Abstract
Introduction:
The angiotensin-converting enzyme gene (ACE) is directly involved in the process of cancer cell proliferation, differentiation, apoptosis and angiogenesis. It also plays a vital role in inducing liver fibrosis and developing hepatocellular carcinoma (HCC). The aim of this study was to investigate the relationship between ACE insertion/deletion (I/D) polymorphism and the risk of HCC in a Chinese Dai population.
Materials and methods:
We conducted a study including 210 patients with HCC and 206 healthy controls in Yunnan Cancer Hospital between January 2012–January 2014. I/D genotypes of ACE were determined with polymerase chain reaction (PCR) amplification of DNA from peripheral blood leukocytes.
Results:
The ACE D allele was more frequent in the HCC cases than in the controls (51.7% vs 44.4%, p=0.036). Individuals with DD genotypes were associated with increased HCC risk compared with those with the II genotypes (odds ratio (OR), 1.911; 95% confidence interval (CI), 1.081–3.379; p=0.025). However, the ACE I/D polymorphism were not significantly associated with any clinicopathological characteristics such as the tumor stage, serum alpha-fetoprotein (AFP) level, and hepatitis B virus (HBV) infection.
Conclusions:
The DD genotypes of ACE I/D polymorphism might contribute to the prediction of HCC risk in a Chinese Dai population.
Introduction
Hepatocellular carcinoma (HCC) is the fifth most common cancer, and the third most common cause of cancer death worldwide. 1 Its incidence is still increasing in China, with more than 330,000 new cases every year. It is the second most common cause of cancer-related death in China. 2 Some risk factors such as hepatitis B virus (HBV) and hepatitis C virus (HCV) infection, sustained alcohol use, cirrhosis, environmental factors, and a great number of complex genetic variants have been identified to be potentially associated with HCC risk. 3
Some studies have shown that tumor angiogenesis occurs at the early stage of tumor formation, which plays a vital role in promoting progressive tumor growth.4–6 Any tumor, including HCC, depends on the formation of a vascular network to provide its with oxygen and essential nutrients.5,6 The tumor that has not acquired its own new blood supply can not grow to more than a few millimeters in size. 4 Recent studies have demonstrated that angiotensin-converting enzyme (ACE), the regulator of the renin-angiotensin system (RAS), is overexpressed in several cancers including HCC, and directly involved in the process of cancer cell proliferation, differentiation, apoptosis, and angiogenesis. 7 It also plays a vital role in inducing liver fibrosis and developing HCC. 8 In addition, ACE inhibitors (ACE-Is), conventional antihypertensive agents, were found to decrease the cancer risk, and attenuate tumor growth via the suppression of angiogenesis in vitro and in vivo.9,10 Several studies have confirmed that ACE-Is may protect against the risk of HCC.11,12 Previous studies indicate an association between the level of ACE and HCC risk.
Gene insertion/deletion (I/D) polymorphism is a common type of DNA sequence variation and is thought to affect the expression of the gene and be associated with the occurrence and progress of certain gene-related diseases. 13 It was reported that the angiotensin-converting enzyme gene (ACE) I/D polymorphism accounted for 30–50% of the ACE serum concentration variance. 14 Some studies have showed a link between the ACE I/D polymorphism and the risk of various malignancies such as breast, gastric, and pancreatic cancer.15–17 However, to our knowledge, the relationship between the ACE polymorphism and the risk of HCC has not been completely clarified. Therefore, in the present study, we evaluated the relationship between the ACE I/D polymorphism and HCC susceptibility in a Chinese Dai population.
Materials and methods
Subjects
The ethics committee of Yunnan Cancer Hospital Board approved the study protocol and all participants provided written informed consent for the study. A total of 416 subjects from the Chinese Dai population, including 210 HCC patients and 206 control subjects were enrolled into this study in the Yunnan Cancer Hospital between January 2012–January 2014. Diagnosis of HCC was based on clinical laboratory data, and liver scans such as abdominal ultrasound examination, abdominal computed tomography (CT), and magnetic resonance imaging (MRI). In some cases, the diagnosis was established by percutaneous core biopsy or aspiration biopsy. The patients were staged according to the National Comprehensive Cancer Network (NCCN) guidelines (2010 version) 18 . Control subjects were healthy adults without a history of cancer as confirmed by ultrasonography. They were selected randomly from the general population and frequency matched to HCC cases for age and sex.
