using one-way analysis of variance. Survival analysis was performed using Kaplin–Meier analysis and the Cox proportional hazards model. A value of p < 0.05 was considered statistically significant.
Results
RAB32 expression is significantly elevated in GBM
First, we observed high expression of RAB32 in GBM, LGG, and multiple cancer types by analyzing the GEPIA database (Figure 1(a)). We also analyzed the median expression of RAB32 in glioma and normal tissue samples, which showed that RAB32 expression was much higher in tumors than in normal tissues (Figure 1(b)). In addition, RAB32 was enriched in high-grade gliomas according to the CGGA database, with a positive correlation between glioma grade and RAB32 expression. These findings were further validated using the TCGA database (Figure 1(c)). Subsequently, the expression of RAB32 in GBM cells was detected by western blotting. The results were consistent with the bioinformatics analysis, indicating that RAB32 expression in U87, U251, and A172 cells was significantly elevated (p < 0.001, p < 0.01, p < 0.05) compared with that in the normal astrocyte line (SVG p12) (Figure 1(d)). In summary, RAB32 was upregulated in gliomas and had a positive correlation with the glioma grade.

RAB32 is highly expressed in gliomas. (a) Expression of RAB32 in pan-cancers in the Gene Expression Profiling Interactive (GEPIA) database. (b) Interactive human mapping in the GEPIA database showing the median expression of RAB32 in tumor and normal samples. (c) Correlation of RAB32 with glioma grading in The Cancer Genome atlas (TCGA) and the Chinese Glioma Genome Atlas (CGGA) databases and (d) expression levels of RAB32 in glioblastoma cells (U251, U87, and A172) and normal glial cells (SVG p12); *p < 0.05, **p < 0.01, ***p < 0.001.
RAB32 is an independent prognostic factor in patients with glioma
To explore the prognostic predictive value of RAB32 in glioma patients, we conducted Kaplan–Meier and Cox proportional hazards model analyses based on the CGGA and TCGA databases. According to the CGGA database, patients with high RAB32 expression showed significantly shorter overall survival time than those with low RAB32 expression (p = 0.038). Similarly, the prognostic value of RAB32 was evaluated in TCGA database (p < 0.0001) (Figure 2(a), (b)). RAB32 expression was an independent prognostic factor, apart from known prognostic factors (original recurrence status, WHO classification, age at diagnosis, IDH mutation, and 1p/19q coding in the CGGA database; and WHO classification, age at diagnosis, IDH mutation, 1p/19q coding, and MGMT promoter methylation in TCGA database) (Figure 2(c), (d)).

Analysis of RAB32 expression in the Chinese Glioma Genome Atlas (CGGA) and The Cancer Genome Atlas (TCGA) databases. (a, b) The cutoff value for this group is the median expression of RAB32. The significance of the prognostic value was tested using a log‐rank test and (c, d) univariate and multivariate Cox analysis of RAB32 expression in the CGGA and TCGA databases and patients' clinical characteristics.
Suppression of RAB32 expression inhibits the proliferation, migration, and invasion of glioma cells
To better assess the role of RAB32 in glioma, we selected the U87 and U251 cells lines, which exhibit higher RAB32 expression levels than A172 cells, for knockdown assays. Lentivirus vectors were used to deliver sh-RAB32 (to silence RAB32) or sh-NC (as a negative control) to U87 and U251 cells. The knockdown efficiencies of RAB32 in U87 and U251 cells were estimated using western blot analysis, which showed that sh-RAB32 caused a significant decrease in the protein levels of RAB32 in U87 (p < 0.01) and U251 cells (p < 0.001) (Figure 3(a)). To examine the effect of RAB32 expression on cellular proliferation, migration, and invasion, CCK-8, plate cloning, wound healing, and Transwell assays were conducted. The results indicated that cell proliferation in the sh-RAB32 group was markedly decreased compared with than in the sh-NC group (Figure 3(b), (c)). Furthermore, the migratory and invasive capacities of GBM were significantly suppressed by downregulation of RAB32 (p < 0.05) (Figure 3(d), (e)). The expression levels of the proliferation marker c-myc, the migration marker MMP9, the anti-apoptotic marker Bcl-2, and the pro-apoptotic marker Bax were also detected in GBM cells after infection. The results showed that c-myc, MMP9, and Bcl-2 were downregulated by attenuating RAB32 expression. In contrast, Bax expression was upregulated (Figure 3(f)). These results indicated that knocking down RAB32 induced cell apoptosis. In summary, our findings demonstrate the inhibitory effect of RAB32 on glioma cell progression in vitro, suggesting a crucial role of RAB32 in gliomas.

