Sage Journals: Discover world-class research

Abstract

Introduction

Colorectal cancer (CRC) is the world's third most frequent cancer, with a significant mortality rate due to late detection. There is a need to search for biomarkers that can detect colorectal cancer at an early stage. MicroRNAs (miRNAs) regulate several targets that function as oncogenes and/or tumor suppressor genes, so any change in microRNA expression level can predict abnormality.

Objective

The objective of the study was to evaluate the expression of miR-1290, and Suppressor of cancer cell invasion (SCAI) gene that may be used as biomarkers for early diagnosis of colorectal carcinoma.

Methodology

This study included 50 subjects consisting of newly diagnosed colorectal carcinoma patients (n = 25), and healthy controls (n = 25). After RNA isolation and reverse transcription, the expression level of miR-1290 and SCAI gene in the tissues and plasma samples of CRC patients were analyzed using real time PCR and compared with healthy individuals as normal controls. The 2^−ΔΔCt formula was used to compute the fold-change, while using miR-16 and GAPDH as reference genes for normalization.

Results

We found that miR-1290 is upregulated, whereas SCAI gene is downregulated in both plasma and tissue samples of CRC patients. For miR-1290, the sensitivity was 96% and specificity was 100%, and for SCAI, 100% sensitivity and 88% specificity was calculated by ROC analysis.

Conclusion

The expression of miR-1290 and SCAI gene may be utilized as biomarkers for diagnosis of colorectal carcinoma.

Keywords

colorectal cancer carcinoma miR gene expression

Introduction

Colorectal cancer (CRC) that affects the rectum and colon, is the third most occurring type of cancer¹ and the fourth most common cancer causing death in patients.² The global cancer data showed that it is second cancer that is most often diagnosed in women and ranks third in men.^3,4 It is contributing 9.7% of worldwide cancer burden and expected to rise with one million fatalities and over two million additional cases by the year 2030.

Commonly CRC remains asymptomatic until it has progressed to an advanced stage. It is unfortunate that up to 25% of patients are diagnosed at metastatic stage.⁵ Survival rate and prognosis of colorectal cancer depends upon the stage at which it is diagnosed, at stage I, the 5 years survival rate is 90% - 92% compared to 10% or less than 10% in stage IV, when distant metastases are present.⁶ Usually, when cancer is diagnosed with presenting symptoms, up to 70% are at an advanced stage like III-IV. For improved CRC survival rate, disease-free outcomes, and good quality of life, screening programs should be developed that can diagnose colorectal carcinoma at an early stage (I-II). In the UK, 16% decline in overall mortality rate was achieved with the use of screening colonoscopy and on fecal occult blood testing (FOBT).⁷

CRC screening is more important as CRC grows slowly, and usually symptoms are not produced until reaching large size of many centimeters, which can block feces passage, and present additional symptoms like pain, cramping, and bleeding with stool or rarely “tarry” dark stool. Development of CRC is a multistep route which involves genetic, morphological, and histological changes which takes time to mount up.⁸

Colonoscopy is an outstanding screening tool, still there are many limitations, such as bleeding, colon perforation, cost, sedation requirements and procedure invasiveness.⁹ Also, improper bowel preparation and limited access are few more limitations of colonoscopy.¹⁰ The FOBT is also considered imperfect due to low positive predictive value.¹¹ Blood biomarkers are alternative, and promising diagnostic approach for an early detection of colorectal carcinoma.^12,13

Lack of early detection is the primary cause of cancer's high fatality rate. The biomarkers that can be detected in body fluids are easier to perform.¹⁴ Biomarkers are molecular patterns, which can be helpful for early detection of colorectal carcinoma, and treatment as well.¹⁵ As compared to the conventional tools such as colonoscopy, sigmoidoscopy, FOBT, double contrast barium enema, and computer tomographic colonoscopy, it is expected that molecular tests are more sensitive, specific, and patients report better tolerance. However, additional research is required to confirm authenticity.¹⁶

MicroRNAs (miRNAs) are 18–25 bp ribonucleic acids, that inhibit the translation by binding 3’ ends of mRNA. By regulating translation, they affect cell growth, apoptosis, and differentiation.¹⁷ MiRNAs are single stranded, noncoding small RNA which by interacting with messenger RNA at 3’ untranslated region suppresses the gene expression.¹⁸ Each miRNA can potentially interrelate with diverse mRNAs, in response to them many miRNAs can be suppressed. Therefore, miRNAs are involved and affect angiogenesis, inflammatory response, and malignant transformation of cells.¹⁷

MicroRNA as a promising biomarker of cancer has been described in many cancers.¹⁹ Abnormal expression of miRNA has been linked to many types of malignant and hematological tumors which also include colorectal carcinoma, emphasizing their use as a very potential biomarker for diagnostic, prognostic, and to classify many human malignancies as well.²⁰

MicroRNAs can be extracted from blood, plasma, stool, urine, tissue samples, saliva, serum, and various body fluids in frozen and paraffin-embedded tissues because of their stability against endogenous RNAs.^21,22 Alterations in plasma microRNA expression in cancer patients are tumor-specific that can be used as promising diagnostic/prognostic non-invasive biomarkers. Plasma microRNAs are highly stable, this property highlighting their application as potential biomarker in plasma.^23,24 MicroRNA released by plasma can be measured to check in many instances, track the initiation of medication resistance mechanisms and assess the treatment efficacy.²⁵

