Sage Journals: Discover world-class research

Abstract

Introduction:

The insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene has recently been linked to the pathogenesis and progression of human cancers. The aim of this study was to evaluate the potential association between ACE I/D polymorphism and glioma in a Chinese population.

Materials and methods:

A case-control study involving patients with 800 glioma and 800 controls was conducted. Polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) assay was applied to assess the ACE I/D genotypes.

Results:

Glioma cases had a significantly higher frequency of DD genotype [odds ratio (OR) = 1.61, 95% confidence interval (CI) = 1.12, 2.32; p = 0.01] than controls. When stratified by the grade of glioma, cases with WHO IV glioma had a significantly higher frequency of DD genotype (OR = 1.51, 95% CI = 1.03, 2.21; p = 0.03). When stratified by the histology of glioma, there was no significant difference in the distribution of each genotype.

Conclusion:

Our study suggested that the ACE DD genotype was associated with a higher glioma risk in this Chinese population. To the best of our knowledge, this is the first report describing the potential association between ACE I/D polymorphism and glioma. Additional studies are needed to confirm this finding.

Keywords

Glioma angiotensin-converting enzyme gene polymorphism

Introduction

Gliomas are the most common primary tumors of the central nervous system,¹ but in spite of the marked advances in the characterization of their molecular pathogenesis, these tumors remain incurable. Estimated 5-year survival was 60% and 74% for biopsy and watchful waiting and early resection in low-grade gliomas, respectively.^2,3 Gliomas are classified as grade I to grade IV on the basis of histopathological and clinical criteria established by the World Health Organization (WHO).⁴ This group of tumors includes specific histological subtypes, the most common of which are the astrocytomas, glioblastoma, and other gliomas.^4-6 Malignant gliomas account for approximately 70% of the 22,500 new cases of malignant primary brain tumors that are diagnosed in adults in USA each year.⁷ Several occupations,^8,9 environmental carcinogens,¹⁰ and diet have been reported to be associated with an elevated glioma risk,^11-15 as well as genetic factors such as single nucleotide polymorphisms (SNPs).²

The angiotensin-converting enzyme (ACE) gene (chromosome 17q23) has functional insertion/deletion (I/D) polymorphism of a 287 bp Alu sequence within intron 16.¹⁶ Subjects with the DD genotype have higher plasma ACE activity compared with those with the ID and II genotypes.^16,17 The ACE I/D polymorphism has recently been linked to the pathogenesis and progression of human cancers. Although an association between ACE I/D polymorphism and glioma is biologically plausible, there is no epidemiologic study to evaluate the potential association between ACE I/D polymorphism and glioma. The aim of this study was to evaluate the potential association between ACE I/D polymorphism and glioma in a Chinese population.

Materials and methods

Study population

From January 2009 to December 2012, 800 primary gliomas cases, from the Department of Neurosurgery of the First Affiliated Hospital of Xi’an Jiaotong University, that had been surgically resected were analyzed. At the same time, 800 healthy controls were collected from the same geographic region. This was a convenience sample, and the cases were collected consecutively. The healthy control subjects were matched with the gliomas cases for age and sex. Tumor type and stage were determined according to the WHO criteria. Smoking status was defined as non-smoker (smoked less than 100 cigarettes in lifetime) and smoker. Drinking status was defined as non-drinker and drinker (drinks per day). Informed consents were obtained according to the Declaration of Helsinki. Participants will be paid for their time. This study was approved by the institutional review board of the Xi’an Jiaotong University.

DNA extraction and genotyping

Leukocyte DNA was extracted from 10 ml of venous blood, anticoagulated with 1.6 mg/ml EDTA using a commercially available kit (Wizard DNA Purification Kit, Promega, Madison, WI, USA). A polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) assay was applied to assess the ACE I/D genotypes.¹⁸ Based on the GenBank reference sequence, the PCR primers were as follows: forward-5’- CTGGAGACCACTCCCATCCTTTCT -3’ and reverse-5’- GATGTGGCCATCACATTCGTCAGAT -3’. DNA was denaturanted at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 67°C for 1 min and extension at 72°C for 2 min, with a final extension step of 5 min at 72°C. PCR products (490 bp insertion and 190 bp deletion) were separated by 2% agarose gel electrophoresis, stained with ethidium bromide, and viewed with ultraviolet (UV) light.

