Sage Journals: Discover world-class research

Abstract

Background and objective:

The cornerstone of dermatomyositis (DM) pathogenesis involves vascular disturbance that leads to hypoxia, capillary necrosis and muscle perifascicular atrophy. Hence, the hypothesis is that the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism could be associated with susceptibility to DM.

Method:

A single centre, case control study that genotyped ACE gene in 88 DM and 99 healthy individuals. The ACE gene polymorphism was determined by melting curve analysis of real-time polymerase chain reaction products using SYBR Green.

Results:

The DM and the control subjects had a comparable mean age, gender frequency and ethnicity. The frequency of the D allele was higher in DM than in the control individuals (63.6% vs 55.6%, respectively). The DM had more ACE D/D and less ACE I/D genotype when compared to the control individuals, whereas the ACE I/I genotype distribution was similar in both case and control groups. Moreover, after sex-age-adjusted analysis, the ACE D/D genotype was strongly associated with DM disease (odds ratio (OR) 2.44, 95% confidence interval (CI): 1.17–4.37), in contrast to ACE I/D genotype (OR 0.51, 95% CI: 0.28–0.93).

Conclusions:

Homozygous ACE D/D was associated significantly with the DM risk. Further investigations are required to clarify and to confirm the association of these genes with DM susceptibility.

Keywords

Angiotensin converting enzyme comorbidities dermatomyositis gene polymorphism

Introduction

Dermatomyositis (DM) is a systemic idiopathic inflammatory myopathy characterized by a subacute onset and proximal, symmetrical muscle weakness and is also associated with cutaneous manifestations, including heliotrope and Gottron’s papules.¹ The cornerstone of DM pathogenesis involves vascular disturbances that lead to hypoxia, capillary necrosis and muscle perifascicular atrophy.^1,2

The insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene in an intron of the ACE gene, is in strong linkage disequilibrium with genetic factors that influence serum ACE concentrations.³ ACE is expressed in a wide range of tissues including the lung, vascular endothelium, kidney, and heart.⁴ In addition, ACE plays an important role in blood vessel pathogenesis because it catalyses the conversion of angiotensin I to angiotensin II, a vasoactive peptide and growth factor that contributes to vascular reactivity, tissue remodeling and fibrosis,^5,6 vascular smooth muscle cell contraction, smooth muscle proliferation, monocyte adhesion, and platelet adhesion and aggregation. Therefore, as DM pathogenesis involves vascular changes and vasculitis, it is plausible that ACE polymorphism could also be involved in this disease.

Furthermore, angiotensin II is also a potent proinflammatory modulator that augments and possibly perpetuates immune responses,⁶ such as those that are characteristic of systemic inflammatory diseases other than DM, including juvenile rheumatoid arthritis,⁷ rheumatoid arthritis,⁸ and systemic lupus erythematosus (SLE)^9
–12 Indeed, there are some studies that have found that ACE polymorphism is associated with an increase in susceptibility to SLE and lupus nephritis.^9–14

Nevertheless, to our knowledge, no studies to date have analyzed the ACE gene polymorphism in DM. Moreover, this polymorphism could be an attractive candidate among the factors that play a role in the development of vascular pathological and systemic inflammatory states; therefore, contributing to DM susceptibility and/or DM pathogenesis.

Materials and methods

Study design

The present case control study was performed at a single centre and included 88 DM patients and 99 healthy control individuals from June 2012–January 2013. All of the DM patients met at least four of the five Bohan and Peter criteria,¹⁵ and they were treated at the myopathies unit of our tertiary service. Healthy individuals aged under 18 years and/or with other associated systemic autoimmune diseases were excluded. The study was approved by the local ethics committee, and all of the participants signed an informed consent form.

Patient data

All of the participants underwent a clinical evaluation that included a standardized interview, and all of their medical charts were extensively reviewed and obtained retrospectively. The following data were collected: (a) the patient’s age at disease onset and disease duration, gender, and ethnicity; (b) comorbidity prior to DM symptoms/diagnosis, such as systemic arterial hypertension, type 2 diabetes mellitus, hypothyroidism, myocardium infarction, and ischemic stroke; (c) lifestyle features (tobacco and alcohol use); and (d) family history of cardiovascular disease (CVD) (myocardial infarction and sudden death in first degree relatives before age 55 years for men and before age 65 years for women). In addition, laboratory features were collected at the interview day: the serum levels of creatine kinase (normal range: 24–173 U/l) and aldolase (normal range: 1.0–7.5 U/l) were obtained using automated kinetic methods; antinuclear antibodies were detected by indirect immunofluorescence using HEp-2 cells as the substrate; a myositis-specific autoantibody anti-Mi-2 assessment was performed using a commercially available line blot test kit (Myositis Profile Euroline Blot test kit, Euroimmun, Lübeck, Germany) and was used according to the manufacturer’s protocol.

