Sage Journals: Discover world-class research

Abstract

Several genes influence sheep’s reproductive performance, among them the paired-like homeodomain transcription factor 2 (PITX2) gene. Thus, this study aimed to examine whether the variability within the PITX2 gene is associated with the reproductive performance of Awassi ewes. A total of 123 single-progeny ewes and 109 twin ewes were used to extract genomic DNA. An amplicon of 4 sequence fragments from exons 2, 4, 5 (upstream portion), and 5 (downstream portion) of the PITX2 gene was generated by polymerase chain reaction (PCR), 228, 304, 381, and 382 bp, respectively. Three genotypes of 382 bp amplicons were identified: CC, CT, and TT. Sequence analysis revealed a novel mutation in the CT genotype 319C > T. Statistical analysis revealed that single-nucleotide polymorphism (SNP) 319C > T was associated with reproductive performance. Single-nucleotide polymorphism 319C > T-carrying ewes had significantly (P ⩽ .01) lower litter sizes, twinning rates, lambing rates, and more days to lambing than those carrying CT and CC genotypes. Based on a logistic regression analysis, it was confirmed that the 319C > T SNP decreased litter size. Ewes with TT genotype produced fewer lambs than ewes with CT and CC genotypes. According to these results, the variant 319C> T SNP negatively affects the reproductive performance of Awassi sheep. Ewes carrying the 319C > T SNP have a lower litter size and are less prolific than those without the SNP.

Keywords

Fertility litter size RIEG polymorphism sheep

Introduction

Reproductive performance is among the most important features associated with sheep^1,2 that is potentially affected by genetics and the environment.³ Identifying the genetic mechanisms responsible for lamb reproductive performance is imperative to identify the candidate genes and their causal mutations.^4,5 The gremlin 1 (GREM1) gene,⁶ the prolactin gene,⁷ and the oxidized low density lipoprotein receptor 1 (OLR1) gene⁸ have all been found to stimulate reproductive function in Awassi sheep. Another gene, paired-like homeodomain transcription factor 2 (PITX2), has also been found to play a role in livestock reproduction.⁹ The PITX2 gene resides on chromosome 6 in sheep and contains 6 exons (adopted from ncbi.nlm.nih.gov), as well as on chromosome 6 in cows with 7 exons.¹⁰ The PITX2 gene regulates asymmetric organ development during animal development. Therefore, this gene is crucial to animal physiological function.⁹ It has also been found that the PITX2 gene is vital for myogenesis and muscle formation¹⁰ and can control redox conditions and regulate the transcription factor myogenic differentiation (MyoD) during fetal and adult development.¹¹ PITX2, also known as RIEG, influences hematopoiesis, differentiation, and organogenesis.^12,13 PITX2 expression results in the expression of all genes in our asymmetry marker panel, including ERα, which may contribute to sexual differentiation. Paired-like homeodomain transcription factor 2 also controls the bone morphogenetic protein 7 (BMP7) gene, which is present in the left gonad at the beginning of its development.¹⁴ Many signal pathways require the PITX2 gene, such as the Wnt/β-catenin pathway and the POU1F1-PROP1 pathway and can mediate mRNA stabilization in these pathways.⁹ The Wnt/β-catenin signal pathway is crucial during embryonic development, development decisions, and tissue homeostasis of adult tissues.¹⁵ In this way, PITX2 regulates gene expression by interacting with Wnt and growth factor pathways in cell types that are specifically responsive to this receptor.¹⁶ Furthermore, PITX2 participates in the transcription and expression of genes involved in the POU1F1-PROP1 signal pathway, most notably POU1F1, LHX3, and PROP1, which contribute to growth hormone, prolactin, and reproductive hormone secretion.¹⁷ The PITX2 gene may affect animals because these hormones are crucial for their development, growth, and reproduction.¹⁸ In addition, the PITX2 is involved in signal transduction pathways that could influence reproductive processes.¹⁹ This gene encodes the bicoid-like transcription factor PITX2 protein, which contains the homeobox-2 and the OAR domains. Paired-like homeodomain transcription factor 2 interacts with pituitary homeobox 1 through its OAR domain as well as its homeobox-2 domain. This is because the homeobox-2 domain has a helix-turn-helix (HTH) structure that can combine specifically with DNA.²⁰ The integrity of the homeodomain is essential for PITX2 to bind DNA.²¹