Genotyping
DNA was isolated from peripheral blood leukocytes with the DNA Blood Mini Kit (Biotech Corporation, Beijing, China) according to the manufacturer’s instructions. ACE genotyping was determined by PCR as described previously. 19 A typical 50 μl reaction mixture consisted of 25 μl of HotStarTaq Master Mix (Qiagen), 100 ng of genomic DNA, and 0.2 μM of each primer. The ACE primers used in PCR were listed as follows: forward primer: CTGGAGACCACTCCCATCCTTTCT, reverse primer: GATGTGGCCATCACATTCGTCAGAT. The PCR conditions consisted of an initial five-minute denaturation at 95°C, followed by 35 cycles of 30 s at 94°C, 90 s at 70°C, 90 s at 72°C, and 10 m at 72°C. Amplified ACE fragments were separated on 5% polyacrylamide gel and visualized by silver staining. The 490-bp-long fragment amplification indicated presence of the I allele, while the 190-bp-long fragment amplification indicated presence of the D allele. The ID genotype commonly showed a double band at 490 bp and 190 bp. The different genotypes were further confirmed by the direct sequencing method.
Angiotensin-converting enzyme gene (ACE) insertion/deletion (I/D). Lane 1: DNA marker; Lane 2, 3: negative control; Lane 4, 7: DD genotype; Lane 5: ID genotype; Lane 6, 8: II genotype.
Statistical analysis
The statistical analyses were performed by SPSS software, version 13.0. Chi-square analysis or the Student’s t-test was used to compare the differences in demographic variables between HCC cases and controls. Hardy-Weinberg equilibrium was tested with a goodness-of-fit chi-square test with one degree of freedom to compare the observed genotype frequencies with the expected genotype frequencies. The distribution of ACE genotypes and alleles in the case and control groups were compared by either Pearson Chi-square test or Fisher’s exact test. The odds ratio (OR) and the 95% confidence interval (95% CI) were calculated to evaluate the risk of HCC with the ACE genotypes. Correlations between ACE I/D polymorphism and clinicopathological parameters such as HBV infection serum a-fetoprotein (AFP) level, tumor stage, and Child-Pugh grade in HCC patients were also evaluated with the chi-square test. A value of p less than 0.05 was considered statistically significant.
Results
Population characteristics
A total of 210 HCC patients and 206 control cases were included in this study. There were no statistical significant differences between the two groups in terms of gender and age distribution. The mean age was 53.3±12.6 years (range, 17–83 years) in HCC patients, and 51.1±11.2 years (range, 24–88 years) in controls. HBV infections were present in 168 (80.0%) cases of HCC patients, and 151 (71.9%) out of 210 patients were diagnosed in advanced stages (stage III and stage IV) (Table 1).
Characteristics of the analyzed groups.
AFP: alpha-fetoprotein; HBV: hepatitis B virus; HCC: hepatocellular carcinoma.
Adjusted for age, sex.
Association between ACE I/D polymorphism and HCC risk
The genotype distribution of ACE I/D polymorphism was in accordance with Hardy-Weinberg equilibrium in the patients and controls. The ACE D allele frequency was 51.7% among the HCC cases and 44.4% among the controls, and the difference was statistically significant (p=0.036). Of the 210 HCC patients, 50 (23.8%) cases carried the II genotype, 103 (49.1%) carried the ID genotype, and 57 (27.1%) carried the DD genotype. The frequencies of II, ID and DD genotypes in the control group were 27.7%, 55.8%, and 16.5%, respectively. DD carriers were associated with increased HCC risk compared with II carriers (OR, 1.911; 95% CI, 1.081–3.379; p=0.025) (Table 2). The relationships between ACE polymorphism and clinicopathological parameters in HCC patients were subsequently explored. However, no significant correlation was found between the polymorphic genotypes of ACE and the clinical pathological variables such as HBV infection, serum AFP level, tumor stage, and Child-Pugh grade in HCC patients (Table 3).
The association between the angiotensin-converting enzyme gene (ACE) insertion/deletion (I/D) polymorphism and hepatocellular carcinoma (HCC) risk.
