Xiaoliu Pingyi Recipe Inhibits Lung Pre-Metastatic Niche Formation and Prevents Myeloid-Derived Suppressor Cells Recruitment

Abstract

Background:

Metastasis, a leading cause of cancer-related deaths, involves complex mechanisms. The premetastatic niche (PMN) is a crucial contributor to this process. Myeloid-derived suppressor cells (MDSCs) play an important role in PMN formation and promote tumor progression and metastasis. The Xiaoliu Pingyi recipe (XLPYR), a traditional Chinese medicine, is effective in preventing postoperative recurrence and metastasis in cancer patients.

Objective:

This study investigated the effects of XLPYR on MDSCs recruitment and on the expression of PMN markers and elucidated the mechanisms involved in the prevention of tumor metastasis.

Methods:

C57BL/6 mice were subcutaneously injected with Lewis cells and treated with cisplatin and XLPYR. Tumors were resected after 14 days after the establishment of a model of lung metastasis, and tumor volume and weight were measured. Lung metastases were observed 21 days after resection. MDSCs in the lung, spleen, and peripheral blood were detected by flow cytometry. Western blotting, qRT-PCR and ELISA were used to detect the expression of S100A8, S100A9, MMP9, LOX, and IL-6/STAT3 in premetastatic lung tissue.

Results:

XLPYR treatment inhibited tumor growth and prevented lung metastasis. Compared to mice without subcutaneous tumor cell transplantation, the model group had an increased proportion of MDSCs, higher expression of S100A8, S100A9, MMP9, and LOX in the premetastatic lung. XLPYR treatment reduced the proportion of MDSCs, S100A8, S100A9, MMP9, and LOX expression, and downregulated the IL-6/STAT3 pathway.

Conclusions

XLPYR may prevent MDSCs recruitment and reduce the expression of S100A8, MMP9, LOX, and IL6/STAT3 in premetastatic lung tissue, thus reducing lung metastases.

Keywords

Xiaoliu Pingyi recipe premetastatic niche MDSCs lung metastasis IL6/STAT3

Introduction

The prevalence of malignant tumors and cancer-related mortality has increased over time, with metastasis being the leading cause. Consequently, new therapeutic strategies are urgently needed to prevent or slow the progression of metastatic disease.¹ Metastasis is a multistep process that involves several stages, including the detachment of cancer cells from the primary tumor, penetration of the basement membrane, degradation of the extracellular matrix, and the establishment and growth of a secondary tumor at a distant site.^2,3 In recent years, premetastatic niches (PMN) have been recognized as crucial factors in the processes of tumor invasion and metastasis processes.⁴

Tumor cells that seek to establish secondary metastases rely on concerted efforts from tumor cell exosomes, tumor-derived secreted factors, and bone marrow-derived cells (BMDC) to create a PMN that is conducive to their colonization and growth.⁵ As such, intervening on the formation of the PMN has been suggested as a promising avenue to mitigate the harmful consequences of metastasis. The integral involvement of myeloid-derived suppressor cells (MDSCs), including granulocytic (G-MDSCs) and monocytic (M-MDSCs), a critical subset of BMDC, in PMN formation is well documented. Specifically, MDSCs are capable of transforming the inflammatory response and immune microenvironment of the tumor-bearing organ, thus facilitating tumor cell activity, promoting the epithelial-mesenchymal transition,⁶ and suppressing the activity of natural killer cells.⁷ IL-6/STAT3 signaling play a crucial role in the PMN and MDSCs, which influences tumor cell proliferation and metastasis, as well as the behavior of immune cells in the tumor microenvironment. Targeting IL-6/STAT3 could be a promising strategy to inhibit metastasis.^8,9

As a multicomponent and multi-target therapeutic approach, traditional Chinese medicine (TCM) holds immense promise for intervening in the formation of PMN. In particular, several TCM compounds have shown significant effects in mitigating the development of PMN.^10-12 The clinical application of the Xiaoliu Pingyi recipe (XLPYR) has shown considerable efficacy in mitigating tumor recurrence and metastasis among surgically treated patients.¹³ However, the mechanism underlying the effects of XLPYR on PMN formation and its potential as an inhibitor of metastasis remains to be elucidated. Therefore, our aim was to investigate the effects of XLPYR on PMN formation and tumor metastasis in a mouse model of lung metastasis. Specifically, we examined the effects of XLPYR on MDSCs recruitment and PMN markers expression in the premetastatic lung microenvironment and explored the underlying mechanism of XLPYR activity in preventing lung metastasis.