By regulating the numerous molecular signaling pathways, these small molecules can control the immune system and metabolic activities, and their dysregulation can result in a few illnesses, including cancer.^26,27 Several miRNA expressions have been connected to different types of tumor biomarkers. Let-7a, miR-150, miR-142, miR-21, miR-223, miR-1246, miR-23a, miR-1229, and miR-378 are few examples of microRNAs, that all have been found to have high expression levels in CRC. Whereas, elevated levels of expression of miR-320, miR-596, miR-141, and miR-203 are mostly linked to tumor recurrence, malignant potential, and prognosis. Low levels of miR-484, miR-106a, and miR-130b expression are associated with poor prognosis, whereas high levels of these genes are associated with good predictive biomarkers.²⁸

Recent research has shown that miR1290 is important for determining the prognosis and an early diagnosis of patients with CRC. The expression of miR-1290 is elevated in colon cancer, which causes delayed cytokinesis and the development of multinucleated cells.²⁹ Colorectal cancer involves the carcinogenic functions of miR-1290. In CRC, cell proliferation has been inhibited by miR-1290 silencing. miR-1290 up-regulation increased cyclin D1 transcript, and protein levels while decreasing p27 expression.³⁰

A recently discovered, and extremely conserved protein known as Suppressor of cancer cell invasion (SCAI) uses a three-dimensional matrix to mediate metastasis. It has been shown that in human malignancies, SCAI serves as a target gene for several miRNAs. In many different types of cancers, SCAI is downregulated and functions as an anti-tumor gene.³¹ SCAI was first described as a tumor suppressor preventing metastasis in several human cancer cells. It is still unclear how SCAI expresses itself and what function it serves during physiological and pathological processes.³²

In the present study, the relative expression of miR-1290 and SCAI gene was determined in colorectal carcinoma patients and matched healthy controls to explore their potential as biomarkers for early detection of colorectal cancer.

Methodology

Study Subjects

The present study included a total of 50 subjects involving newly diagnosed patients with colorectal carcinoma (n = 25), and healthy human controls (n = 25). Written consent and permission were taken from all the study subjects. History was taken from all participants enrolled in the study on the pre-designed proforma.

Inclusion criteria: The newly diagnosed patients with colorectal carcinoma before chemotherapy and treatment were included in this study.

Exclusion criteria: The patients with hepatitis B & C, HIV disease, and patients having chemotherapy and radiotherapy were excluded from the study.

Ethical Approval

The study was approved by the Institute of Molecular Biology and Biotechnology Ethical Review Committee at The University of Lahore (Ref-IMBB/BBBC/22/) and ethical review board of Allama Iqbal Medical College/ Jinnah Hospital, Lahore (Ref no. 275/23/06/2022/S1 ERB).

Reporting of the Study

The reporting of this study conforms to STARD guidelines.³³

Blood Collection and Plasma Isolation

Blood samples of CRC patients were collected from Jinnah Hospital Lahore, Pakistan. Blood was collected in CBC vial, about 5 mL from each patient, and processed on the same day to isolate plasma and was kept at −20 °C until its next processing. The initial step involved separating the plasma by centrifugation at 3000 rpm for 10 min; the second step involved repeating the process at room temperature. Temperatures below −20 °C were used for storing plasma samples.³⁴

Biopsy Collection

The colonoscopy biopsy samples from CRC patients during routine colonoscopy examination were taken from Jinnah Hospital, Lahore, Pakistan. Samples were immediately placed in RNALater and were stored at −20 °C until further processing.

RNA Isolation for Colorectal Cancer Patients and Healthy Controls

Total RNA was isolated from colon biopsy and plasma samples according to the manufacturer's instructions using the mirVana™ miRNA Isolation Kit (catalog no. AM1560) by Life Technologies. For RNA extraction, 5–10 mg of frozen tissue samples were utilized, which were treated on ice to avoid thawing. The extracted RNA was then dissolved in 35 μL of RNase-free water and kept at −80 °C for future use. The concentration and purity of the isolated RNA was measured by using a NanoDrop spectrophotometer (Thermofisher Scientific). Electrophoresis to make sure the RNA was pure and undamaged was used.^29,34–36

Reverse Transcription

The Thermo Scientific™ RevertAid™ First Strand cDNA Synthesis Kit (Cat no. K1622) for whole RNA reverse transcription was utilized to reverse transcribe the extracted total RNA, which served as the microRNA template. All the procedures were performed according to the manufacturer's instructions. The steps for the reaction were as follows: first, 5 min at 65 °C, then chilled on ice. Then, incubation at 25 °C for 5 min, 42 °C for 60 min, and at the end, 70 °C for 5 min to stop the reaction. The reverse transcription mixture included 1 µL of random hexamer primers, 1 µL of Ribo-lock RNase inhibitor 200U/µL, 2 µL of 10 mM dNTP Mix, 1 µL of RevertAid M-MuLV RT (200 U/µL) reverse transcriptase, and 5 µL of the 5X reaction buffer. The final volume was 20 µL, in which 1 µg of total RNA and nuclease-free water was also included. The cDNA that was synthesized was kept at −20 °C until needed.³⁷