ACE genotype determination

To genotype the I/D polymorphism of the ACE gene, genomic DNA was isolated from peripheral blood, and quantitative real-time polymerase chain reaction (qRT-PCR) was performed for the ACE gene I/D allele using the SYBR Green I. The amplification mixtures, at a final volume of 10 µl, included 25 ng genomic DNA, 5 µl 2×Maxima SYBR Green qPCR Master Mix (Fermentas Life Sciences, Burlington Ontario, Canada), and forward (F) and reverse (R) primers at a final concentration of 100 nM. The following primer sequences (5′-3′), synthesized by Eurofins MWG Operon (Huntsville, Alabama, USA), were used: ACE1F, CATCCTTTCTCCCATTTCTCT’; ACE2InsF, TGGGATTACAGGCGTGATACA; and ACE3R, ‘GCTGGAATAAAATTGGCGAA. The reactions were performed using an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, California, USA). The cycle conditions included incubation at 50°C for 2 min, initial denaturation at of 95°C for 10 min, and 40 cycles at 95°C for 15 s and 60°C for 1 min. After the amplification was complete, a melting curve analysis was performed by cooling the reaction to 60°C and then heating slowly to 95°C, following the instructions of the manufacturer (Applied Biosystems). The melting curve analyses were performed to assay the ACE I/D polymorphism. In addition, the amplified PCR product was separated on 2% agarose gel electrophoresis and visualized using UV light and ethidium bromide staining. PCR products of 57 base pairs (bp) and 75 bp, corresponding to the two melting peaks at 72.9°C and 74°C, represented the I and D alleles, respectively. A set of PCR products at 57 bp and 363 bp for the two melting peaks at 72.9°C and 86.2°C indicated the I allele, and a PCR product at 75 bp for a melting peak at 74°C indicated the D allele (Figure 1).

Figure 1.

Genotyping of insertion/deletion polymorphism of angiotensin-converting enzyme (ACE) gene by quantitative real-time polymerase chain reaction (qRT-PCR).

Statistical analysis

The continuous variables were expressed as means±standard deviation (SD), medians with interquartile range (IQR), or percentages for the categorical variables. All of the data, including the distributions of ACE genotypes (I/I, I/D, D/D) and alleles (I, D) between the two groups (DM patients vs health controls), were compared using the χ² test or Fischer’s exact test. All of the variables that differed significantly in the univariate analysis were selected for adjustment. The sex-age-adjusted odds ratio (OR) and 95% confidence interval (CI) were calculated using an unconditional logistic model. The value of p<0.05 was considered to be statistically significant. We used the SPSS version 15.0 statistics software (Chicago, USA) to perform the analyses.

Results

The present study included 88 DM patients and 99 healthy control individuals. The DM patients and control subjects had a comparable mean age (39.8±14.4 vs 40.3±12.3 years, respectively; p=0.802), female gender frequency (p=0.313) and white ethnicity frequency (p=0.176) (Table 1). The median DM duration was four years.

Table 1.

General characteristics of dermatomyositis patients and controls.

	Dermatomyositis(n=88)	Control(n=99)	p
Age (years)	39.8±14.4	40.3±12.3	0.802
Female	72 (81.8)	75 (75.8)	0.313
White ethnicity	69 (78.4)	69 (69.7)	0.176
Disease duration (years)	4 (1–6	–	–
Laboratory features
Creatine kinase (U/l)	151 (72–313	107 (84–159	0.069
Aldolase (U/l)	4.8 (4.0–6.7	3.6 (3.5–4.4	0.001
Antinuclear factor	48 (54.5)	–	–
Anti-Mi-2 antibody	7 (8.0)	–	–

The results are expressed in mean±(standard deviation), median with interquartile range (IQR or as percentages (%).