Methods

XLPYR Preparation

Granules of XLPYR was prepared by mixing the following herbs: astragalus 30 g crude drug (granules voucher No. 21021371), ginseng 10 g crude drug (granules voucher No. 21100641), Curcumae Rhizoma 15 g crude drug (granules voucher No. 21050311), centipede 2 g crude drug (granules voucher No. 21051181), Fritillaria thunbergii Miq 20 g crude drug (granules voucher No. 21051551), Hedyotis diffusa 30 g crude drug (granules voucher No. 21074161), and Glycyrrhizae Radix et Rhizoma 6 g crude drug (granules voucher No. 2109007). Granules were prepared by Jiangyin Tianjiang Pharmaceutical Co., Ltd., purchased from the Affiliated Hospital of Shandong University of Traditional Chinese Medicine. The pharmaceutical department evaluated the quality of granules. The total weight of granules was 24.88 g (including excipients such as dextrin). According to the body surface area method, the dosage of mice and human was converted,¹⁴ mice: 5100 mg/kg = 12.3 × human: (XLPYR 24.88 g ÷ 60 kg). Granules were dissolved in distilled water to prepare a solution with a concentration of 510 mg/mL, mice were given an intragastric dose of 0.1 mL per 10 g body weight.

Cell Line Culture

Lewis lung cancer (LCC) cells expressing green fluorescent protein (GFP-LLC) were purchased from IMMOCELL (Xiamen, Fujian, China) and maintained in DMEM culture medium (Hyclone) supplemented with 10% fetal bovine serum (SV30160) and 1% penicillin/streptomycin (V900929) at 37°C in the presence of 5% CO₂.

Animal Models and Treatment Regimes

Forty, 6-week-old C57BL/6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Animal experiments were carried out according to the standards of the Animal Ethics Committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (2021-82). Laboratory mice were kept under standard conditions, including a room temperature range of 18°C to 22°C, a 12:12-hour light/dark cycle, and provided with a purified diet and access to drinking water.

The experimental groups were as follows: the nontumor control group (normal), the tumor model group (model), the cisplatin intervention group (DDP), and the XLPYR intervention group (XLPYR), 10 mice were randomly assigned to each group. GFP-LLC (1 × 10⁶/0.2 mL cells in PBS) were subcutaneously injected into the right flank of mice of the model, DDP and XLPYR groups, while the normal group was injected with an equal volume of PBS buffer. Body weights were monitored every other day. Normal saline solution (0.1 mL/10 g body weight/day) was administered to the normal and model groups intragastrically; the DDP group was injected intraperitoneally with 0.2 mL of DDP solution (5 mg/1 kg body weight/every other day); and the XLPYR group was treated intragastrically with XLPYR granule solution (0.1 mL/10 g body weight/day). All mice groups were treated continuously for 2 weeks.

To establish the PMN and postoperative metastasis model in C57BL/6 mice, according to described in previous studies,^15-17 the 14th day following subcutaneous implantation of LLC cells was designated as the time point for assessing the status of PMNs. Under anesthesia, subcutaneous tumor tissues from mice in the model group, DDP group, and XLPYR group were excised to be weighed, and the tumor volume was determined using the formula V = L × W²/2, where L represents the length and W denotes the width of the tumor. In the normal group, model group, DDP group, and XLPYR group, 5 mice were randomly selected from each group to collect peripheral blood, while lung and spleen tissues were dissected for subsequent analysis. The remaining 5 mice in each group were allowed to recover and were closely monitored after wound closure. Lung metastases were observed 21 days after the primary tumor resection by histological hematoxylin and eosin (H&E) staining and fluorescence imaging using the IVIS Spectrum (PerkinElmer) platform.^18,19 Figure 1 demonstrates the timeline of this study.

Figure 1.

Timeline of model establishment and treatment of animal experiment.

Flow Cytometry

Mice were euthanized on the 14th day after tumor implantation and peripheral blood was collected in EDTA tubes. Lung tissue was washed with cold PBS 3 times and then dissected with scissors. To digest lung tissue, a solution containing 0.001% DNase1 (P05346, Solarbio) and 150 units/mL collagenase IV (BS165, Biosharp) in PBS was used at 37°C for 45 minutes. The spleen was dissociated in PBS using a 1 mL syringe plunger and a single cell suspension was generated by filtering the digested lung tissue and the suspension of the spleen cells through a 70 mL nylon filter. RBC lysis buffer was used to lyse red blood cells in single-cell suspensions of the lung, spleen, and peripheral blood. Cells were then labeled with BV510 Rat Anti-CD11b (562950, BD), APC/Cyanine7 anti-mouse Ly-6G (127623, Boilegend), PE antimouse Ly-6C (128007, Boilegend), and 7-AAD (559925, BD) and incubated in the dark at 4°C for 30 minutes. Antibody-labeled cells were analyzed using an Aria III flow cytometer (BD Biosciences). G-MDSCs and M-MDSCs were identified as CD11b⁺Ly6G⁺Ly6C⁻, and CD11b⁺Ly6G⁻Ly6C⁺ cells, respectively.^20,21