In several research studies, PITX2 polymorphism has been related to phenotypic characteristics in livestock. According to Zhao et al,¹² variants in the PITX2 gene influence milk quality in dairy goats and meat quality and growth traits in pigs.²² In addition, the black-bone chickens of Wuliang Mountain have significant body size and carcass traits, which vary with polymorphisms in exons 1 and 3 of the PITX2 gene.²⁰ In reproduction, PITX2 has been shown to enhance twinning rates in chickens¹⁸ because of its predominance in embryonic axes formation. Furthermore, Shaanbei white cashmere goats with a 22-bp indel mutation in the PITX2 gene have significant growth and litter size.⁹ The PITX2 gene is, therefore, suitable for use in genetics and breeding as a candidate gene for marker-assisted selection. However, genetic polymorphisms in PITX2 have only been studied in limited current studies on their effects on livestock reproductive traits, and to the researcher’s knowledge, no research has been done on their impact on Awassi sheep reproductive performance. Thus, this study aimed to determine whether genetic variations in the PITX2 gene affect reproductive performance in Awassi sheep.

Materials and Methods

Sheep population

The research was approved by the animal ethical committee of Al-Qasim Green University and performed from July 2021 and April 2022 according to international guidelines on animal care and use (Agri, No. 015, 7,20). A total of 232 sexually mature ewes between 3 and 4 years of age were included in the study. Following parturition, singletons and twins ewes were categorized into 123 and 109, respectively, weighing 40–60 kg. Two stations—Babylon and Karbala—were randomly selected for these ewes. Concentrates containing 59% barley and 40% bran, along with 1% salt, were fed to animals proportionally to 2.5% of their weight. Three kilograms of alfalfa were also given to each animal, along with 1 kg of straw. All animals had access to fresh water at all times. In the breeding stations, twinning rate, lambing rate, survival rate, and time to lambing were all recorded, as well as age at first lambing.

DNA and polymerase chain reaction

The genetic analysis of the sheep was conducted using a blood sample collected from its jugular vein. Genomic DNA was extracted from a sample using rapid salting-out methods.²³ Using NCBI Primer-BLAST, all 232 PITX2 genetic sequences were amplified.²⁴ A polymerase chain reaction (PCR) was performed using a Bioneer premix, and thermal gradients were performed using an Eppendorf thermal gradient apparatus (Germany) to identify the optimal PCR-amplifying conditions (Table 1). The sample was denatured for 4 minutes at 94°C, followed by 30 cycles of 30 seconds at 94°C, then annealed for 45 seconds and elongated for 30 seconds at 72°C. Then, the PCR products were electrophoresed on agarose gels (2%) (Figure 1), and the gel images were visualized with a Chemidoc Gel Imager (Bio-Rad, Hercules, CA, USA).²⁵

Figure 1.

Agarose gel electrophoresis for PCR products from the exon 2 to exon 5 amplification of the PITX2 gene. Lane M: 100 bp DNA ladder, lanes 1-12 indicate the samples of ewes with a single pregnancy, lanes 13-25 indicate the samples of ewes with twin pregnancies. Electrophoresis conditions: 2% agarose concentration and electrophoresis time: 30 minutes. The buffer used TBE pH 8.3.

Table 1.

The oligonucleotide primer sets designed for the amplification of the ovine PITX2 gene.

Primer code	Locus	Sequence (5’-3’)	Binding coordinate in the genome		Amplicon length	Annealing temperature
			Start	Stop
PITX2,exo2-F	Exon 2	TTGAAGTCGTCTGCCCCACA	15196256	15196275	228 bp	59.8°C
PITX2,exo2-R		CCATAAGACCAGTGCCCTCTC	15196483	15196463		59.8°C
PITX2,exo3-F	Exon 3	GATACTTTCCCCCGCCGTC	15196802	15196820	249 bp	NA^a
PITX2,exo3-R		GAGGCAGGCGCCCAG	15197050	15197036		NA^a
PITX2,exo4-F	Exon 4	CGGGGACCTCTGTGTTTCG	15208134	15208152	304 bp	61.0°C
PITX2,exo4-R		TTTCACCCTCCCTCCTGATCT	15208437	15208417
PITX2,exo5,1-F	Exon 5,1	CACTTATGTGTCGGAGGGGG	15210690	15210709	381 bp	59.8°C
PITX2,exo5,1-R		GACGACATGCTCATGGACGA	15211070	15211051		59.8°C
PITX2,exo5,2-F	Exon 5,2	GCCCAATTCCATCTCGTCCA	15211038	15211057	382 bp	59.8°C
PITX2,exo5,2-R		CCCAGTCTTTCAAGGGCAGA	15211419	15211400

The symbols “F” and “R” refer to forward and reverse primers, respectively. The design was based on the ovine NCBI Reference Sequence NC_056059.1.