Statistical analysis

Chi-square test was used to compare the genotype distribution between the two groups. Multivariate logistic regression analysis was used to assess the association between the genotypes and risk of glioma after stratifying the subjects according to age, gender, and histological grade. The odds ratio (OR) and 95% confidence interval (CI) were calculated using a logistic regression model. A 2-sided significance level of p-value less than .05 was used for all analyses. All analyses were performed using Predictive Analytics Software version 18.0 (SPSS Inc., Chicago, IL, USA) for Windows^®.

Results

The characteristics of the 800 glioma cases and 800 control subjects are shown in Table 1. Glioma cases and controls did not differ regarding gender (p = 0.58) or age (p = 0.68). The mean age was 45.3 (± 9.7) years for the glioma and 45.1 (± 9.5) years for the controls. In addition, no significant differences between the cases and controls in smoking (p = 0.75), drinking (p = 0.79) and family history of cancer (p = 0.72) were found (Table 1). Among 800 glioma cases, 285 cases had astrocytomas, 264 cases had glioblastoma and 251 cases had other gliomas. In these cases, 68 cases had WHO grade I gliomas, 249 cases had WHO grade II gliomas, 161 cases had WHO grade III gliomas, and 322 cases had WHO grade IV gliomas.

Table 1.

Characteristics of cases with glioma and controls.

	Glioma	Controls	p-value
Total no.	800	800
Age at diagnosis (years), mean±SD	45.3±9.7	45.1±9.5	0.68
Gender (%)			0.58
Male	457 (57.1)	446 (55.8)
Female	343 (42.9)	354 (44.2)
Smoking (%)			0.75
Yes	265 (33.1)	259 (32.4)
No	535 (66.9)	541 (67.6)
Drinking (%)			0.79
Yes	271 (33.9)	266 (33.2)
No	529 (66.1)	534 (66.8)
Family history of cancer (%)			0.72
Yes	72 (9.0)	68 (8.5)
No	728 (91.0)	732 (91.5)
Histology (%)
Astrocytomas	285 (35.6)	NA
Glioblastoma	264 (33.0)	NA
Other gliomas	251 (31.4)	NA
Grade (%)
WHO I	68 (8.5)	NA
WHO II	249 (31.1)	NA
WHO III	161 (20.1)	NA
WHO IV	322 (40.3)	NA

NA: not available.

Glioma cases had a significantly higher frequency of DD genotype (OR =1.61, 95% CI = 1.12, 2.32; p = 0.01) than controls (Table 2). When stratified by the grade of glioma, cases with WHO IV glioma had a significantly higher frequency of DD genotype (OR =1.51, 95% CI = 1.03, 2.21; p = 0.03) (Table 3). When stratified by the histology of glioma, there was no significant difference in the distribution of each genotype (Table 3).

Table 2.

Genotype frequencies of angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism among glioma cases and controls.

Genotype	Glioma (%)	Controls (%)	OR (95%CI)	p-value
II	384 (48.0)	398 (49.7)	0.93 (0.77,1.13)	0.48
ID	337 (42.1)	351 (43.9)	0.93 (0.76,1.14)	0.48
DD	79 (9.9)	51 (6.4)	1.61 (1.12,2.32)	0.01
I allele frequency	1105 (69.1)	1147 (71.7)	0.88 (0.76,1.03)	0.10
D allele frequency	495 (30.9)	453 (28.3)	1.13 (0.97,1.32)	0.10

Table 3.

Stratification analysis of angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism in glioma.