Western Blotting Analysis

On day 14 after tumor implantation, lung tissues were collected, homogenized, and lysed in RIPA buffer to extract total protein. Protein concentration was measured using a BCA protein assay kit (P0012, Beyotime). Absorbance was measured, and protein concentration was determined using a standard curve. The 30 μg protein samples were subjected to SDS-PAGE and subsequently transferred to PVDF membranes (G6015, Servicebio) before blocking (GF1815, Genefist Life Science CO., LTD) and incubating with primary antibodies.²² Primary antibodies included anti-S100A8 antibody (1:1000; A1688, Abclonal), anti-S100A9 antibody (1:1000; A9842, Abclonal), anti-matrix metalloproteinase 9 (MMP9) antibody (1:1000; ab76003, Abcam), anti-lysyl oxidase (LOX) antibody (1:1000; A11504, Abclonal), anti-signal transducer and activator of Transcription 3 (STAT3) antibody (1:2000; A1192, Abclonal), anti-p-STAT3 antibody (1:2000; AP0705, Abclonal), and anti-β-actin antibody (1:2000; AC006, Abclonal). The secondary antibody (1:5000; GB23303, Servicebio) was added and incubated at room temperature for 1 hour. Proteins were then visualized using an ECL luminescent reagent (PM00021, Abclonal), and the densitometric analysis of the protein bands was analyzed using Image J software.

Enzyme-Linked Immunosorbent Assay (ELISA)

The homogenization of lung tissue was conducted using cold buffered phosphate saline (PBS) followed by centrifugation at 12 000 rpm for 20 minutes at 4°C, and the resulting supernatant was used for protein quantification by BCA assay to standardize the protein concentration. IL-6 expression was then determined by ELISA using a MultiSciences kit (EK206/3).²³

QRT-PCR Analysis

The Tissue and Cell RNA Rapid Extraction kit (AC0202, Sparkjade) was used to extract total RNA from lung tissue, and the SPARKscript II RT Kit (with gDNA Eraser) (AG0304, Sparkjade) was used to synthesize cDNA from total RNA (1000 ng) by reverse transcription. qRT-PCR was performed using the Light Cycler 480 II instrument and the 2×SYBR Green qPCR Mix (AH0104, Sparkjade), following the manufacturer’s instructions. All kits associated qRT-PCR purchased from Shandong Sparkjade Biotechnology Co.,Ltd, Jinan, China.²⁴ The expression of the target genes (S100A8, S100A9, MMP9, LOX) was quantified using the 2^−ΔΔCt formula with β-actin as the internal reference gene. The primer sequences are listed in Table 1.

Table 1.

Sequence of Primers for Gene Amplification.

Gene	Primer	Sequence
MMP9	Forward	TGGTGCCCCATGTCACTTTC
MMP9	Reverse	ACAGGGTTTGCCTTCTCCGT
LOX	Forward	GTGAAGAACCAAGGGACATCG
LOX	Reverse	GGCATCAAGCAGGTCATAGTG
S100A8	Forward	TCACCATGCCCTCTACAAGAAT
S100A8	Reverse	TTATCACCATCGCAAGGAACTC
S100A9	Forward	CAGCATAACCACCATCATCGA
S100A9	Reverse	GTGCTTCCACCATTTGTCTGA
β-Actin	Forward	AGCCATGTACGTAGCCATCC
β-Actin	Reverse	CTCTCAGCTGTGGTGGTGAA

Data Analysis

Data were statistically analyzed using SPSS 25.0. Descriptive statistics were calculated to determine the mean and standard deviation (SD) of the variables. A one-way analysis of variance (ANOVA) was applied to evaluate differences between groups, followed by post hoc tests with the least significant difference (LSD) correction to compare differences between specific groups. A two-tailed test was performed and statistical significance was defined as a P-value < .05.

Results

Treatment With XLPYR Inhibited Tumor Growth and Lung Metastasis

On the 14th day after tumor implantation, the tumor was surgically resected. We found that the tumor volume and weight of the DDP group and the XLPYR group were significantly lower than those of the model group (Figure 2A, C, and D), indicating that XLPYR treatment can suppress tumor growth. On the 21st day after tumor resection, we observed metastases in lung tissue by H&E and fluorescence imaging. XLPYR exhibited an antimetastatic effect, although slightly less than DDP (Figure 3). Furthermore, suppression of body weight was not significant in the XLPYR group (Figure 2B), indicating that the toxicity of XLPYR in mice was relatively mild.

Figure 2.