No specific results were obtained from utilizing this primers’ pair to amplify this locus as no specific bands (~249 bp) were observed in agarose gel electrophoresis.

Single-strand conformation polymorphism

The genotypes of each PCR product were determined following Imran et al.⁶ In equal volume, the denaturing-loading buffer was added to each PCR amplicon (95% formamide, 0.05% xylene cyanol, and 20 mM EDTA, pH 8). Following denaturation for 7 minutes, amplicons were placed on wet ice for 10 minutes. Polyacrylamide gels with neutral denaturants were loaded into 0.5 Tris-borate-EDTA (TBE) buffers. For the next step, the gels were electrophoresed for 4 hours at room temperature at 200 mA and 100 V. A protocol described by Byun et al²⁶ was used to stain the gels.

DNA sequencing

In sequence laboratories (Macrogen, Geum Chen, Korea), all 232 animals were exposed to Sanger-sequencing reactions from both termini after single-strand conformation polymorphism (SSCP) bands were detected on polyacrylamide gels. From the NCBI website (https://www.ncbi.nlm.nih.gov), the PITX2 gene sequence was retrieved. SnapGene Viewer 4.0.4 (http://www.snapgene.com) was used to visualize the polymorphisms, and BioEdit 7.1 was used to edit polymorphisms within each genotype. The novelty of observed variants was determined using Ensemble genome browser 96 (https://asia.ensembl.org/index.html). On-line prediction software for RNA folding Web Server was used to analyze the effects of genotypes on PITX2 gene 3’ untranslated region (3’UTR) mRNA secondary structure (http://rna.tbi.univie.ac.at/cgi-bin/rnawebsuite/rnafold.cgi).

Statistical analysis

PopGen32, version 1.31,²⁷ was used in this study to determine the genotype and allele frequencies. Our next step was to determine the Hardy-Weinberg equilibrium (HWE) and then determined the polymorphism information content (PIC) following Botstein et al.²⁸ IBM SPSS 23.0 (Armonk, NY, USA) was used to analyze the association analysis of PITX2 genotypes as follows

Y_{i j k} = μ + G_{i} + P_{j} + e_{i j k}

where Y_ijk is the phenotypic traits, μ is the mean, G_i is the fixed effect of ith genotypes (i = CC, CT, TT), P_j is the fixed effect of jth parity (j = 1, 2, 3), and e_ijk is the random residual error. A significant difference was determined at the (0.05, 0.01) level by the Tukey-Kramer test. Using the chi-square test, 3 reproductive traits were analyzed: lambing rate, survival rate, and type of birth. Paired-like homeodomain transcription factor 2 polymorphisms and litter size were examined using logistic regression. The potential effects of the factor interaction, lambing season, and age were evaluated and discarded when non-significant.

Results

Genotyping, sequencing of PITX2 genes, and genetic diversity

Out of 6 exons, only 3 exons (exons 2, 4, and 5) were, respectively, selected for PITX2 genotyping in the studied ewes’ population. This was because they covered 271 amino acid residues, which make up most paired-like homeodomain 2 amino acid sequences (271 out of 317, or 85.5%). The other exons of the PITX2 gene were not considered as they covered only 46 amino acid residues of the entire protein (46/317 or 14.5%). The 4 coding regions of the PITX2 gene, together with their flanking regions, were analyzed by amplification of 4 genetic fragments of 228, 304, 381, and 382 bp, respectively (Figure 2A). For the PCR-SSCP amplicons corresponding to exons 2, 4, and 5 (upstream portion), all electrophoretic migrations were monomorphous, and there was no heterogeneity in the electrophoretic migration as observed for the amplicons of 228, 304, and 381 bp. Polymerase chain reaction-single-strand conformation polymorphism pattern analysis of 382 bp amplicons intended for amplification of exon 5 (downstream portion) revealed 3 distinct patterns (Figure 2B). According to sequencing experiments, there was heterogeneity in exon 5 and 1 polymorphic locus was detected within the amplified exon 5 fragment. The variants belonging to CC, CT, and TT genotypes were predicted from the 319C > T nucleic acid substitution detected in the PCR amplicons, which corresponds to homozygous C/C, T/T, and heterozygous C/T patterns (Figure 2C). The different genotypes (CC, TT, and CT) were classified based on the SSCP pattern and confirmed based on the Sanger sequencing. Samples that did not appear for the first time in the gel were reposted to get the best picture. On-line prediction software RNA fold Web Server was used to determine the effects of genotypes on PITX2 gene 3’UTR mRNA secondary structure. The 319C > T mutation altered the secondary structure of PITX2 3’UTR in these genotypes (Figure 2D).