CI: confidence interval; OR: odds ratio.
Association between angiotensin-converting enzyme gene (ACE) insertion/deletion (I/D) polymorphism and clinicopathological parameters in hepatocellular carcinoma (HCC) patients.
AFP: a-fetoprotein; HBV: hepatitis B virus.
Discussion
This case-control study was undertaken to investigate the potential relationship between ACE I/D polymorphism and the risk of HCC in the Chinese Dai population. Our study showed that DD carriers were associated with increased HCC risk compared with II carriers (OR, 1.911; 95% CI, 1.081–3.379; p=0.025). This finding suggests that the DD genotype of ACE I/D polymorphism may alter the susceptibility to HCC.
Previous studies have investigated the associations between this polymorphism with cancer risk. However, the results were inconsistent and conflicting. Liu et al. reported the ACE DD genotype was related to a 5.46-fold higher risk of developing oral cancer than those with the II genotype in the Chinese Taiwan population. 20 Ruiter et al. reported a correlation between the D allele and an increased risk of prostate cancer and postmenopausal breast cancer in a meta-analysis. 21 On the contrary, Gao et al. did not detect any significant correlation between ACE I/D polymorphism and lung cancer risk in a meta-analysis of six studies of 1183 lung cancer patients and 1065 controls. 22 Similarly, Zhang et al. found no significant association between the I/D polymorphism and lung cancer, breast cancer, prostate cancer, colorectal cancer, gastric cancer risks through the comparison of DD+DI vs II genotype in a meta-analysis of 25 case-control studies comprising 3914 cancer patients and 11,391 controls. 23 The discrepancy of the results might be explained partially by cancer or ethnicity specific effects.
The ACE I/D polymorphism have been found to influence serum ACE activity. The presence of the I allele gives rise to lower ACE activity in serum and tissues, whereas DD carriers have increased ACE levels. 14 The increased ACE level plays a important role in neovascularization of hepatocellular carcinoma via stimulating angiotensin II production.8,12 Castellon et al. supposed that the ACE I/D polymorphism were associated with cancer susceptibility through regulation of the ACE level and angiotensin-II activity. 24 Angiotensin-II would in turn induce vascular endothelial growth factor (VEGF) expression in the tumor cells and vascular endothelial cells. 8
In addition to the ACE polymorphism, alcohol consumption and HBV infection have been confirmed to be etiological factors of HCC in previous studies. 3 In the current study, the influence of the ACE genotype on HCC development was found to be uncorrelated with the risk factor of HBV infection when stratified analysis was conducted on the basis of presence or absence of HBV infection. Nevertheless, HBV carriers accounted for more than 80% of the total patients, which might result in a bias.
The ACE I/D polymorphism has also been identified as a factor for predicting cancer progression and clinical outcome. Röcken et al. reported that ACE was expressed locally in gastric cancer and that the ACE D allele was associated with the number of nodal metastases. 16 On the contrary, De Martino et al. revealed that neither the ACE genotypes nor alleles were associated with the tumor stage or grade in renal cell carcinoma. 25 Similarly, in the present study, we failed to detect any association between the ACE polymorphisms and tumor stage, portal vein invasion status, and serum AFP level in HCC.
Some limitations of our study should be taken into account. Firstly, HCC is a multifactor-induced disease; unfortunately, we were unsure about the completeness of data on some confounding factors, such as smoking status and alcohol consumption, which limited our research to assess the interactions between genetic factors and environmental factors. Secondly, this study sample size is limited, our results need to be examined further with trials based on multi-institute collection of more patients. Thirdly, we only determined the ACE I/D polymorphism in intron16, which accounted for 30–50% of the variability of plasma ACE levels.14,26 However, a large number of ACE polymorphisms remain unexplored.
In summary, in spite of the limited sample size, our results still suggest that the DD carriers are associated with increased HCC risk compared with II carriers in a Chinese Dai population. This study also implies the possibility of prevention of HCC by manipulation of ACE function once its effect is further confirmed.
Footnotes
Declaration of Conflicting Interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study is supported, in part, by grants from the Applied Basic Research Programs of Science and Technology Commission Foundation of Yunnan Province (no. 2011FB064, no. 2012FB065).