XLPYR and DDP treatment inhibits LLC tumor growth in mice. (A) Tumor resection was performed on day 14 following subcutaneous injection of LLC tumor cells (n = 5). (B) Changes in body weight of mice were monitored after subcutaneous tumor transplantation in the normal, model, DDP, and XLPYR groups (n = 5). Tumor volume (C) and weight (D) were measured after resection (n = 5). ANOVA with LSD used to assess group differences.Data are represented as Mean ±SD. ^###P < .001, compared to the model group. XLPYR and DDP treatment have potential therapeutic benefits against LLC tumor growth.

Figure 3.

XLPYR and DDP treatment reduces lung metastases in LLC tumor-bearing mice after resection. (A and B) Lung metastases were visualized and quantified by fluorescence imaging on day 21 following tumor resection (n = 5). (C and D) H&E-stained lung sections were used to obtain images for the quantification of lung metastases, images were captured at a 400× magnification, and the scale bar indicates 1 mm (n = 5). ANOVA with LSD used to assess group differences. Data are represented as Mean ± SD. **P < .01, ***P < .001, compared to the normal group; ^#P < .05, ^##P < .01, ^###P < .001, compared to the model group; & P < .05, compared to the DDP group. XLPYR and DDP treatment may have a therapeutic effect on reducing the incidence of lung metastases in LLC tumor-bearing mice following resection.

XLPYR Prevents the Formation of a Premetastatic Niche in the Lung

Changes in the expression of MMP9/LOX/ S100A8/S100A9 in the lung serve as notable markers of PMN formation. To investigate the effects of XLPYR on preventing the formation of the premetastatic niche, we evaluated the expression of niche signature genes, including LOX, MMP9, S100A8, and S100A9. Upon tumor inoculation, the expression of LOX, MMP9, S100A8, and S100A9 in the lung tissue of mice increased, as demonstrated by western blotting and qRT-PCR analyses. However, compared to the model group, the expression of target genes was significantly reduced in the XLPYR treatment group. These findings suggest that XLPYR may have a potential inhibitory effect on the expression of LOX, MMP9, S100A8, and S100A9, which are involved in the process of PMN formation and cancer metastasis (Figures 4 and 5).

Figure 4.

Western blotting analysis of MMP9, LOX, S100A8, and S100A9 in premetastatic lung tissue of LLC tumor-bearing mice. β-actin served as a loading control (n = 3). ANOVA with LSD used to assess group differences. Data are represented as Mean ± SD. *P < .05, **P < .01, ***P < .001 compared to the normal group; ^#P < .05, ^##P < .01 compared to the model group. XLPYR may reduce the expression of MMP9, LOX, S100A8, and S100A9, contributing to its therapeutic effect.

Figure 5.

qRT-PCR analysis of MMP9, LOX, S100A8, and S100A9 gene expression in premetastatic lung tissue of LLC tumor-bearing mice treated with XLPYR. β-actin was used as the reference gene (n = 3). ANOVA with LSD used to assess group differences. Data are represented as Mean ± SD. *P < .05, **P < .01, compared to the normal group; ^#P < .05, compared to the model group. Treatment with XLPYR significantly downregulated the expression of MMP9, LOX, S100A8, and S100A9 mRNA, suggesting its potential as a therapeutic agent against lung metastasis.

XLPYR Inhibits the MDSCs Levels of in the Lungs, Spleens, and Peripheral Blood Cells

On day 14 after tumor implantation, the content of 2 MDSCs subpopulations in the lung, spleen, and peripheral blood of mice were quantified using flow cytometry. The results indicated that the content of M-MDSCs and G-MDSCs was significantly increased in the model group compared to the normal group. For the DDP group, only G-MDSCs in peripheral blood decreased after treatment. The level of G-MDSCs and M-MDSCs in the lung, spleen, and peripheral blood was significantly reduced by treatment with XLPYR. (Figure 6).

Figure 6.

XLPYR treatment reduces the levels of M-MDSCs and G-MDSCs in the premetastatic lung, spleen, and peripheral blood (n = 3). ANOVA with LSD used to assess group differences. Data are represented as mean ± SD. *P <.05, **P < .01, ***P < .001, compared to the normal group; ^#P < .05, ^##P < .01, compared to the model group; ^&P < .05, ^&&P <.01, compared to the DDP group. XLPYR treatment may have a therapeutic effect in reducing the levels of M-MDSCs and G-MDSCs in the premetastatic microenvironment of LLC tumor-bearing mice.

XLPYR Down-Regulates the IL-6/STAT3 Pathway in the Premetastatic Niche of the Lung

The activation of the IL-6/STAT3 pathway has been implicated in the recruitment of MDSCs to the PMN, which is critical to the establishment of a permissive microenvironment for tumor cells.²⁵ We evaluated the potential influence of XLPYR on the IL-6/STAT3 signaling pathway in the lung premetastatic niche by measuring the expression of IL-6 and p-STAT3/STAT3 using ELISA and western blotting techniques, respectively. We found that IL-6 and p-STAT3/STAT3 expression was significantly elevated in tumor-inoculated mice but decreased significantly after XLPYR treatment (Figure 7). These results suggest that XLPYR may downregulate the activity of the IL-6/STAT3 pathway in the PMN of the lung, which may ultimately contribute to its antimetastatic effects.