Figure 2

A schematic diagram for the PITX2 gene-based PCR-SSCP-sequencing strategy within Awassi ewes. (A) PCR design of 4 PCR specific primers pairs for the amplification of 228, 304, 381, and 382 bp in exon 2, exon 4, exon 5 (upstream portion), and exon 5 (downstream portion), respectively. (B) PCR-SSCP genotyping, in which only exon 5 (downstream portion) showed 3 genotypes, homozygous and heterozygous. (C) DNA-sequencing electropherograms of the detected genotypes, in which 1 SNP, 319C > T, was detected in the exon 5 (3’UTR region) in the heterozygous TT genotype. (D) Secondary structure prediction of different genotypes of mRNA in PITX2 gene 3’-UTR.

Based on genetic diversity, there were 113 genotypes of the CC genotype, with a total frequency of 0.42. Following this were the TT and CT genotypes, with frequencies of 0.35 and 0.23, respectively. Expected heterozygosity (He) values were higher than observed heterozygosity (Ho) values at the 319C > T SNP locus, indicating lower genetic variation (Table 2). Based on the classification of PIC (low, median, and high polymorphism if PIC value <0.25, 0.25 <PIC value < 0.5, and PIC value > 0.5, respectively), this study showed a moderate level of polymorphism at the 319C > T SNP locus. The chi-square analysis showed significant deviance from the HWE for the 319C> T SNP locus of the PITX2 gene (P ⩽ .05).

Table 2.

Genetic diversity of the PITX2 gene in Awassi ewes detected by PCR-SSCP.

Observed genotypes			Genotype frequencies			Allele frequencies		Ho	He	Ne	PIC	χ²
CC	CT	TT	CC	CT	TT	C	T
n = 113	n = 40	n = 79	0.42	0.23	0.35	0.57	0.43	0.17	0.49	1.96	0.37	97.96

Abbreviations: χ², chi-square; He, expected heterozygosity, Ho, observed heterozygosity, n, number of individuals, Ne, effective allele frequency, PCR, polymerase chain reaction; PIC, polymorphism information content; SSCP, single-strand conformation polymorphism.

All chi-square tests have 2 degrees of freedom and within the significance level P ⩽ .05.

Association analysis of PITX2 gene with reproductive performance

Based on the 319C > T SNP, an association analysis found no significant difference (P ⩾ .01) between CC and CT/TT genotypes in survival rate and age of first lambing. The CC genotype at the same 319C > T locus was associated significantly (P ⩽ .01) with more litter sizes, twinning rates, lambing rates, and shorter lambing days compared with the CT and TT genotypes (Table 3). An analysis of logistic regression provided further insights into the association between 319C > T and litter size in Table 4. Ewes with CC genotypes had 1.70 lambs per animal compared with CT and TT genotypes. As a result, the SNP 319C > T negatively impacted these traits.

Table 3.

The association between PITX2 genetic polymorphism and reproductive performance in Awassi ewes.