Variable	Glioma	II			ID			DD
		n (%)	OR (95%CI)	p	n (%)	OR (95%CI)	p	n (%)	OR (95%CI)	p
Histology	800	384 (48.0)	1 (Reference)		337 (42.1)	1 (Reference)		79 (9.9)	1 (Reference)
Astrocytomas	285	136 (47.7)	0.99 (0.78,1.26)	0.96	121 (42.5)	1.01 (0.79,1.29)	0.95	28 (9.8)	0.99 (0.63,1.56)	0.98
Glioblastoma	264	127 (48.1)	1.00 (0.79,1.28)	0.99	111 (42.0)	0.99 (0.77,1.29)	0.99	26 (9.9)	0.99 (0.63,1.59)	0.99
Other gliomas	251	121 (48.2)	1.00 (0.78,1.29)	0.97	105 (41.8)	0.99 (0.77,1.29)	0.96	25 (10.0)	1.01 (0.63,1.62)	0.97
Grade	800	384 (48.0)	1 (Reference)		337 (42.1)	1 (Reference)		79 (9.9)	1 (Reference)
WHO I	68	32 (47.1)	0.98 (0.63,1.52)	0.93	30 (44.1)	1.05 (0.67,1.64)	0.84	6 (8.8)	0.89 (0.38,2.12)	0.80
WHO II	249	132 (53.0)	1.10 (0.87,1.41)	0.42	100 (40.2)	0.95 (0.73,1.24)	0.72	17 (6.8)	0.69 (0.40,1.19)	0.18
WHO III	161	80 (49.7)	1.04 (0.77,1.39)	0.82	73 (45.3)	1.08 (0.79,1.46)	0.64	8 (5.0)	0.50 (0.24,1.06)	0.07
WHO IV	322	140 (43.5)	0.91 (0.72,1.14)	0.41	134 (41.6)	0.99 (0.78,1.25)	0.92	48 (14.9)	1.51 (1.03,2.21)	0.03

Discussion

The ACE I/D polymorphism has recently been linked to many other cancers. A case-control study indicated that the ACE I/D polymorphism played an important role in the risk of prostate cancer. The DD genotype was related to patients with aggressive stage of prostate cancer (OR = 2.21, 95%CI = 1.169, 4.194; p = 0.01).¹⁹ A population-based case-control study indicated that the D allele in the ACE gene was closely associated with a significantly higher risk of developing prostate cancer (OR = 31.66, 95%CI = 0.09, 1.27) in Mexico.²⁰ A case-control study showed that the ACE I/D polymorphism might be linked to the progression of human prostate cancer. It was found that the DD genotype was present in 31 of 78 (39.8%) patients with advanced disease and in 19 of 82 (23.2%) with localized disease: this difference was statistically significant (OR = 2.18, 95%CI = 1.11, 4.03, p = 0.02).²¹ A population-based case-control study suggested that the DD genotype of ACE may contribute to a higher risk of developing squamous cell carcinoma in a Croatian population.²² A case-control study indicated that the ACE I/D polymorphism could play a role in the development of chronic pancreatitis and pancreatic cancer through interaction with other genetic and environmental factors.²³ A population-based case-control study showed that ACE I/D polymorphism may alter susceptibility to gall bladder cancer, especially in women.²⁴ A case-control study suggested that the ACE I/D polymorphism could be a risk factor for patients with lung cancer in Turkey.²⁵ A case-control study indicated that the ID genotype of the ACE gene might be protective against breast cancer among Brazilian women.²⁶ A case-control study suggested that the DD genotype of the ACE gene might accompany poor prognostic factors and influence the tumor course of breast cancer.²⁷ A logistic regression and survival analysis of the Rotterdam Study suggested that the ACE I/D polymorphism played an important role in breast cancer risk and disease-free survival in Caucasian postmenopausal women.²⁸ A case-control study showed that the I/D polymorphism, by affecting the ACE gene expression, was associated with the progress of oral oncogenesis.²⁹ Another study showed that ACE was expressed locally in gastric cancer and that the I/D polymorphism influenced metastatic behavior.³⁰ A case-control study showed that the ACE I/D polymorphism might be linked to the development of early gastric cancer.³¹ A case-control study showed that the ACE I/D polymorphism might be associated with the development of endometrial carcinoma and with the onset of this tumor in younger women.³²

Our results can be plausibly explained biologically, although the exact mechanism is unclear. Subjects with the DD genotype have higher plasma ACE activity compared with those with the ID and II genotypes.^16,17 Its activity can be blocked by the ACE inhibitors. It is noteworthy that ACE inhibitors have the effect of modifying gene expression, inhibiting proliferation and invasion of cancer cells, reducing endothelial cell migration and angiogenesis in vitro, whereas tumor growth and metastasis were inhibited in vivo.³³ Several mechanisms of action are possible, but inhibition of matrix metalloprotease activity, reduced expression of vascular endothelial growth factor and interference with the renin–angiotensin system have been demonstrated in experimental studies.³³ Although an association between ACE I/D polymorphism and glioma is biologically plausible, this is the first epidemiological study to evaluate the potential association between ACE I/D polymorphism and glioma.