Figure 7.

Effects of XLPYR on the IL-6/STAT3 pathway in premetastatic lung tissue. (A) ELISA was used to measure the expression of IL-6 (n = 5). (B) The expression of p-STAT3 and STAT3 was detected using western blotting analysis (n = 3). ANOVA with LSD used to assess group differences. Data are represented as Mean ±SD. **P < .01, ***P < .001, compared to the normal group; ^#P < .05, ^##P < .01, ^###P < .001, compared to the model group. Treatment with XLPYR significantly decreased IL-6 and p-STAT3 expression, suggesting its ability to suppress the IL-6/STAT3 signaling pathway and prevent PMN formation.

Discussion

Metastasis involves several steps, including immune escape from the primary tumor, survival in the peripheral circulation, colonization, and proliferation in the target organs, which are the primary factors leading to cancer-related mortality in patients with malignant tumors. The concept of the premetastatic niche was introduced by Kaplan,⁴ who emphasized the critical role of the local microenvironment in the target organ for the establishment and growth of disseminated tumor cells before metastasis. Successful colonization of circulating tumor cells (CTCs) at distant organ sites is a crucial step in metastasis and is determined by the interaction between CTCs and the microenvironment in the target tissue.²⁶

The PMN is primarily composed of BMDCs, and MDSCs play a crucial role in the remodeling of the tumor microenvironment through immunosuppression, promotion of inflammatory responses, and induction of vascular leakage, which ultimately leads to cancer progression.^27,28 MDSCs accumulate in the premetastatic lung and promote tumor metastasis by mediating immunosuppression before tumor cell arrival. Furthermore, MDSCs contribute to inflammation, vascular hyperosmolarity, tumor cell seeding, and metastasis formation.^29,30 M-MDSCs exhibit superior immunosuppressive efficacy compared to G-MDSCs in tumor-bearing mice and cancer patients.^31,32 M-MDSCs possess prolonged longevity, enhanced cellular adaptability, and the capability to differentiate into tumor-associated macrophages.³³ Additionally, M-MDSCs function as progenitors to sustain the population of circulating G-MDSCs.³²

Changes in the expression of S100A8, S100A9, MMP9, and LOX in the lung are important markers of PMN formation.^16,34,35 S100A8/S100A9 are MDSCs-secreted immune inflammatory proteins, which are essential factors in promoting local immune disorders in the lung.^36,37 They also play a regulatory role in the immune function of myeloid cells.³⁸ Of note, Liu et al discovered that S100A8/9 and MMP9 were overexpressed during the formation of the PMN in lung cancer.¹⁶ Before tumor cells even reach the target organ, MDSCs can secrete MMP9 and other factors to reduce the coverage of pericytes and destroy the VE-cadherin junction of the vascular endothelium, resulting in high permeability of blood vessels. In the PMN, LOX can remodel the extracellular matrix by promoting collagen IV cross-linking, thus increasing the recruitment of CD11b+ bone marrow cells, leading to tumor invasion and metastasis.^35,39,40 Surgery can also induce up-regulation of LOX in mouse lung tissue to promote metastasis.⁴¹ MDSCs can be mobilized from the bone marrow and recruited to metastatic target organs, by the action of granulocyte colony-stimulating factor, and secrete MMP9, S100A8, S100A9, and chemokine Bv8, which can promote the introduction of tumor cells and recruit MDSCs. Additionally, the expression of S100A8/9 in premetastatic lung tissue can induce the expression of serum amyloid A3 and further activate the NF-κB signaling pathway, thus constructing a local inflammatory microenvironment.^42,43

TCM compounds have a significant effect on the transformation of PMN. The Baoyuan Jiedu Decoction, which enhances immune function, can inhibit the accumulation of MDSCs through the TGF-β/CCL9 pathway in the lung, thus prolonging the survival time of mice with 4T1 tumors and reducing metastasis.¹² The Xiaopi formula has been shown to prevent lung metastasis by downregulating the expression of CXCL1 in M2 macrophages, which, in turn, reduces the recruitment and differentiation of hematopoietic stem and progenitor cells into MDSCs in the bone marrow.¹¹ Another study showed that Ruyiping combined with Platycodon grandiflorum can protect the integrity of pulmonary vessels and interrupt the interaction of fibrinogen with carcinoma in situ, thus reducing its extravasation and inhibiting the formation of inflammatory PMN.¹⁰ The combination of the herb Salvia miltiorrhiza and Ginseng treatment can reduce breast cancer tumor angiogenesis, serum VEGFA levels, PMN markers, and MDSCs localization in the lungs, suggesting a potential therapeutic benefit.⁴⁴