Quantitative Real Time PCR

Thermo Scientific Maxima SYBR Green/ROX qPCR Master Mix (2X) (cat no. K0221) kit was used to amplify the cDNA using specific primers. StepOne Plus system (Thermo Fisher Scientific) was used to perform quantitative real time PCR (qRT-PCR). Using SYBR Green master mix qRT-PCR was run to assess the changes in the expression of the miRNA and its targets. For every group, there were a minimum of two replicates used for the qPCR tests. The quantitative data was normalized using GAPDH against SCAI, while hsa-miR-16 was used to normalize the hsa-miR-1290 expression. Following conditions were followed for all experiments, initial denaturation was at 95 °C for 10 min, and in cycles denaturation at 95 °C for 15 s, annealing at 54 °C for 60 s, and extension at 60 °C for 20 s. The 2^−ΔΔCt formula was used to calculate normalized expression and fold change.³⁸ Following primer sequences were used: miR-1290 mature sequence 5’UGGAUUUUUGGAUCAGGGA 3’, SCAI sequence was 5’AAATATGTGTGAGGTGGCTG 3’.

Statistical Analysis

The data analysis was carried out using various statistical software, such as GraphPad Prism (version 8.0.2) for graphical representation, MedCalc (version 22.021) for the production of ROC curves, and Cytoscape (version 3.10.1) for the determination of miR-1290 targets. We checked the data on miRDB online website for miRNA target prediction while selecting the gene.

Results

Characteristics of Study Subjects

Overall, 50 subjects were included in the study comprising patients (n = 25), normal controls (n = 25). Patients with colorectal cancer who participated had an average age of 49.41 years and a range of 25–75 years. There were 25 CRC patients in our study, out of which 13 (52%) were males, and 12 (48%) females. From the diagnosed patients, most patients were at advanced stage ie, 6 (24%) patients at pathological stage II, 9 (36%) stage III, and 10 (40%) patients were at stage IV. The demographics of the patients and clinical details are detailed in Table 1. There were 25 healthy controls in the study, 8 were female, and 17 were male, making up 68% of the total. The average age of the healthy control subjects was 40.44, and their ages varied from 21 to 67. Hematological and other blood characteristics of healthy controls were also displayed in Table 2.

Table 1.

Demographic Representation and Medical History of the Study Subjects

Demographics and clinical characteristics of study subjects
Characteristics	Healthy individuals	Colorectal cancer patients
Total subjects (n = 50)	25	25
Gender
Male	17	13
Female	8	12
Stage II	-	6
Stage III	-	9
Stage IV	-	10
Marital status
Single	2	5
Married	23	20
Treatment of cancer
Yes	0	0
No	25	25
Family history of CRC
Yes	4	2
No	21	23
Per rectum bleed
Yes	21	13
No	4	12
Anemia
Yes	20	9
No	5	16
Abdominal pain
Yes	23	12
No	2	13
Black stool
Yes	12	6
No	13	19
Metastasis stage
Early stage	-	6
Late stage	-	19
Constipation
Yes	18	10
No	7	15
Weight loss
Yes	23	7
No	2	18
Loss of appetite
Yes	20	11
No	5	14
Lump bumps
Yes	2	8
No	23	17
Socioeconomic status
Poor	9	17
Middle class	16	13
Education status
Bachelor	3	6
Matric	6	8
Middle	3	4
uneducated	13	7
Colonoscopy
Yes	25	25
No	0	0
Age (years)	40.44 ± 14.34	49.41 ± 12.86
Weight (kg)	66.65 ± 20.62	57.45 ± 21.42
Height (cm)	165.56 ± 9.65	163.10 ± 10.76

Values are expressed as n = number or mean ± standard deviation (minimum-maximum).

Table 2.

Hematological Parameters and Liver Function Test Details of Study Subjects

Parameter	Control (n = 30)	Colorectal cancer patients (n = 30)	p value
Hemoglobin (g/dL)	13.62 ± 2.00	9.99 ± 2.06	<0.01
WBC's (10^⁹ /L)	7.22 ± 1.62	11.57 ± 13.17	0.113
Platelets (10^⁹ /L)	247.84 ± 50.37	277.45 ± 123.36	0.256
MCV (fL)	86.38 ± 7.69	71.75 ± 15.81	0.001
ALP (U/L)	72.44 ± 15.26	121.7 ± 174.49	0.007
ALT (U/L)	18.72 ± 5.96	72.5 ± 174.49	0.137
AST (U/L)	21.04 ± 4.97	88.54 ± 108.66	0.004
Bilirubin (mg/dL)	1.07 ± 1.71	1.08 ± 0.66	0.942

The values are n = number and/or mean ± standard deviation (minimum–maximum)

Circulating miR-1290 is Upregulated in Colorectal Cancer

By comparing the plasma miR-1290 levels of healthy individuals with those of cancer patients, we were able to determine the significance of miR-1290 in colorectal carcinoma. By employing RT-qPCR for relative quantification, the fold expression was ascertained. The difference in fold was calculated using the 2^−ΔΔCt formula. The difference of miR-1290 expression in patients and healthy controls was statistically significant with a p value of <0.05 as demonstrated by scatter plots. Figure 2(A) shows that, in comparison to plasma from healthy individuals, cancer patients had a significant increase in the expression of miR-1290.