Some limitations of this study should be mentioned. First of all, the interactions between gene–gene, gene–environment and even different polymorphic loci of the same gene may modulate glioma risk. Second, this is a hospital-based case-control study, so selection bias is not avoidable and the subjects may not be representative of the general population. Third, these results should be interpreted with caution because the population was exclusively from China, which reduces the possibility of confounding from ethnicity; thus the results cannot be extrapolated to other ethnic groups.

Conclusions

In conclusion, our data suggested that the ACE DD genotype was associated with a higher glioma risk in this Chinese population. To the best of our knowledge, this is the first report describing the potential association between ACE I/D polymorphism and glioma. This is an adequate study with potentially useful information. Additional studies are needed to confirm this finding.

Footnotes

Acknowledgements

We would like to thank the anonymous reviewer and the editor for their constructive comments on revising this manuscript.

Conflict of interest

None declared.

Funding

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

References

Jemal

Siegel

Ward

. Cancer statistics, 2009. CA Cancer J Clin 2009; 59: 225–249.

Ohgaki

Kleihues

. Epidemiology and etiology of gliomas. Acta Neuropathol 2005; 109: 93–108.

Jakola

Myrmel

Kloster

. Comparison of a strategy favoring early surgical resection vs a strategy favoring watchful waiting in low-grade gliomas. JAMA 2012; 308: 1881–1888.

Yan

Parsons

Jin

. IDH1 and IDH2 mutations in gliomas. N Engl J Med 2009; 360: 765–773.

Zhou

Wang

. Detection of cancer stem cells from the C6 glioma cell line. J Int Med Res 2009; 37: 503–510.

Wang

Liu

Hou

. The relationship between intra-operative ultrasonography and pathological grade in cerebral glioma. J Int Med Res 2008; 36: 1426–1434.

Wen

Kesari

Malignant gliomas in adults. N Engl J Med 2008; 359: 492–507.

Samkange-Zeeb

Schlehofer

Schuz

. Occupation and risk of glioma, meningioma and acoustic neuroma: Results from a German case-control study (interphone study group, Germany). Cancer Epidemiol 2010; 34: 55–61.

De Roos

Stewart

Linet

. Occupation and the risk of adult glioma in the United States. Cancer Causes Control 2003; 14: 139–150.

10.

Maker

Syed

Whetsell

. Environmental factors modifying the effect of CCNU on glioma in vitro and in vivo. Trans Am Neurol Assoc 1976; 101: 273–275.

11.

Kabat

Park

Hollenbeck

. Reproductive factors and exogenous hormone use and risk of adult glioma in women in the NIH-AARP Diet and Health Study. Int J Cancer 2011; 128: 944–950.

12.

Thivat

Farges

Bacin

. Phase II trial of the association of a methionine-free diet with cystemustine therapy in melanoma and glioma. Anticancer Res 2009; 29: 5235–5240.

13.

Chen

Ward

Tucker

. Diet and risk of adult glioma in eastern Nebraska, United States. Cancer Causes Control 2002; 13: 647–655.

14.

Bunin

Kuijten

Boesel

. Maternal diet and risk of astrocytic glioma in children: A report from the Childrens Cancer Group (United States and Canada). Cancer Causes Control 1994; 5: 177–187.

15.

Groothuis

Lippitz

Fekete

. The effect of an amino acid-lowering diet on the rate of melphalan entry into brain and xenotransplanted glioma. Cancer Res 1992; 52: 5590–5596.

16.

Rigat

Hubert

Alhenc-Gelas

. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990; 86: 1343–1346.

17.

Tiret

Rigat

Visvikis

. Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet 1992; 51: 197–205.

18.