Higher frequencies of the following CVD risk factors were observed in the patients compared to the controls: systemic arterial hypertension (34.1% vs 16.2%, patients and controls, respectively; p=0.004), type 2 diabetes mellitus (5.7% vs 0%; p=0.016) and a family history of premature CVD (22.1% vs 9.2%; p=0.020). However, no significant differences were observed in the rates of myocardial infarction (2.3% vs 0%), ischemic stroke (2.3% vs 0%), hypothyroidism (13.6 vs 6.1%), alcohol consumption (2.3% vs 1.0%), or smoking (9.1% vs 10.0%).

The serum levels of creatine kinase were comparable between both groups, whereas the aldolase levels were higher in the DM patients. We observed antinuclear antibodies and anti-Mi-2 antibody in 54.5% and 8.0%, respectively, of the DM patients.

The ACE D and I allele distributions were not in Hardy-Weinberg equilibrium (59.4% vs 40.6%, respectively; p<0.001). Furthermore, the frequency of the D allele was higher in the DM patients than in the control individuals (63.6% vs 55.6%, respectively) (Table 2).

Table 2.

The angiotensin converting enzyme (ACE) allele frequencies.

	Dermatomyositis(n=88)	Control(n=99)
ACE allele
D	112 (63.5)	110 (55.6)
I	64 (36.5)	88 (44.4)
	p=0.09	p<0.0001

The DM patients included more ACE D/D and fewer ACE I/D genotypes compared to the control individuals, whereas the distribution of the ACE I/I genotype was similar in both groups (Table 3). The sex-age-adjusted OR indicated that the ACE D/D genotype was strongly associated with DM disease (OR 2.44, 95% CI: 1.17–4.37), in contrast to that of the ACE I/D genotype (OR 0.51, 95% CI 0.28–0.93).

Table 3.

The angiotensin-converting enzyme (ACE) genotype frequencies.

Genotype	Dermatomyositis(n=88)	Control(n=99)	OR	95% CI
I/I	8 (9.1)	9 (9.1)	1.00	Reference
I/D	48 (54.5)	70 (70.7)	0.51	0.28–0.93
D/D	32 (36.4)	20 (20.2)	2.44	1.17–4.37
I/D + D/D	80 (90.9)	90 (90.9)	1.09	0.39–3.01

CI: confidence interval; I/D: insertion/deletion; OR: odds ratio.

No association was observed between the ACE D/D genotype and cardiovascular risk factors and demographic features of the DM patients (p>0.050).

Discussion

To our knowledge, this is the first study to assess the ACE gene polymorphism in DM patients. We observed that the ACE D/D genotype was significantly associated with a genetic susceptibility to DM.

The ACE gene is located on the long arm of chromosome 17¹⁶ and shows a characteristic I/D polymorphism based on the presence or absence of a 287 bp Alu repeat sequence within intron 16. Accordingly, there are therefore three possible genotypes: I/I, I/D, and D/D. Carriers of the D/D genotype have the highest levels of serum ACE, and those with the I/I genotype have the lowest serum levels.¹⁷

The ACE gene I/D polymorphism is implicated in the pathogenesis of a number of cardiovascular disorders, including myocardial infarction, left ventricular hypertrophy, and systemic arterial hypertension. Furthermore, the ACE gene has been recognized as a potential candidate gene for cardiovascular research.^18–22 Indeed, the D allele reportedly behaves as a marker of atherosclerotic cardiovascular complications.²³ Therefore, the available evidence supports the notion that the D/D genotype adversely influences specific CVDs.

Moreover, the ACE gene polymorphism had been described in various systemic autoimmune diseases, such as juvenile rheumatoid arthritis,⁷ systemic lupus erythematosus,^9–12,24,25 rheumatoid arthritis,^8,26 spondylarthritis.^27,28 and systemic sclerosis.^29–31 Indeed, the presence of the ACE D allele in systemic sclerosis,^29–31 which involves an increased prevalence of vascular damage,²⁷ may predispose the individual to an involvement of the macrovascular system.^29,30 Lupus nephritis is characterized by increasing vascular lesion risk,¹³ and some studies have found that the ACE polymorphism was associated with lupus renal involvement.^10,14 In contrast to these diseases, there is no study thus far that has analyzed the ACE polymorphism in DM, a disease that involves vascular pathogenesis mediated by humoral processes with secondary ischemic changes of muscle fibers.^1,2,31,32 In these conditions, abnormalities have been found in the endothelium of capillaries, arterioles, and veins, which have been suggested to represent primary disease-related alterations.^31,32 DM is characterized by perifascicular atrophy, perivascular inflammation, microvascular deposits of the C5b-9 membrane attack complex on endothelial cells, and endomysial capillaries that are enlarged and reduced in number, with partial endothelial swelling.^31–33 Thus, the ACE polymorphism could additionally contribute to the microvascular pathology findings in DM.