Genotypes	Birth type (%)		Lambing rate (%)	Survival rate (%)	Days to lambing (LSM ± SE)	Age at first lambing (LSM ± SE)
Genotypes	Singleton	Twin	Lambing rate (%)	Survival rate (%)	Days to lambing (LSM ± SE)	Age at first lambing (LSM ± SE)
CC	34 (30.08%)	79 (69.91%)	96	189 (98.43%)	161^a ± 8.62	519.41 ± 26.32
CT	23 (57.50%)	17 (42.50%)	88	55 (96.49%)	170^b ± 9.31	523.11 ± 28.41
TT	58 (73.41%)	21 (26.58%)	82	96 (96.00%)	184^c ± 11.48	534.32 ± 29.12
P value	.001	.01	.03	.31	.02	.23

Abbreviations: LSM ± SE, least square means ± standard error; PITX2, paired-like homeodomain transcription factor 2.

a,b,c

Significant differences in mean values represent by differences in the same column within each classification, the P value with statistical significance are indicated in bold numbers.

Table 4.

Logistic regression analysis of PITX2 genotype and litter size in Awassi ewes.

Genotype	Litter size (LSM ± SE)	Logistic regression analysis
Genotype	Litter size (LSM ± SE)	β	Odds ratio (95%CI)	P value
CC	1.70^a ± 0.15	1.00	Reference	.001
CT	1.43^b ± 0.10	−1.03	2.80 (1.49-5.62)	.001
TT	1.27^c ± 0.09	−1.32	3.85 (1.38-6.18)	.001

Abbreviations: β, regression coefficients; CI, confidence interval; LSM ± SE, least square means ± standard error; PITX2, paired-like homeodomain transcription factor 2.

a,b,c

Significant differences in mean values represent by differences in the same column within each classification, the P value with statistical significance are indicated in bold numbers.

Discussion

Several studies have reported genetic variations in the PITX2 gene in livestock. In 2 famous Chinese dairy goat breeds, 4 single-nucleotide polymorphisms (SNPs) of the caprine PITX2 gene have been found: g.18117TNC, g.18161CNG, g.18322CNA, and g.18353TNC. These SNPs are associated significantly with dairy goat milk traits.¹² Furthermore, genetic variant g.18117T > C, g.18353T > C, and g.18161C > G within the caprine PITX2 genes was correlated significantly with growth traits in Guanzhong dairy goats, according to Zhang et al.²⁹ In chickens, the novel SNPs g.12713A > G of the PITX2 gene is associated significantly with carcass characteristics in Wuliang Mountain Black-bone hens.²⁰ Recently, 4 SNPs (g.9830C > T, g.13335G > A, g.10073 C > T, g.13726A > G) of the PITX2 gene showed significant association with chicken meat quality.¹³ However, the literature about PITX2 variation in Awassi sheep is rare.

In this study, the 319C > T SNP occurred in a non-coding region and significantly affected economic traits. A possible explanation for this situation is that the conserved non-coding region of DNA has previously been found to play a vital role in biological reactions.³⁰ In the case of synonymous mutations, the coded message remains unchanged. However, protein production may be affected by impaired RNA splicing. Furthermore, it can lower the translation of gene products and influence regulatory sequences.³¹ A further study by Manning and Cooper³² revealed that non-coding variants found in RNA synthesis regions are linked to post-translational processing and translation initiation. Various functions of the genome may be affected by changes to RNA secondary structures, including protein folding, accessibility of RNA to functional sites, alternative splicing, and proteins that recognize RNA binding sites.³³ A recent study indicates that the 3’UTR region of genes can influence mRNA location and protein abundance through their effects on mRNA stability and translation.³⁴ Ribeiro et al³⁵ revealed that genetic information stored in gene 3’UTR can affect protein expression through protein-protein interactions.