Aggarwal

Jain

Jha

. Endothelial nitric oxide synthase, angiotensin-converting enzyme and angiotensinogen gene polymorphisms in hypertensive disorders of pregnancy. Hypertens Res 2010; 33: 473–477.

19.

Wang

Lin

. Angiotensin-converting enzyme insertion/deletion polymorphism and the risk of prostate cancer in the Han population of China. Med Oncol 2012; 29: 1964–1971.

20.

Sierra Diaz

Sanchez Corona

Rosales Gomez

. Angiotensin-converting enzyme insertion/deletion and angiotensin type 1 receptor A1166C polymorphisms as genetic risk factors in benign prostatic hyperplasia and prostate cancer. J Renin Angiotensin Aldosterone Syst 2009; 10: 241–246.

21.

Medeiros

Vasconcelos

Costa

. Linkage of angiotensin I-converting enzyme gene insertion/deletion polymorphism to the progression of human prostate cancer. J Pathol 2004; 202: 330–335.

22.

Devic Pavlic

Ristic

Flego

. Angiotensin-converting enzyme insertion/deletion gene polymorphism in lung cancer patients. Genet Test Mol Biomarkers 2012; 16: 722–725.

23.

Lukic

Nikolic

Alempijevic

. Angiotensin-converting enzyme gene insertion/deletion polymorphism in patients with chronic pancreatitis and pancreatic cancer. Dig Surg 2011; 28: 258–262.

24.

Srivastava

Mittal

. Angiotensin I-converting enzyme insertion/deletion polymorphism and increased risk of gall bladder cancer in women. DNA Cell Biol 2010; 29: 417–422.

25.

Nacak

Sanli

. Association of angiotensin converting enzyme gene insertion/deletion polymorphism with lung cancer in Turkey. Cancer Genet Cytogenet 2010; 198: 22–26.

26.

Alves Correa

Ribeiro

Noronha

Nogueira-de-Souza

. Association between the angiotensin-converting enzyme (insertion/deletion) and angiotensin II type 1 receptor (A1166C) polymorphisms and breast cancer among Brazilian women. J Renin Angiotensin Aldosterone Syst 2009; 10: 51–58.

27.

Yaren

Turgut

Kursunluoglu

. Insertion/deletion polymorphism of the angiotensin I-converting enzyme gene in patients with breast cancer and effects on prognostic factors. J Investig Med 2007; 55: 255–261.

28.

Gonzalez-Zuloeta Ladd

Arias Vasquez

Sayed-Tabatabaei

. Angiotensin-converting enzyme gene insertion/deletion polymorphism and breast cancer risk. Cancer Epidemiol Biomarkers Prev 2005; 14: 2143–2146.

29.

Vairaktaris

Yapijakis

Tsigris

. Association of angiotensin-converting enzyme gene insertion/deletion polymorphism with increased risk for oral cancer. Acta Oncol 2007; 46: 1097–1102.

30.

Rocken

Lendeckel

Dierkes

. The number of lymph node metastases in gastric cancer correlates with the angiotensin I-converting enzyme gene insertion/deletion polymorphism. Clin Cancer Res 2005; 11: 2526–2530.

31.

Ebert

Lendeckel

Westphal

. The angiotensin I-converting enzyme gene insertion/deletion polymorphism is linked to early gastric cancer. Cancer Epidemiol Biomarkers Prev 2005; 14: 2987–2989.

32.

Freitas-Silva

Pereira

Coelho

. Angiotensin I-converting enzyme gene insertion/deletion polymorphism and endometrial human cancer in normotensive and hypertensive women. Cancer Genet Cytogenet 2004; 155: 42–46.

33.

Lindberg

Nielsen

Jensen

. Angiotensin converting enzyme inhibitors for cancer treatment? Acta Oncol 2004; 43: 142–152.

Angiotensin-converting enzyme insertion/deletion gene polymorphisms is associated with risk of glioma in a Chinese population

Abstract

Introduction:

Materials and methods:

Results:

Conclusion:

Keywords

Introduction

Materials and methods

Study population

DNA extraction and genotyping

Statistical analysis

Results

Discussion

Conclusions

Footnotes

Acknowledgements

Conflict of interest

Funding

References