Furthermore, we have recently observed a high prevalence of metabolic syndrome and CVD parameters, such as stroke and defined-diabetes mellitus, in patients with DM.³⁴ Nevertheless, these high frequencies of CVD in DM patients may be the result of (a) DM in conjunction with underlying inflammatory processes, which decrease functional capacity. and (b) the treatment of CVD as a comorbid condition in DM patients. However, a previous study shows that high CVD frequencies are not explained by demographic data, traditional risk factors or lifestyle habits (alcohol consumption, tobacco, sedentary).³⁴ Therefore, we speculate a possible genetic involvement in the physiopathogenesis of DM that also contributes to a high prevalence of metabolic syndrome and CVD parameters. However, we observed the association of the ACE polymorphism with the presence of DM but not with CVDs, most likely because of the limitation of the number of individuals analyzed in the present study.

Another hypothesis for an association between the ACE polymorphism and DM is that the D/D genotype favors angiotensin II production, a potent proinflammatory modulator that augments and perpetuates immune responses,⁶ which is also observed in various systemic autoimmune diseases.^7–12

In summary, we report for the first time the association of the ACE polymorphism with the presence of DM. However, we did not find a relationship between this genotype and CVD parameters in patients with DM, most likely because of the small sample size. Further investigations are required to confirm the possible association of these genes with cardiovascular comorbidities.

Footnotes

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

Dalakas

Hohlfedl

. Polymyositis and dermatomyositis. Lancet 2003; 9388: 971–982.

Dalakas

. Inflammatory muscle diseases: A critical review on pathogenesis and therapies. Curr Opin Pharmacol 2010; 10: 346–352.

Weinstock

Blum

Kassab

. Angiotensin II is chemotactic for a T-cell subset which can express migration inhibition factor activity in murine schistosomiasis mansoni. Cell Immunol 1987; 107: 180–187.

Alhenc-Gelas

Richard

Courbon

. Distribution of plasma angiotensin I-converting enzyme levels in healthy men: Relationship to environmental and hormonal parameters. J Lab Clin Med 1991; 117: 33–39.

Cambien

Alhenc-Gelas

Herbeth

. Familial resemblance of plasma angiotensin-converting enzyme level: The Nancy Study. Am J Hum Genet 1988; 43: 774–780.

Suzuki

Ruiz-Ortega

Egido

. Angiotensin II: A double edged sword in inflammation. J Nephrol 2000; 13: S101–S110.

Alsaeid

Haider

Ayoub

. Angiotensin-converting enzyme gene insertion-deletion polymorphism is associated with juvenile rheumatoid arthritis. J Rheumatol 2003; 30; 2705–2709.

Uppal

Haider

Hayat

. Significant association of insertion/deletion polymorphism of the angiotensin-converting enzyme gene with rheumatoid arthritis. J Rheumatol 2007; 34; 2395–2399.

Kaufman

Kelly

Gray-Mcguire

. Linkage analysis of angiotensin-converting enzyme (ACE) insertion/deletion polymorphism and systemic lupus erythematosus. Mol Cell Endocrinol 2001; 177: 81–85.

10.

Zhou

Liu

Lin

. Relationship between angiotensin-converting enzyme insertion/deletion gene polymorphism and systemic lupus erythematosus/lupus nephritis: A systematic review and meta-analysis. J Rheumatol 2012; 39; 686–693.

11.

Abbas

Ezzat

Hamdy

. Angiotensin-converting enzyme (ACE) serum levels and gene polymorphism in Egyptian patients with systemic lupus erythematosus. Lupus 2012; 21; 103–110.

12.

Wang

Pan

. Association of ACE gene polymorphism with genetic susceptibility to systemic lupus erythematosus in a Chinese population: A family-based association study. J Rheumatol 2007; 34: 2408–2411.

13.

Thacker

Berthier

Mattinzoli

. The detrimental effects of IFN-alpha on vasculogenesis in lupus are mediated by repression of IL-1 pathways: Potential role in atherogenesis and renal vascular rarefaction. J Immunol 2010; 185: 4457–4469.

14.