MiR-1290 is Upregulated in the Tissue Biopsy of Colorectal Cancer

After collecting samples from patients with colorectal cancer during colonoscopies, miR-1290 expression level was checked in the pinch biopsy. RT-qPCR was used for relative quantification of miR-1290 in CRC patients and controls and normalized fold change in miR-1290 expression was determined by 2^−ΔΔCt formula. A graph was generated to show the relative expression of miR-1290 in colorectal cancer patients compared to healthy control subjects. As compared to healthy individuals, cancer patients exhibited a significant increase in the expression of miR-1290 Figure 2(B).

Circulating SCAI is Downregulated in Colorectal Cancer

Compared to normal plasma, CRC plasma has a decreased expression of SCAI. A patient's SCAI expression level was established using RT-qPCR. The fold change was calculated using the 2^−ΔΔCt formula. Figure 2(C) showed that compared to healthy plasma, the SCAI expression level was much lower in colorectal cancer patients’ plasma.

Target Prediction Analysis of miR-1290 by Cytoscape Software

Several tumor suppressor genes have been implicated in CRC aetiology, miR-1290 has showed a great potential to inhibit their expression. As demonstrated in Figure 1, Cytoscape was used to display the targets of miR-1290. The gene network analysis showed that the predicted target genes were involved in cell development, cell cycle, DNA replication and repair, cell death, and other related processes. In order to anticipate new miR-1290 targets, we also built a hypothetical pathway comprising these targets using Cytoscape software (Figure 1). Red round ball showed the target genes of miR-1290 which played role in CRC, green round ball showed all the genes which are targeted by miR-1290, while purple ball showed that SCAI expression is downregulated in CRC. There were a number of genes regulated by miR-1290, of which most common were BCL7A, THBS, DKK3, SMEK1, SCAI, TOMM20, HM13, ADD2, PYGO1, CREB1, CDC73.

Figure 1.

Analysis of target prediction of miR-1290. This figure showed network analysis of miR-1290 predicted targets by Cytoscape software. Red round ball showed the genes which play role in CRC and these genes are targeted by miR-1290, green round ball showed all the genes which are targeted by miR-1290, while purple ball showed that SCAI expression is downregulated in CRC.

SCAI is Downregulated in Tissue Biopsy of Colorectal Cancer

Tissues affected by colorectal cancer express less SCAI than healthy tissues. RT-qPCR was used to ascertain the degree of SCAI expression in patient tissues. To calculate the fold change, the 2^−ΔΔCt formula was employed. The results showed that compared to healthy tissue, cancer tissue had a significant decreased expression level of SCAI Figure 2(D).

Figure 2.

Graphical representation of expression of miR-1290 and SCAI in control and colorectal carcinoma patients. (A) MiR-1290 expression in colorectal carcinoma patients’ plasma and that of healthy controls (B) Expression of miR-1290 in tissue samples from colorectal cancer patients and healthy controls (C) SCAI expression in colorectal carcinoma patients’ plasma samples and in healthy controls’ samples (D) Expression of SCAI in the tissue samples of healthy control and colorectal carcinoma patients.

Comparison of Circulating and Tissue Expression

Comparison of both miR-1290 and SCAI in plasma samples and as well as matched tissue biopsy samples were shown in Figure 2. MiR-1290 was upregulated in both plasma and tissue samples while SCAI was downregulated in plasma and tissue samples as shown in Figure 2.

Comparison of Expression at Different Stages of Colorectal Cancer

When we compared the results of miR-1290 and SCAI in plasma samples and as well as matched tissue biopsy samples, we noticed that there is a gradual increase in expression of miR-1290 at all stages of colorectal cancer, and decrease in expression of SCAI in all stages of colorectal cancer, both in plasma and tissue, this differential expression is shown in Figure 3. MiR-1290 is upregulated in the plasma samples of CRC patients at all stages (II-IV) compared to the healthy control (p < 0.05) as shown in Figure 3(A). Figure 3(B) showed the results of tissue samples, miR-1290 is upregulated in the tissue samples of CRC patients compared to the healthy control tissue samples (p < 0.05). On the contrary, SCAI expression in plasma samples, and matched tissue biopsy samples is markedly reduced in colorectal cancer patients compared to the healthy control (p < 0.05) as shown in Figure 3(C) and 3(D).

Figure 3.

Graphical representation of miR-1290 and SCAI expression at various stages of colorectal cancer. (A) Stage-specific miR-1290 expression in plasma samples from healthy controls and colorectal cancer patients (B) miR-1290 expression in colorectal cancer patients’ and healthy controls’ tissue samples at various stages (C) SCAI expression in plasma samples from colorectal cancer patients and healthy controls at various stages (D) SCAI expression in tissues of colorectal cancer samples and control at different stages.

Figure 4.

Analysing clinical correlations of miR-1290 in plasma samples of CRC patients. (A) Haemoglobin (B) TLC count (C) MCV (D) Platelet count (E) ALP(F) ALT(G) AST(H) Bilirubin total. None of the measures showed a correlation that was considered statistically significant (p > 0.05).