Statistically, individuals belonging to the CC genotype had higher litter sizes, twinning rates, lambing rates, and fewer days to lambing than those belonging to the CT and TT genotypes. As a result of these findings, the 319C > T mutation negatively affects the reproductive performance of Awassi ewes. The PITX1 and PITX2 proteins affect several fertility genes, such as GH, PRL, LHβ, FSHβ, and GnRH receptors by interactions with cell-specific factors, including NeuroD1/Pan1, Steroidogenic Factor-1 (SF-1), and Pit1.¹⁴ PITX2 may regulate the function of the ovary by interacting with its cofactor Pit1. Paired-like homeodomain transcription factor 2 may also regulate unidentified genes and could play a role in steroidogenesis, folliculogenesis, and ovarian development.³⁶ PITX2 contributes significantly to reproductive traits because, as a member of the POU1F1-PROP1 pathway, and regulates the expression of POU1F1, LHX3, PROP1, GH, and PRL genes.¹⁷ In addition, PITX2 regulates Wnt/β-catenin pathways, which are involved in embryo implantation, linking this to litter size.^9,15 However, a few reports in the literature describe the impact of non-coding region SNPs, specifically the 3’UTR, on phenotypic traits. In goat PITX2 genes, a novel 22-bp indel mutation is associated with litter size and growth characteristics.⁹ According to Jia et al,³⁷ an occurrence of synonymous mutations of the bone morphogenetic protein receptor type 1B (BMPR-1B) gene in Mongolian, Dorset, and Small Tail Han sheep can cause the premature termination of mRNA, which affects sheep follicular oocyte expression and granulosa cells. A novel variant, g.46544883A > G within the 3’ UTR of GDF9, has been shown to affect litter size in Mongolian ewes.³⁸ Jia et al³⁹ found that the A1354G SNP of the 3’UTR region of the BMPR-1B gene is correlated with litter size. Statistical analysis indicated that the 13-bp indel substitution in the 3’ UTR region of the A-kinase anchoring protein 12 (AKAP12) gene is correlated significantly with litter size in Shaanbei white cashmere goats and those carriers with DD genotypes produced smaller litters compared with carriers of ID and II genotypes.⁴⁰ Based on these data, little is known about how this gene polymorphism affects sheep reproductive performance. The Awassi sheep is a prevalent breed throughout most Middle Eastern countries.⁴¹ Although this breed is known for its ability to cope with unfavorable conditions,⁴² its reproduction is lower than other breeds in the region, such as Karakuls and Assafs.³ Most Middle Eastern breeders are concerned about the low reproductive capacity of this breed, which drives efforts to improve its reproductive performance. Based on this, the PITX2 gene appears to have the potential for influencing reproductive performance in Awassi sheep. The polymorphism of the PITX2 gene is strongly suggested as a new critical candidate in marker-assisted selection for future improvement of the litter size of the Awassi ewe’s population.

Conclusions

A novel SNP, 319C > T, was found in the heterozygous CT genotype of the PITX2 gene (3’UTR). Ewes with the CC genotype showed significant associations with higher litter sizes, twinning rate, lambing rates, and shorter days to lambing than ewes with the CT and TT genotypes. Ewes with CC genotypes showed better measurements of reproductive traits than those with TT genotypes. Based on the results of this study, ewes carrying the 319C > T SNP have a lower litter size and are less prolific than ewes without the SNP.

Footnotes

Acknowledgements

The authors thank Babylon and Karbala sheep stations for providing the ewes for their study.

Funding:

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Declaration of conflicting interests:

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Author Contributions

All authors contributed equally.

References

Maquivar

Smith

Busboom

. Reproductive management of rams and ram lambs during the pre-breeding season in US sheep farms. Animals. 2021;11:2503. doi:10.3390/ani11092503

AL-Thuwaini

TM.

Adiponectin and its physiological function in ruminant livestock. Rev Agric Sci. 2022;10:115-122. doi:10.7831/ras.10.0_115

Ajafar

Kadhim

AL-Thuwaini

TM.

The reproductive traits of sheep and their influencing factors. Rev Agric Sci. 2022;10:82-89. doi:10.7831/ras.10.0_82

Gholizadeh

Esmaeili-Fard

SM.

Meta-analysis of genome-wide association studies for litter size in sheep. Theriogenology. 2022;180:103-112. doi:10.1016/j.theriogenology.2021.12.025

Ajafar

Al-Thuwaini

Dakhel

HH.

Association of OLR1 gene polymorphism with live body weight and body morphometric traits in Awassi ewes. Mol Biol Rep. 2022;49:4149-4153. doi:10.1007/s11033-022-07481-3

Imran

Al-Thuwaini

Al-Shuhaib

MBS

Lepretre

A novel missense single nucleotide polymorphism in the GREM1 gene is highly associated with higher reproductive traits in Awassi sheep. Biochem Genet. 2021;59:422-436. doi:10.1007/s10528-020

Al-Thuwaini

TM.