Guo

. Assocation of the genetic polymorphism of the ACE gene and the eNOS gene with lupus nephropathy in northern Chinese population. BMC Medical Genetics 2010; 11: 94–101.

15.

Bohan

Peter

. Polymyositis and dermatomyositis. Pt I. N Engl J Med 1975; 292; 344–407.

16.

Mattei

Hubert

Alhenc-Gelas

. Angiotensin I converting enzyme gene is on chromosome 17. Cytogenet Cell Genet 1989; 51: 1041–1045.

17.

Rigat

Hubert

Alhenc-Gelas

. An insertion-deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990; 86: 1343–1346.

18.

Mayer

Schunkert

. ACE gene polymorphism and cardiovascular diseases [German]. Herz 2000; 25: 1–6.

19.

Niu

Chen

. Angiotensin converting enzyme gene insertion/deletion polymorphism and cardiovascular disease: Therapeutic implications. Drugs 2002; 62: 977–993.

20.

Di Pasqualse

Cannizaro

Scalzo

. Cardiovascular effects of I/D angiotensin-converting enzyme gene polymorphism in healthy subjects. Findings after follow-up of six years. Acta Cardiol 2005; 60: 427–435.

21.

Celentano

Mancini

Crivaro

. Cardiovascular risk factors, angiotensin-converting enzyme gene I/D polymorphism, and left ventricular mass in systemic hypertension. Am J Cardiol 1999; 83: 1196–1200.

22.

Sayed-Tabatabaei

Schut

Vasquez

. Angiotensin converting enzyme gene polymorphism and cardiovascular morbidity and mortality: The Rotterdam Study. J Med Genet 2005; 42: 26–30.

23.

Staessen

Wang

Ginocchio

. The deletion/insertion polymorphism of the angiotensin converting enzyme gene and cardiovascular-renal risk. J Hypertens 1997; 15: 1579–1592.

24.

Gong

Wang

. Association study of ACE polymorphisms and systemic lupus erythematosus in Northern Chinese Han Population. Mol Biol Rep 2012; 39: 9485–9491.

25.

Saeed

Mekan

Rabbani

. Angiotensin converting enzyme (ACE) gene polymorphisms and lupus disease severity: A promising link. Ann Rheum Dis 2005; 64: 164–165.

26.

Yigit

Inanir

Tural

. Association of angiotensin converting enzyme (ACE) gene I/D polymorphism and rheumatoid arthritis. Gene 2012; 511: 106–108.

27.

Inaninr

Yigit

Tural

. Significant association between insertion/deletion polymorphism of the angiotensin-converting enzyme gene and ankylosing spondylitis. Mol Vis 2012; 18: 2107–2113.

28.

Shehab

Al-Jarallah

Al-Awadhi

. Association of angiotensin-converting enzyme (ACE) gene insertion-deletion polymorphism with spondylartropathies. J Biomed Sci 2008; 15: 61–67.

29.

Bartoli

Angotti

Fatini

. Angiotensin-converting enzyme I/D polymorphism and macrovascular disease in systemic sclerosis. Rheumatol 2007; 46: 772–775.

30.

Guiducci

Fatini

Rogai

. Angiotensin-converting enzyme in systemic sclerosis: From endothelial injury to a genetic polymorphism. Ann N Y Acad Sci 2006; 1069: 10–9.

31.

Authier

. Dyimmune and inflammatory myopathies. Rev Prat 2008; 58: 2253–60.

32.

Dimitri

. Inflammatory myopathies: Diagnosis and classifications. Presse Med 2009; 38: 1141–1163.

33.

Konttinen

Mackiewicz

Povilenaite

. Disease-associated increased HIF-1, αvβ3 intergrin, and Fit-1 do not suffice to compensate the damage-inducing loss of blood vessels in inflammatory myopathies. Rheumatol Int 2004; 24: 333–339.

34.

De Moraes

De Souza

De Barros

. Analysis of metabolic syndrome in adult dermatomyositis with a focus on cardiovascular disease. Arthritis Care Res 2013; 65: 793–799.

Angiotensin-converting enzyme insertion/deletion gene polymorphism is associated with dermatomyositis

Abstract

Background and objective:

Method:

Results:

Conclusions:

Keywords

Introduction

Materials and methods

Study design

Patient data

ACE genotype determination

Statistical analysis

Results

Discussion

Footnotes

Declaration of Conflicting Interests

Funding

References