Clinical Correlation of miR-1290 with Blood Parameters

An exceptional characteristic of a diagnostic marker is its ability to remain unaffected by clinical factors and haematological variables, thereby demonstrating its independence from clinical relevance. This was validated by a correlation study between haematological markers and miR-1290 levels in plasma. There was no statistically significant correlation between haemoglobin, total bilirubin, ALP, ALT, AST, MCV, platelet count, or total bilirubin (Figure 4A–H) that demonstrated that plasma miR-1290 is not affected by any of the markers and may be utilized as an independent predictive biomarker for CRC.

MiR-1290 and SCAI as Diagnostic Marker for CRC

To assess plasma's diagnostic potential of miR-1290 and SCAI in CRC patients, analysis of receiver operating curve (ROC) was performed. It was found that miR-1290 showed an area under the curves (AUC = 0.997, 95% CI 0.923 to 1.00), p < 0.001, representing 96% sensitivity and 100% specificity as shown in Figure 5(A). In the case of SCAI the area under the curve (AUC) was 0.942 (95% CI 0.838 to 0.988), and exhibited 100% sensitivity, 88% specificity (p < 0.001) for CRC as shown in Figure 5(B).

Figure 5.

Receiver Operating Curve (ROC) analysis of plasma miR-1290. miR-1290 showed AUC 0.997 and its p < 0.001 for CRC Figure 5(A). SCAI (AUC) was 0.942 and its p < 0.001 for CRC Figure 5(B).

Discussion

Colorectal cancer (CRC) ranks high among cancer-related deaths. In the last several decades, there has been a notable rise in both the frequency and mortality rate of CRC.²⁹ It is also becoming a main issue in Pakistani public health due to the sharp rise in cancer incidence rates. The overall burden of colorectal cancer in Pakistan, according to recent studies, was 4.27%, with 1.66% of women and 2.61% of males affected.³⁹ A lower death rate can be achieved with the early diagnosis of colorectal cancer and precancerous lesions.⁴⁰ An integral part of cancer progression is the involvement of molecular biomarkers.⁴¹ Early detection, tracking of illness development, and evaluation of therapy efficacy can all be accomplished with the use of biomarkers. The clinical use of microRNAs (miRNAs) as novel biomarkers for diagnosis or prognosis has been suggested due to their great specificity and sensitivity.^41,42

The available methods for CRC detection are, stool-based, imaging, endoscopic testing,^43,44 and markers such as carcinoembryonic antigen (CEA) and carbohydrate antigen (CA19-9). Their utility remains debatable due to certain limitations, as (CEA) and, (CA19-9) are non-specific.⁴⁵ While colonoscopy has its own limitations including bleeding, colon perforation, cost, sedation requirements, procedure invasiveness, improper bowel preparation and limited access.⁹ The biomarkers that can be detected in body fluids are easier to perform.^15,45 MicroRNAs (miRNAs) in the blood can be utilized as biomarkers and diagnostics in CRC as in CRC often the miRNAs are deregulated.⁴⁶ The advantages of miRNA biomarkers are that these are noninvasive, with a high degree of specificity, and sensitivity, miRNA biomarkers that are specific to CRC or combinations of miRNA biomarkers that are detectable in serum or plasma.⁴⁷

This study showed that miR-1290 is dysregulated in the bloodstream, and it may be useful to detect colorectal cancer at an early stage. The findings suggested that elevated levels of miR-1290 are strongly connected with the advancement of the illness and that circulating miR-1290 is a possible biomarker for CRC tumors. Valuable early screening and monitoring can provide two benefits ie, reducing the likelihood of overdiagnosis-related overtreatment and improving patient prognosis.³⁸ Circulating miRNAs exhibit greater stability than cellular RNA species under extreme conditions, such as boiling, numerous cycles of freezing and thawing, treatment with RNase, and extremes of pH. For this reason, evaluating circulating miRNAs is a crucial component of liquid biopsy.⁴⁸ Few studies have demonstrated changes in miR-1290 expression in colorectal cancer (CRC) tissue and serum, indicating that miR-1290 may be a useful diagnostic tool for CRC. This suggests that miR-1290 overexpression could potentially contribute to the development of CRC.^48,49 This study's results have demonstrated that miR-1290 promotes tumor progression because it was found to be considerably increased in colon cancer tissue compared to normal tissue of healthy control. MiR-1290 elevated in blood plasma, and tissue biopsy of the same patients, suggesting that detection of this microRNA in the plasma can be helpful for the early diagnosis of CRC. In addition, we found no significant link between haemoglobin, total bilirubin, platelet count, ALP, ALT, AST, MCV, or any of the haematological markers that we tested for miR-1290's clinical relevance. It can be inferred from these results that the clinical features did not impact miR-1290 levels.

Although the technology for cell-free miRNA identification is developing, there are still a lot of issues that need to be resolved before it can be used in clinical practice. Since circulating miRNA concentrations are relatively low, as well as miRNA integrity and detection stability, a high extraction efficiency should be ensured. Confirmation of procedures prior to analysis influencing miRNA quantification is highly significant, especially when a single miRNA is selected as a clinical biomarker. Most of the indicators’ clinical utility is dependent on resolving the mentioned issues, even though strongly up- or down-regulated miRNAs offer advantages as biomarkers. Methodological verification hasn't been done in many studies.⁵⁰ Given that the molecular mechanism and miRNA expression differ, a detection strategy that works for one study may not work for another. This means that the detection process (accuracy, repeatability, and reliability) for a particular miRNA needs to be checked and enhanced.⁵¹

Interestingly, we found that SCAI could be a miR-1290 target. Consistent with an earlier study that also discovered a reduction in SCAI in cancers of the human body, the current research showed that SCAI was downregulated in tumor tissues as compared to normal tissues suggesting a tumor suppressive role.⁵² The main cause of cancer death is metastasis, a complicated process brought on by mutations in tumor suppressor, and proto-oncogene genes that are linked to angiogenesis, invasion, proliferation, and migration of cancer cells.⁵³ The possible pathway through which upregulation of miR-1290 and SCAI can regulate the cell programming is shown in the Figure 6.