Downregulated RAB32 inhibits glioma cell proliferation, migration, and invasion. (a) Western blot analysis was performed to examine the knockdown efficiency of RAB32 in U87 and U251 cells. (b) The effect Continued.of RAB32 knockdown on cell proliferation in U87 and U251 cells was assessed by a cell counting kit-8 assay. (c) The effect of RAB32 knockdown on colony formation of U87 and U251 cells was detected by Giemsa staining. The inhibitory effect of RAB32 on glioma cell migration was confirmed by (d) transwell and (e) wound healing assessments. (f) Western blot analysis detected the expression of proliferation, apoptosis, and invasion related proteins in U87 and U251 cells, including MMP9, c-Myc, Bcl-2, and Bax. *p < 0.05, **p < 0.01, ***p < 0.001.
RAB32 is associated with the JAK/STAT3 pathway in GBM
To investigate the underlying mechanisms of RAB32 in GBM progression, we used gene set enrichment analysis to analyze the CGGA and TCGA datasets. The results showed that RAB32 was enriched in the IL6/JAK/STAT3 signaling pathway (TCGA-NES = 2.33, p < 0.001; CGGA-NES = 2.18, p < 0.001) (Figure 4(a), (b)), indicating that RAB32 may promote the malignant progression of GBM through this signaling pathway. Western blotting was subsequently performed to verify this hypothesis. The levels of phosphorylated JAK3 and STAT3 were decreased after knocking down RAB32, while no significant change was observed in the expression of JAK3 and STAT3 (Figure 4(c)). This finding suggests a strong association between RAB32 and the JAK/STAT3 pathway in GBM.

RAB32 regulates gliomagenesis by activating JAK/STAT signaling. (a, b) Gene set enrichment analysis using The Cancer Genome Atlas (TCGA) and the Chinese Glioma Genome Atlas (CGGA) databases to determine whether RAB32 is significantly enriched in the IL6/JAK/STAT3 signaling pathway and (c) Western blot analysis detected the expression and phosphorylation of JAK/STAT signaling pathway-related proteins (including STAT3, p-STAT3, JAK3, and p-JAK3) in U87 and U251 cells after RAB32 knockdown. *p < 0.05.
RAB32 promotes GBM progression by activating the JAK/STAT3 signaling pathway
We upregulated RAB32 expression using OE-RAB32 in A172 cells, which had the lowest RAB32 expression among the three GBM cell lines (Figure 5(a)). Then, part of the OE-RAB32 cells were treated with the JAK/STAT inhibitor BP-1-102 (10 μmol/L) for 24 hours. Western blot analysis showed that p-JAK3 and p-STAT3 expression significantly increased after RAB32 overexpression (p < 0.001, p < 0.01), while there was no change in the expression levels of JAK3 and STAT3 (Figure 5(b)). In addition, overexpression of RAB32 promoted cell proliferation (Figure 5(c), (d)), migration (Figure 5e, f), and invasion (Figure 5(e)); however, these effects could be reversed by the JAK/STAT inhibitor BP-1-102. Furthermore, overexpression of RAB32 upregulated MMP9, c-myc, and Bcl-2 expression and downregulated Bax expression in A172 cells. After treatment with BP-1-102, the changes in expression of these proteins were reversed (Figure 5(g)). The results suggest that RAB32 promotes GBM cell proliferation and invasion and inhibits apoptosis by activating the JAK/STAT3 signaling pathway.