In this study, the effects of XLPYR on PMN were investigated in the lung tissue from tumor-bearing mice. The findings indicate that XLPYR decreased the expression of S100A8, S100A9, MMP9, and LOX, while inhibiting the recruitment of MDSCs in the lung, spleen, and peripheral blood. This suggests that XLPYR suppressed the formation of the premetastatic niche in the lung, which is consistent with the results of a previous study by Qiu et al that investigated the effects of glycyrrhizic acid on PMN formation.⁴⁵ Furthermore, astragalus polysaccharide can inhibit MDSCs recruitment and formation of a premetastatic niche in the lung by suppressing the S1PR1/STAT3 signaling pathway.⁴⁶ We speculated that the Glycyrrhizae Radix et Rhizoma and astragalus in XLPYR may play an irreplaceable role. However, further research is needed to clarify the specific active compounds in XLPYR.

The activation of the IL-6/STAT3 pathway has been shown to play a critical role in PMN formation, particularly by promoting MDSCs recruitment to target organs.^25,47,48 Knocking out STAT3 or selectively inhibiting STAT3 expression in tumor-bearing mice can significantly down-regulate MDSCs aggregation and enhance the cellular immune response.⁴⁹ We found that there was an up-regulation of IL-6 and STAT3 expression in the lungs of tumor-bearing mice prior to metastasis, treatment with XLPYR resulted in down-regulation of IL-6 expression and inhibited STAT3 activation. Based on these results, we suggested that IL-6/STAT3 plays a crucial role in the mechanism of PMN formation and that XLPYR may prevent tumor metastasis and colonization by inhibiting this pathway.

Interestingly, we observed that while XLPYR exhibited less effectiveness than DDP in inhibiting tumor growth and postoperative metastasis, it demonstrated significant effects in suppressing the recruitment of MDSCs and reducing the expression of PMN related markers. Previous studies have indicated that DDP can inhibit the recruitment of MDSCs in tumors,⁵⁰ although its efficacy is lower compared to other natural compounds.⁵¹ This finding is similar to the research of Tian et al on BYJDD.¹² We speculate that the active compounds responsible for these effects may be present in the shared traditional Chinese medicines of XLPYR and BYJDD, such as Astragalus, Ginseng, and Glycyrrhizae Radix et Rhizoma, which have been shown to effectively inhibit PMN formation. Regarding the inhibition of the IL-6/STAT3 pathway, DDP exhibited limited effects compared to XLPYR, similar to the findings of Chen et al on Antrodan.⁵² This suggests that XLPYR and DDP may operate through different mechanisms in their anti-tumor and anti-metastasis activities.

Taken together, the study demonstrated that XLPYR can inhibit MDSCs accumulation in the lung premetastatic niche and can decrease the expression of S100A8/9, MMP9, and LOX and the IL-6/STAT3 pathway. However, more research is needed to determine the specific active compounds in XLPYR, given the complex composition of formulations in TCM. However, this study had certain limitations as it did not investigate other signaling pathways apart from IL-6/STAT3. In future research, we aim to elucidate the mechanism by which XLPYR inhibits PMN formation specifically through this signaling pathway by employing targeted inhibition of IL-6/STAT3.

Conclusions

XLPYR may prevent MDSCs recruitment and reduce the expression of S100A8, MMP9, LOX, and IL6/STAT3 in premetastatic lung tissue, thus reducing lung metastases.

Footnotes

Acknowledgements

The experiment was carried out in the central Laboratory, Affiliated Hospital of Shandong University of Traditional Chinese Medicine. Thanks to Dr Yuehua Jiang, Dr Zhiyong Liu, Dr Denglu Zhang, Dr Lei Qi and laboratory technology teachers for their help.

Correction July 2023:

Title has been corrected with word Pecipe changed to Recipe.

Data Availability Statement

Data supporting the findings of this study are available upon request. Interested parties may contact the authors for access to the data.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The study was funded by the Natural Science Foundation of Shandong Province (ZR2021LZY029).

ORCID iD

Honglin Li

References

Xia

Dong

, et al. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J. 2022;135:584-590.

Vanharanta

Massagué

Origins of metastatic traits. Cancer Cell. 2013;24:410-421.

Steeg

PS.

Targeting metastasis. Nat Rev Cancer. 2016;16:201-218.

Kaplan

Riba

Zacharoulis

, et al. VEGFR1-positive haematopoietic bone marrow progenitors initiate the pre-metastatic niche. Our Nat. 2005;438:820-827.

Liu

Cao

Characteristics and significance of the pre-metastatic niche. Cancer Cell. 2016;30:668-681.