Figure 6.

The possible pathway through which upregulation of miR-1290 and SCAI can regulate the cell programming. Upregulation of miR-1290 blocks the DDK and blockage of DDK3 blocks wnt signaling pathway, and beta catenin gets activated and causes increased proliferation, migration, and angiogenesis.

In a study conducted by Li et al, it was found that miR-1290 stimulated the growth, and spread of esophageal squamous cell carcinoma cells via blocking SCAI. Based on our findings, miR-1290 likely triggered an increase in CRC cell migration, and invasion by inhibiting SCAI. The results of different studies showed that miR-1290 inhibited the SCAI, and promoted cell proliferation and metastasis in cancer.⁵⁴ The function of miR-1290 in colorectal cancer (CRC) remains unclear, despite its demonstration as an onco-miRNA in multiple cancer types. In an in-vitro study it has been demonstrated the miR-1290's potential to promote cancer and blood vessel formation in colorectal cancer cells and human umbilical vein endothelial cells (HUVECs). Increased proliferation, and migration of HUVECs are caused by miR-1290 overexpression while downregulation of SCAI.⁵⁵ Here, our findings suggest that miR-1290 expression is significantly increased in the plasma and tissue of colorectal cancer patients, while expression of SCAI is downregulated in both plasma and tissue. So, the expression level of miR-1290 and SCAI may be a possible biomarker for the detection of CRC.

Conclusion

We have validated novel molecular markers comprising miR-1290 and SCAI in plasma and tissue for CRC detection. Expression of miR-1290 was upregulated in tissue, and plasma samples of CRC patient's while SCAI expression in the plasma and tissue was significantly downregulated. Therefore, expression levels of miR-1290 and its target gene SCAI may be utilized as potential biomarkers for detection of colorectal cancer.

Further research is needed before miRNA profiling may be used in clinical practice. Finding specific miRNA signatures to differentiate between subtypes will be a major challenge in the coming years.

Footnotes

List of Abbreviations

Acknowledgements

None declared.

Author Contributors

Conceptualization and designing and Conduction of experiment: SS, RN Instrumentation and analysis: RN, SS. Data collection, visualization and interpretation: RN, SS, WS, GA. Preparation of initial draft: RN, SS. Proof reading and approval of the final version: RN, SS, WS, GA. All authors have critically reviewed and approved the final draft and are responsible for the content and similarity index of the manuscript.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethical Approval

For this study involving human subjects, a formal ethical approval has been taken from ethical review committee of Institute of Molecular Biology and Biotechnology at University of Lahore, Lahore, Pakistan (Ref. No. IMBB/BBBC/22) and Ethical review Board of Allama Iqbal Medical College/Jinnah Hospital Lahore (Ref. No. 275/23/06/2022/S1 ERB).

Funding

The authors received no financial support for the research, authorship, and/or publication of this article.

Informed Consent

Written informed consent has been taken from all the subjects to participate in the study.

ORCID iD

Samiah Shahid

References

Del Vecchio

Mastroiaco

Di Marco

, et al. Next-generation sequencing: Recent applications to the analysis of colorectal cancer. J Transl Med. 2017 Dec;15(1):246.

Forman

Ferlay

Stewart

Wild

. The global and regional burden of cancer. World Cancer Rep. 2014;2014:16-53.

Baena

Salinas

. Diet and colorectal cancer. Maturitas. 2015;80(3):258-264.

Favoriti

Carbone

Greco

Pirozzi

REM

Corcione

. Worldwide burden of colorectal cancer: A review. Updat Surg. 2016;68(1):7-11.

Huang

Wang

Wen

, et al. Hsa-miR-19a is associated with lymph metastasis and mediates the TNF-α induced epithelial-to-mesenchymal transition in colorectal cancer. Sci Rep. 2015;5(1):13350.

Ogunwobi

Mahmood

Akingboye

. Biomarkers in colorectal cancer: Current research and future prospects. Int J Mol Sci. 2020;21(15):5311.

Maida

Macaluso

Ianiro

, et al. Screening of colorectal cancer: Present and future. Expert Rev Anticancer Ther. 2017;17(12):1131-1146.

Balchen

Simon

. Colorectal cancer development and advances in screening. Clin Interv Aging. 2016 Jul;11(2016):967-976.

Ladabaum

Dominitz

Kahi

Schoen

. Strategies for colorectal cancer screening. Gastroenterology. 2020;158(2):418-432.

10.

Young

Womeldorph

. Colonoscopy for colorectal cancer screening. J Cancer. 2013;4(3):217.

11.

Issa

Noureddine

. Colorectal cancer screening: An updated review of the available options. World J Gastroenterol. 2017;23(28):5086.