Exploration of the downstream pathway underlying the effect of RAB32 on glioma. A172 cells were transfected with OE-NC and OE-RAB32. (a) Western blot analysis was used to evaluate the Continued.transfection efficiency of RAB32 in A172 cells. (b) Western blotting was used to detect JAK/STAT signaling pathway-related proteins (including STAT3, p-STAT3, JAK3, and p-JAK3) in cells pre-transfected with OE-NC or OE-RAB32 or treated with the JAK/STAT inhibitor BP-1-102 after RAB32 overexpression. (c) Cell counting kit-8 assays were conducted to measure cell proliferation. (d) The effect of RAB32 overexpression on A172 cell colony formation was detected by Giemsa staining. (e) Treated A172 cells were subjected to a Transwell migration experiment to measure the cell migration and invasion levels. (f) Wound-healing assays were used to measure cell migration levels and (g) Western blot analysis was used to detect the expression of proliferation, migration, and invasion related proteins in A172 cells, including MMP9, c-Myc, Bcl-2, and Bax. **p < 0.01, ***p < 0.001.
Discussion
In the central nervous system, glioma constitutes approximately 35% to 40% of intracranial neoplasms. Glioma is characterized by its high incidence and aggressiveness. Despite the growing research focus on gliomas, the prognosis for glioma patients has remained poor and is characterized by an exceedingly short overall survival time, high 5-year mortality rate, and postoperative recurrence rate of up to 90%.19,20 Therefore, it is imperative to explore novel therapeutic methods to improve the prognosis of these patients.
In this study, we illustrated the role of RAB32 and its mechanism in GBM. First, we found that RAB32 was highly expressed in both LGG and GBM in a GEPIA database analysis. Additionally, the CGGA and TCGA datasets showed a positive correlation between glioma grade and the RAB32 level. The prognostic value of RAB32 in glioma patients was assessed using Kaplan–Meier survival analysis and Cox regression analysis, which revealed a significant negative correlation between RAB32 expression and patient survival time. Increased RAB32 expression resulted in decreased survival time. RAB32 expression was found to be an independent prognostic factor of glioma. A previous study reported 21 that RAB32 knockout in CD11c cells can aggravate the development of dextran sodium sulfate-induced colitis. However, inhibition of RAB32 expression can inhibit the proliferation and migration ability of K562 cells in chronic myelogenous leukemia, 22 suggesting RAB32 could play both advantageous and disadvantageous roles. Currently, the effect of RAB32 has been confirmed in various cancers, including gastric adenocarcinoma, ovarian cancer, and hepatocellular carcinoma.12,16,17 However, the function of RAB32 in gliomas remains unclear. Here, we investigated the biological function of RAB32 in glioma cell lines using RAB32 knockdown and overexpression. We found that suppression of RAB32 expression significantly inhibited the proliferation, migration, and invasion of glioma cells. In contrast, upregulation of RAB32 expression could accelerate the malignant phenotype of glioma cells. Taken together, our findings demonstrate that RAB32 expression is elevated in glioma, which strongly correlates with the poor prognosis of glioma patients. These results indicate that RAB32 is involved in the malignant progression of glioma and may act as an oncogenic factor by stimulating the malignant behaviors of diverse cancer cells.
Oncogenes usually change the biological behavior of cells through different signaling pathways. Many studies have demonstrated the pivotal role of the JAK/STAT signaling pathway in essential biological processes, including cell proliferation, apoptosis, angiogenesis, and immune responses.23–25 Empirical evidence has indicated that upregulation of miR-30 facilitates the proliferation of glioma stem cells through modulation of the JAK/STAT3 signaling pathway. 26 Chen et al. 27 reported that silencing STAT3 reduced the invasion activity of human glioma cells and induced apoptosis. TMEM158 promotes the proliferation and migration of glioma cells through STAT3 signaling in GBM. 28 In addition, STAT3/p-STAT3 was found to be related to a poor prognosis of glioma patients, indicating that STAT3/p-STAT3 may be a valuable prognostic biomarker and potential therapeutic target.29,30 There is increasing evidence to suggest31–34 that the JAK/STAT3 signaling pathway plays a crucial role in the progression of human cancers. In the present investigation, the A172 glioma cell line was treated with recombinant RAB32 protein, and overexpression of RAB32 was found to enhance the proliferation, migration, and invasion capabilities of these cells. The colony formation assay, a pivotal in vitro experimental method used to assess tumor cell growth and invasive potential, revealed that RAB32 significantly promotes the clonal expansion of glioma cells, implying its role in tumor initiation and metastatic dissemination. Concurrently, upregulation of RAB32 promoted phosphorylation of JAK3 and STAT3, thereby activating the JAK/STAT signaling pathway. Moreover, blocking of JAK/STAT signaling using the inhibitor BP-1-102 could reverse facilitation of RAB32 in glioma cells. These findings suggest that RAB32 may modulate the biological functions of glioma cells through regulation of the JAK/STAT signaling pathway.
The present study explored the potential association between RAB32 and glioma utilizing bioinformatics methodologies. Subsequently, the study delved into the functional role of RAB32 in facilitating the proliferation, survival, and migration of glioma cells, in addition to investigating the underlying molecular regulatory mechanisms through a series of cell-based experiments. It is important to note that a limitation of the current investigation lies in its exclusive focus on the in vitro environment. The study did not extend its inquiries into the more complex in vivo microenvironment, where various other factors and interactions could influence the regulatory effects of RAB32 on glioma cells. To address this limitation, we plan to establish a xenograft model in subsequent studies. This approach will enable us to investigate the pathological and molecular mechanisms underlying the potential role of RAB32 in the onset and progression of glioma.
In conclusion, this study has provided preliminary evidence suggesting that RAB32 may modulate the proliferation, survival, and migration of glioma cells through the JAK/STAT signaling pathway. However, further research is necessary to elucidate the precise functions and regulatory mechanisms of RAB32 within the in vivo tumor microenvironment. The pursuit of these investigations will contribute to a more comprehensive understanding of the significance of RAB32 in gliomagenesis and may potentially lead to the development of novel therapeutic targets for the treatment of glioma.
Footnotes
Acknowledgements
We are very grateful to Daqing Oilfield General Hospital for their kind support of this work.
Author contributions
SZ and LH designed the experiments. LZ provided technical support. SZ carried out the experiments and wrote the first version of the manuscript. ZH and XJ revised the manuscript. All authors read and approved the final manuscript.
Declaration of conflicting interest
The authors declare that there is no conflict of interest.
Funding
This study was supported by Heilongjiang Provincial Nature Science Foundation of China (LH2022H015). All authors participated in the project.