Novel single nucleotide polymorphism in the prolactin gene of Awassi ewes and its role in the reproductive traits. Iraqi J Vet Sci. 2021;35:429-435. doi:10.33899/ijvs.2020.126973.1423

Mohammed

Al-Thuwaini

Al-Shuhaib

MBS

A novel p. K116Q SNP in the OLR1 gene and its relation to fecundity in Awassi ewes. Theriogenology. 2022;184:185-190. doi:10.1016/j.theriogenology.2022.03.014

Yan

Jiang

Zhu

Liu

The novel 22 bp insertion mutation in a promoter region of the PITX2 gene is associated with litter size and growth traits in goats. Arch Anim Breed. 2018;61:329-336. doi:10.5194/aab-61

10.

Zhang

Kang

, et al. Bovine pituitary homeobox 2 (PITX2): mRNA expression profiles of different alternatively spliced variants and association analyses with growth traits. Gene. 2018;669:1-7. doi:10.1016/j.gene.2018.05.083

11.

Hernandez-Torres

Rodríguez-Outeiriño

Franco

Aranega

AE.

Pitx2 in embryonic and adult myogenesis. Front Cell Dev Biol. 2017;5:46. doi:10.3389/fcell.2017.00046

12.

Zhao

Cai

, et al. Genetic variants and effects on milk traits of the caprine paired-like homeodomain transcription factor 2 (PITX2) gene in dairy goats. Gene. 2013;532:203-210. doi:10.1016/j.gene.2013.09.062

13.

Cao

Zhou

Tan

, et al. Chronological expression of PITX2 and SIX1 genes and the association between their polymorphisms and chicken meat quality traits. Animals. 2021;11:445. doi:10.3390/ani11020445

14.

Guioli

Lovell-Badge

. PITX2 controls asymmetric gonadal development in both sexes of the chick and can rescue the degeneration of the right ovary. Development. 2007;134:4199-4208. doi:10.1242/dev.010249

15.

Majidinia

Aghazadeh

Jahanban-Esfahlani

Yousefi

The roles of Wnt/β-catenin pathway in tissue development and regenerative medicine. J Cell Physiol. 2018;233:5598-5612. doi:10.1002/jcp.26265

16.

Kioussi

Briata

Baek

, et al. Identification of a Wnt/Dvl/β-catenin→Pitx2 pathway mediating cell-type-specific proliferation during development. Cell. 2002;111:673-685.

17.

Zhao

Zhu

, et al. A novel 29 bp insertion/deletion (indel) variant of the LHX3 gene and its influence on growth traits in four sheep breeds of various fecundity. Arch Anim Breed. 2017;60:79-85. doi:10.5194/aab-60

18.

Torlopp

Khan

Oliveira

, et al. The transcription factor Pitx2 positions the embryonic axis and regulates twinning. Elife. 2014;3:e03743. doi:10.7554/eLife.03743

19.

Quan

Zhu

Zheng

, et al. Comparison of the pituitary gland transcriptome in pregnant and non-pregnant goats (Capra hircus). Czech J Anim Sci. 2019;64:420-430. doi:10.17221/141/2019-CJAS

20.

Cao

Dong

Mao

Yin

Expression analysis of the PITX2 gene and associations between its polymorphisms and body size and carcass traits in chickens. Animals. 2019;9:1001. doi:10.3390/ani9121001

21.

Priston

Kozlowski

Gill

, et al. Functional analyses of two newly identified PITX2 mutants reveal a novel molecular mechanism for Axenfeld–Rieger syndrome. Hum Mol Genet. 2001;10:1631-1638. doi:10.1093/hmg/10.16.1631

22.

Jiang

Tang

Wang

, et al. A genome-wide association study of growth and fatness traits in two pig populations with different genetic backgrounds. J Anim Sci. 2018;96:806-816. doi:10.1093/jas/skx038

23.

Al-Shuhaib Mohammed Baqur

. A universal, rapid, and inexpensive method for genomic DNA isolation from the whole blood of mammals and birds. J Genet. 2017;96:171-176. doi:10.1007/s12041-017

24.

Coulouris

Zaretskaya

Cutcutache

Rozen

Madden

TL.

Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012;13:1-11. doi:10.1186/1471-2105

25.

Al-Thuwaini

Association between polymorphism in BMP15 and GDF9 genes and impairing female fecundity in diabetes type 2. Middle East Fertil Soc J. 2020;25:1-10. doi:10.1186/s43043-020

26.

Byun

Fang

Zhou

Hickford

JGH

. An effective method for silver-staining DNA in large numbers of polyacrylamide gels. Anal Biochem. 2009;385:174-175. doi:10.1016/j.ab.2008.10.024

27.