Zhu

Xue

Yuan

Cao

Liu

CXCR2(+) MDSCs promote breast cancer progression by inducing EMT and activated T cell exhaustion. Oncotarget. 2017;8:114554-114567.

Sceneay

Parker

Smyth

Möller

Hypoxia-driven immunosuppression contributes to the pre-metastatic niche. OncoImmunology. 2013;2:e22355.

Chang

Bournazou

Sansone

, et al. The IL-6/JAK/Stat3 feed-forward loop drives tumorigenesis and metastasis. Neoplasia. 2013;15:848-862.

Lee

Herrmann

Buettner

Jove

Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat Rev Cancer. 2014;14:736-746.

10.

Pei

Liu

Protective effect of traditional Chinese medicine formula RP on lung microenvironment in pre-metastasis stage of breast cancer. Integr Cancer Ther. 2019;18:1534735419876341.

11.

Zheng

Wang

, et al. XIAOPI formula inhibits the pre-metastatic niche formation in breast cancer via suppressing TAMs/CXCL1 signaling. Cell Commun Signal. 2020;18:48.

12.

Tian

Song

Wang

, et al. Chinese herbal medicine Baoyuan Jiedu decoction inhibits the accumulation of myeloid derived suppressor cells in pre-metastatic niche of lung via TGF-beta/CCL9 pathway. Biomed Pharmacother. 2020;129:110380.

13.

Zhou

Jiao

ZH.

Clinical study on post-operational anti-metastasis effect of Xiaoliu Pingyi mixture. Chin J Integr Med. 2001;21:335-338.

14.

Nair

Jacob

A simple practice guide for dose conversion between animals and human. J Basic Clin Pharm. 2016;7:27-31.

15.

Zhang

Zhou

Yang

Zhang

Gao

Loss of endothelial EMCN drives tumor lung metastasis through the premetastatic niche. J Transl Med. 2022;20:446.

16.

Liu

Han

, et al. Tumor exosomal RNAs promote lung pre-metastatic niche formation by activating alveolar epithelial TLR3 to recruit neutrophils. Cancer Cell. 2016;30:243-256.

17.

Wei

Guo

Zhu

, et al. Shuangshen granules attenuate lung metastasis by modulating bone marrow differentiation through mTOR signalling inhibition. J Ethnopharmacol. 2021;281:113305.

18.

Qiu

Liu

Gao

Rhizoma amorphophalli inhibits TNBC cell proliferation, migration, invasion and metastasis through the PI3K/Akt/mTOR pathway. J Ethnopharmacol. 2018;211:89-100.

19.

Zhang

Miao

, et al. Interleukin-33 activates and recruits natural killer cells to inhibit pulmonary metastatic cancer development. Int J Cancer. 2020;146:1421-1434.

20.

Xue

, et al. Elevated granulocytic myeloid-derived suppressor cells are closely related with elevation of Th17 cells in mice with experimental asthma. Int J Biol Sci. 2020;16:2072-2083.

21.

Jiang

Hong

YQ.

Effects of hypertonic saline and hydroxyethyl starch on myeloid-derived suppressor cells in hemorrhagic shock mice under secondary bacterial attack. Biomed Res Int. 2020;2020:5417201.

22.

Zhang

Liu

, et al. Single-cell sequencing reveals the immune microenvironment landscape related to anti-PD-1 resistance in metastatic colorectal cancer with high microsatellite instability. BMC Med. 2023;21:161.

23.

Chen

Yan

, et al. Non-peptidyl non-covalent cathepsin C inhibitoEEr bearing a unique thiophene-substituted pyridine: design, structure-activity relationship and anti-inflammatory activity in vivo. Eur J Med Chem. 2022;236:114368.

24.

Zhang

Wang

, et al. K63 ubiquitination of P21 can facilitate pellino-1 in the context of chronic obstructive pulmonary disease and lung cellular senescence. Cells. 2022;11:3115.

25.

Jing

Wang

Sun

, et al. IL6/STAT3 signaling orchestrates premetastatic niche formation and immunosuppressive traits in lung. Cancer Res. 2020;80:784-797.

26.

Castro-Giner

Aceto

Tracking cancer progression: from circulating tumor cells to metastasis. Genome Med. 2020;12:31.

27.

Bayik

Lee

Lathia

JD.

The role of myeloid-derived suppressor cells in tumor growth and metastasis. Experientia Suppl. 2022;113:189-217.

28.

Cole

Pravoverov

Talmadge

JE.

Role of myeloid-derived suppressor cells in metastasis. Cancer Metastasis Rev. 2021;40:391-411.

29.

Wang

Ding

Guo

Wang

MDSCs: key criminals of tumor pre-metastatic niche formation. Front Immunol. 2019;10:172.

30.

Ren

Qin

Zhao

Role of myeloid-derived suppressor cells in the formation of pre-metastatic niche. Front Oncol. 2022;12:975261.