12.

Gao

Wang

Zhou

Sheng

Qian

Huo

. Evaluation of serum CEA, CA19-9, CA72-4, CA125 and ferritin as diagnostic markers and factors of clinical parameters for colorectal cancer. Sci Rep. 2018;8(1):2732.

13.

Marcuello

Vymetalkova

Neves

, et al. Circulating biomarkers for early detection and clinical management of colorectal cancer. Mol Aspects Med. 2019;69(2019):107-122.

14.

Ding

Han

Zhang

. Predictive biomarkers of colorectal cancer. Comput Biol Chem. 2019;83(2019):107106.

15.

Pellino

Gallo

Pallante

, et al. Noninvasive biomarkers of colorectal cancer: role in diagnosis and personalised treatment perspectives. Gastroenterol Res Pract [Internet]. 2018 [cited 2024 Feb 15];2018. https://www.hindawi.com/journals/grp/2018/2397863/ .

16.

Mármol

Sánchez-de-Diego

Pradilla Dieste

Cerrada

Rodriguez Yoldi

. Colorectal carcinoma: A general overview and future perspectives in colorectal cancer. Int J Mol Sci. 2017;18(1):197.

17.

Lin

Gregory

. MicroRNA biogenesis pathways in cancer. Nat Rev Cancer. 2015;15(6):321-333.

18.

Yiu

. Biomarkers in colorectal cancer. Anticancer Res. 2016;36(3):1093-1102.

19.

Kanaan

Roberts

Eichenberger

, et al. A plasma microRNA panel for detection of colorectal adenomas: A step toward more precise screening for colorectal cancer. Ann Surg. 2013;258(3):400-408.

20.

Al-Sheikh

Ghneim

Softa

, et al. Expression profiling of selected microRNA signatures in plasma and tissues of Saudi colorectal cancer patients by qPCR. Oncol Lett. 2016;11(2):1406-1412.

21.

Xuan

Yang

Zhao

, et al. MicroRNAs in colorectal cancer: Small molecules with big functions. Cancer Lett. 2015;360(2):89-105.

22.

Rapado-González

Álvarez-Castro

López-López

Iglesias-Canle

Suárez-Cunqueiro

Muinelo-Romay

. Circulating microRNAs as promising biomarkers in colorectal cancer. Cancers (Basel). 2019;11(7):898.

23.

Zanutto

Pizzamiglio

Ghilotti

, et al. Circulating miR-378 in plasma: A reliable, haemolysis-independent biomarker for colorectal cancer. Br J Cancer. 2014;110(4):1001-1007.

24.

Wikberg

Myte

Palmqvist

Van Guelpen

Ljuslinder

. Plasma mi RNA can detect colorectal cancer, but how early? Cancer Med. 2018 May;7(5):1697-1705.

25.

Gaedcke

Grade

Camps

, et al. The rectal cancer microRNAome–microRNA expression in rectal cancer and matched normal mucosa. Clin Cancer Res. 2012;18(18):4919-4930.

26.

Kalhori

Saadatpour

Arefian

, et al. The potential therapeutic effect of RNA interference and natural products on COVID-19: A review of the coronaviruses infection. Front Pharmacol. 2021;12:116.

27.

Thurnherr

Mah

Lei

Jin

Rozen

Lee

. Differentially expressed miRNAs in hepatocellular carcinoma target genes in the genetic information processing and metabolism pathways. Sci Rep. 2016;6(1):20065.

28.

Fadaka

Pretorius

Klein

. Biomarkers for stratification in colorectal cancer: MicroRNAs. Cancer Control. 2019;26(1):107327481986278.

29.

Nobari

Soheilifar

Neghab

Jalilian

Bahreini

Amini

. Expression of miR-1290 and its target genes THBS1 and DKK3 in colorectal cancer patients. Basic Clin Cancer Res. 2020;12(1):10-17.

30.

Ghafouri-Fard

Khoshbakht

Hussen

Taheri

Samadian

. A review on the role of miR-1290 in cell proliferation, apoptosis and invasion. Front Mol Biosci. 2021;8:763338.

31.

Cai

Zhang

Cao

Sun

Wang

. Inhibition of microrna-766-5p attenuates the development of cervical cancer through regulating SCAI. Technol Cancer Res Treat. 2020;19:153303382098008.

32.

Gasparics

Kökény

Fintha

, et al. Alterations in SCAI expression during cell plasticity, fibrosis and cancer. Pathol Oncol Res. 2018;24:641-651.

33.

Bossuyt

Reitsma

Bruns

, et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. Radiology. 2015 Dec;277(3):826-832.

34.

Salvianti

Gelmini

Mancini

, et al. Circulating tumour cells and cell-free DNA as a prognostic factor in metastatic colorectal cancer: The OMITERC prospective study. Br J Cancer. 2021;125(1):94-100.

35.

Brown

RAM

Epis

Horsham

Kabir

Richardson

Leedman

. Total RNA extraction from tissues for microRNA and target gene expression analysis: Not all kits are created equal. BMC Biotechnol. 2018 Dec;18(1):16.

36.

Valmiki

Ahuja

Paul

. MicroRNA exhibit altered expression in the inflamed colonic mucosa of ulcerative colitis patients. World J Gastroenterol. 2017;23(29):5324.