Yeh

Yang

Boyle

. Microsoft Window-Based Freeware for Population Genetic Analysis (POPGENE), Ver. 1.31. University of Alberta; 1999.

28.

Botstein

White

Skolnick

Davis

RW.

Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet. 1980;32:314-331.

29.

Zhang

Zhao

Lei

, et al. Effects of genetic variations within goat PITX2 gene on growth traits and mRNA expression. Anim Biotechnol. 2020;31:107-114. doi:10.1080/10495398.2018.1551229

30.

Alexander

Fang

Rozowsky

Snyder

Gerstein

MB.

Annotating non-coding regions of the genome. Nat Rev Genet. 2010;11:559-571. doi:10.1038/nrg2814

31.

McIntosh

Mastaglia

Wilton

Aung-Htut

MT.

Neurodegenerative diseases: a hotbed for splicing defects and the potential therapies. Transl Neurodegener. 2021;10:1-18. doi:10.1186/s40035-021

32.

Manning

Cooper

TA.

The roles of RNA processing in translating genotype to phenotype. Nat Rev Mol Cell Biol. 2017;18:102-114. doi:10.1038/nrm.2016.139

33.

Yan

Sham

Wang

Exploring the function of genetic variants in the non-coding genomic regions: approaches for identifying human regulatory variants affecting gene expression. Brief Bioinform. 2015;16:393-412. doi:10.1093/bib/bbu018

34.

Zhu

Zhang

Analysis and differences of sheep BMP-15 gene expression in ewes with different lambing traits. Genomics Appl Biol. 2018;37:1853-1858. doi:10.13417/j.gab.037.001853

35.

Ribeiro

Prod’homme

Teixeira

Zanzoni

Brun

The role of 3′ UTR-protein complexes in the regulation of protein multifunctionality and subcellular localization. Nucleic Acids Res. 2020;48:6491-6502. doi:10.1093/nar/gkaa462

36.

Ghosh

Saha

Nandi

Bhattacharya

Roy

SS.

Involvement of Pitx2, a homeodomain transcription factor, in hypothyroidism associated reproductive disorders. Cell Physiol Biochem. 2007;20:887-898. doi:10.1159/000110449

37.

Jia

Chen

Gui

, et al. Association of polymorphisms in bone morphogenetic protein receptor-1B gene exon-9 with litter size in Dorset, Mongolian, and small Tail Han ewes. Asian-Australas J Anim Sci. 2019;32:949-955. doi:10.5713/ajas.18.0541

38.

Tong

Wang

Cheng

, et al. Novel variants in GDF9 gene affect promoter activity and litter size in Mongolia sheep. Genes. 2020;11:375. doi:10.3390/genes11040375

39.

Jia

Xie

Zhang

, et al. Association of BMPR-1B Gene 3’-UTR region polymorphism with litter size in Tibetan sheep. Kafkas Univ Vet Fak Derg. 2021;27:285-289. doi:10.9775/kvfd.2020.25064

40.

Kang

Bai

Lan

Zhao

Goat AKAP12: indel mutation detection, association analysis with litter size and alternative splicing variant expression. Front Genet. 2021;12:648256. doi:10.3389/fgene.2021.648256

41.

Al-Thuwaini

Kareem

ZA.

Novel missense variant L46Q of fatty acid synthase gene and fatty acids content in Awassi sheep. Acta Sci-Anim Sci. 2022;44:e56273-e56273. doi:10.4025/actascianimsci.v44i1.56273

42.

Al-Thuwaini

TM.

The relationship of hematological parameters with adaptation and reproduction in sheep; a review study. Iraqi J Vet Sci. 2021;35:575-580. doi:10.33899/ijvs.2020.127253.1490

Association of Novel C319T Variant of PITX2 Gene 3’UTR Region With Reproductive Performance in Awassi Sheep

Abstract

Keywords

Introduction

Materials and Methods

Sheep population

DNA and polymerase chain reaction

Single-strand conformation polymorphism

DNA sequencing

Statistical analysis

Results

Genotyping, sequencing of PITX2 genes, and genetic diversity

Association analysis of PITX2 gene with reproductive performance

Discussion

Conclusions

Footnotes

Acknowledgements

Funding:

Declaration of conflicting interests:

Author Contributions

References