31.

Dolcetti

Peranzoni

Ugel

, et al. Hierarchy of immunosuppressive strength among myeloid-derived suppressor cell subsets is determined by GM-CSF. Eur J Immunol. 2010;40:22-35.

32.

Ugel

Peranzoni

Desantis

, et al. Immune tolerance to tumor antigens occurs in a specialized environment of the spleen. Cell Rep. 2012;2:628-639.

33.

Movahedi

Laoui

Gysemans

, et al. Different tumor microenvironments contain functionally distinct subsets of macrophages derived from Ly6C(high) monocytes. Cancer Res. 2010;70:5728-5739.

34.

Liu

Liao

Zhao

Myeloid-derived suppressor cells (MDSC) facilitate distant metastasis of malignancies by shielding circulating tumor cells (CTC) from immune surveillance. Med Hypotheses. 2016;87:34-39.

35.

Erler

Bennewith

Cox

, et al. Hypoxia-induced lysyl oxidase is a critical mediator of bone marrow cell recruitment to form the premetastatic niche. Cancer Cell. 2009;15:35-44.

36.

Cheng

Corzo

Luetteke

, et al. Inhibition of dendritic cell differentiation and accumulation of myeloid-derived suppressor cells in cancer is regulated by S100A9 protein. J Exp Med. 2008;205:2235-2249.

37.

Srivastava

Andersson

Zhu

, et al. Myeloid suppressor cells and immune modulation in lung cancer. Immunother. 2012;4:291-304.

38.

Yang

Anholts

Kolbe

Stegehuis-Kamp

Claas

FHJ

Eikmans

Calcium-binding proteins S100A8 and S100A9: investigation of their immune regulatory effect in myeloid cells. Int J Mol Sci. 2018;19:1833.

39.

Maruhashi

Kii

Saito

Kudo

Interaction between periostin and BMP-1 promotes proteolytic activation of lysyl oxidase. J Biol Chem. 2010;285:13294-13303.

40.

Gupta

Nguyen

Chiang

, et al. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis. Our Nat. 2007;446:765-770.

41.

Rachman-Tzemah

Zaffryar-Eilot

Grossman

, et al. Blocking surgically induced lysyl oxidase activity reduces the risk of lung metastases. Cell Rep. 2017;19:774-784.

42.

Hiratsuka

Watanabe

Aburatani

Maru

Tumour-mediated upregulation of chemoattractants and recruitment of myeloid cells predetermines lung metastasis. Nat Cell Biol. 2006;8:1369-1375.

43.

Hiratsuka

Watanabe

Sakurai

, et al. The S100A8-serum amyloid A3-TLR4 paracrine cascade establishes a pre-metastatic phase. Nat Cell Biol. 2008;10:1349-1355.

44.

Han

Qian

Zong

, et al. Systemic pharmacological verification of Salvia miltiorrhiza-Ginseng Chinese herb pair in inhibiting spontaneous breast cancer metastasis. Biomed Pharmacother. 2022;156:113897.

45.

Qiu

Huang

Liu

, et al. Modulation of intestinal microbiota by glycyrrhizic acid prevents high-fat diet-enhanced pre-metastatic niche formation and metastasis. Mucosal Immunol. 2019;12:945-957.

46.

Shen

Wang

Liu

, et al. Inhibitory effect of astragalus polysaccharide on premetastatic niche of lung cancer through the S1PR1-STAT3 signaling pathway. Evid Based Complement Alternat Med. 2023;2023:1-10.

47.

Talmadge

Gabrilovich

DI.

History of myeloid-derived suppressor cells. Nat Rev Cancer. 2013;13:739-752.

48.

Weber

Groth

Lasser

, et al. IL-6 as a major regulator of MDSC activity and possible target for cancer immunotherapy. Cell Immunol. 2021;359:104254.

49.

Abad

Nobuta

Kasai

Yong

Waschek

JA.

Targeted STAT3 disruption in myeloid cells alters immunosuppressor cell abundance in a murine model of spontaneous medulloblastoma. J Leukoc Biol. 2014;95:357-367.

50.

Huang

Cui

Shu

Cisplatin selectively downregulated the frequency and immunoinhibitory function of myeloid-derived suppressor cells in a murine B16 melanoma model. Immunol Res. 2016;64:160-170.

51.

Liu

Hong

, et al. Carnosic acid enhances the anti-lung cancer effect of cisplatin by inhibiting myeloid-derived suppressor cells. Chin J Nat Med. 2018;16:907-915.

52.

Chen

Ker

Chang

Chyau

ML.

Anti-metastatic effects of antrodan with and without cisplatin on Lewis lung carcinomas in a mouse xenograft model. Int J Mol Sci. 2018;19:1565.