37.

Chen

Pan

, et al. Gene expression differences among different MSI statuses in colorectal cancer. Int J Cancer. 2018 Oct;143(7):1731-1740.

38.

Cai

Chen

Zhu

Cai

. Circulating MiR-1290 as a potential diagnostic and disease monitoring biomarker of human gastrointestinal tumors. BMC Cancer. 2021 Dec;21(1):989.

39.

Ali Khan

Fallah

Sundquist

Brenner

Kharazmi

. Risk of colorectal cancer in patients with diabetes mellitus: A Swedish nationwide cohort study. PLoS Med. 2020;17(11):e1003431.

40.

Azizi

Asadollahi

Esmaeili

Mirzapoor

. Iranian Dietary patterns and risk of colorectal cancer. Health Promot Perspect. 2015;5(1):72.

41.

Wang

Chen

Sen

. MicroRNA as biomarkers and diagnostics. J Cell Physiol. 2016 Jan;231(1):25-30.

42.

Lech

Słotwiński

Słodkowski

Krasnodębski

. Colorectal cancer tumour markers and biomarkers: Recent therapeutic advances. World J Gastroenterol. 2016;22(5):1745.

43.

Riedmaier

Pfaffl

. Transcriptional biomarkers–high throughput screening, quantitative verification, and bioinformatical validation methods. Methods. 2013;59(1):3-9.

44.

Lee

Liles

Bent

Levin

Corley

. Accuracy of fecal immunochemical tests for colorectal cancer: Systematic review and meta-analysis. Ann Intern Med. 2014 Feb 4;160(3):171-181.

45.

Shang

Wang

Zhu

, et al. Downregulation of miR-423-5p Contributes to the Radioresistance in Colorectal Cancer Cells. Front Oncol [Internet]. 2021 [cited 2024 Feb 1];10. https://www.frontiersin.org/journals/oncology/articles/10.3389/fonc.2020.582239 .

46.

Bagheri

Ghorbian

. Tumor circulating biomarkers in colorectal cancer. Cancer Treat Res Commun. 2024;38:100787.

47.

Ahadi

. The significance of microRNA deregulation in colorectal cancer development and the clinical uses as a diagnostic and prognostic biomarker and therapeutic agent. Non-Coding RNA Res. 2020;5(3):125-134.

48.

Vigneron

Vernon

Meryet-Figuière

, et al. Predictive relevance of circulating miR-622 in patients with newly diagnosed and recurrent high-grade serous ovarian carcinoma. Clin Chem. 2020;66(2):352-362.

49.

Liu

Pan

, et al. Circulating miR-1290 and miR-320d as novel diagnostic biomarkers of human colorectal cancer. J Cancer. 2019;10(1):43.

50.

Moltzahn

Olshen

Baehner

, et al. Microfluidic-based multiplex qRT-PCR identifies diagnostic and prognostic microRNA signatures in the sera of prostate cancer patients. Cancer Res. 2011;71(2):550-560.

51.

Tzimagiorgis

Michailidou

Kritis

Markopoulos

Kouidou

. Recovering circulating extracellular or cell-free RNA from bodily fluids. Cancer Epidemiol. 2011;35(6):580-589.

52.

Brandt

Baarlink

Kitzing

, et al. SCAI Acts as a suppressor of cancer cell invasion through the transcriptional control of β1-integrin. Nat Cell Biol. 2009;11(5):557-568.

53.

Turajlic

Swanton

. Metastasis as an evolutionary process. Science. 2016;352(6282):169-175.

54.

Zhang

, et al. MicroRNA-1290 promotes esophageal squamous cell carcinoma cell proliferation and metastasis. World J Gastroenterol WJG. 2015;21(11):3245.

55.

Soheilifar

Pornour

Saidijam

, et al. miR-1290 contributes to oncogenesis and angiogenesis via targeting of THBS1, DKK3 and, SCAI. BioImpacts BI. 2022;12(4):349.

Oncogenic microRNA-1290 and SCAI Gene as Potential Biomarker for Colorectal Carcinoma

Abstract

Introduction

Objective

Methodology

Results

Conclusion

Keywords

Introduction

Methodology

Study Subjects

Ethical Approval

Reporting of the Study

Blood Collection and Plasma Isolation

Biopsy Collection

RNA Isolation for Colorectal Cancer Patients and Healthy Controls

Reverse Transcription

Quantitative Real Time PCR

Statistical Analysis

Results

Characteristics of Study Subjects

Circulating miR-1290 is Upregulated in Colorectal Cancer

MiR-1290 is Upregulated in the Tissue Biopsy of Colorectal Cancer

Circulating SCAI is Downregulated in Colorectal Cancer

Target Prediction Analysis of miR-1290 by Cytoscape Software

SCAI is Downregulated in Tissue Biopsy of Colorectal Cancer

Comparison of Circulating and Tissue Expression

Comparison of Expression at Different Stages of Colorectal Cancer

Clinical Correlation of miR-1290 with Blood Parameters

MiR-1290 and SCAI as Diagnostic Marker for CRC

Discussion

Conclusion

Footnotes

List of Abbreviations

Acknowledgements

Author Contributors

Declaration of Conflicting Interests

Ethical Approval

Funding

Informed Consent

ORCID iD

References