Sage Journals: Discover world-class research

Abstract

Objectives:

Litter size is a crucial economic factor in the sheep industry. Several factors and genes influence litter size, making the identification of genes or loci involved a genetic challenge. Gonadotropin-inhibitory hormone (GnIH) is one of several genes that influence sheep’s reproductive traits. Thus, this study aimed to investigate whether variations in the GnIH gene affect the reproductive performance of Awassi and Hamdani ewes.

Methods:

DNA was extracted from 99 single-progeny ewes and 101 twin ewes. The polymerase chain reaction (PCR) produced amplicons of 262 bp, 275 bp, and 284 bp from exons 1, 2, and 3 of the GnIH gene. Single-strand conformational polymorphism (SSCP) technique was used for genotyping experiments. Sequencing and in silico analysis were performed on each set of SSCP-resolved bands.

Results:

Two genotypes of 262 bp amplicons were found: TT and TC. Sequence analysis revealed a novel missense mutation in the TC genotype at position c.122T>C. Five in silico tools were used to assess the impact of this mutation on GnIH protein structure, function, and stability, all of them demonstrated a deleterious effect. An analysis of statistical data revealed a strong correlation between the c.122T>C single-nucleotide polymorphism (SNP) and reproductive performance. Ewes with the SNP 122T>C exhibited a significant increase in litter size, twinning rates, lambing rates, and days to lambing when compared with ewes with the TT genotype. A lower number of lambs were born to ewes with the TT genotype than those with the TC genotype.

Conclusion:

These results concluded that the c.122T>C SNP variant positively influences the reproductive performance of Awassi and Hamdani sheep. Sheep that carry the c.122T>C SNP show higher litter size and increased productivity.

Keywords

In silico twinning rate sheep

Introduction

Sheep reproduction is commonly known to be influenced by distinct seasonal patterns, which poses significant challenges for improving sheep farming.¹ Sheep farming is generally more efficient and profitable when the productivity and reproduction of ewes are improved.^2
-4 Numerous genetic loci associated with economic valuable traits in farm animals have been identified through advancements in molecular genetics. The development of marker-assisted selection tools begins with identifying the candidate genes that influence these traits.⁵ The gonadotropin-inhibitory hormone (GnIH) gene is a promising candidate for polymorphism analysis related to reproductive performance.⁶ The GnIH gene consists of 3 exons on sheep’s chromosome 4 (NCBI Reference Sequence NC_056057.1) and goat’s chromosome 4, encoding the GnIH hormone.⁶ The hypothalamic neuropeptide hormone GnIH plays a crucial role in inhibiting the production of reproductive hormones by competing with the gonadotropin-releasing hormone (GnRH).⁷ Furthermore, GnIH effectively reduces cAMP production and GnRH-induced phosphorylation of extracellular signal-regulated kinase.⁸ Gonadotropin-inhibitory hormone neurons also express estrogen receptors, indicating their involvement in the negative feedback loop between estrogen and GnRH that regulates reproductive activity.⁹ Administration of GnIH to ewes resulted in a significant reduction in estrogen-induced luteinizing hormone (LH) surges. Ewes in the preovulatory stage also experience a decrease in gene expression of GnIH. The surge of GnRH/LH in ewes may also be induced by a decrease in GnIH.¹⁰ Through its control over these hormones, GnIH contributes to the regulation of reproductive traits.¹¹ Gonadotropin-inhibitory hormone plays a significant role in the secretion of gonadotropins in both avian and mammalian species.¹² As a result, variations in the GnIH gene have a significant impact on biological traits.

Numerous studies have shown that livestock productivity is strongly related to single-nucleotide polymorphisms (SNPs) in key regulatory genes.^13,14 Until now, only one study has been found to demonstrate that GnIH plays a role in regulating litter size. Two variations, g.1837C>G and g.3195G>A, have been identified in the GnIH gene, which is associated with litter size in dairy goats. Genetic associations suggest that individuals with the CC/GG genotype of 2 SNPs have a significantly larger litter size than those with GG/AA genotypes.⁶ As a result, the GnIH gene is an excellent candidate for genetic selection and breeding. However, the GnIH gene polymorphism has not yet been studied in terms of its impact on the reproductive performance of Awassi and Hamdani sheep. Thus, the study fills this knowledge gap by identifying polymorphisms in the GnIH gene and evaluating their impact on reproductive performance in Awassi and Hamdani sheep. This study used state-of-the-art in silico tools to investigate the genetic diversity and polymorphism of the GnIH gene in the study population and to assess whether the mutation affects GnIH protein structure, function, and stability. After that, GnIH genotypes of Awassi ewes were analyzed for litter size, lambing rate, number of days to lambing, and age at first lambing. Furthermore, the study examined the relationship between litter size and GnIH variants.

Materials and Methods

Sheep population

The study was approved by the Al-Qasim Green University Animal Ethics Committee in compliance with international guidelines (Agri, No. 01, 7, 22). Awassi (130) and Hamdani (70) ewes were selected for this study. The Awassi and Hamdani are the most prevalent breeds among those in the Middle East. Awassi sheep weigh 40 to 45 kg, while Hamadani sheep weigh 55 to 60 kg. The 2 animal breeds differed in terms of genetics and geography. Despite this, they are characterized by reproductive seasonality and have lower reproduction rates than Karakuls and Assafs. Thus, breeding improvements in Awassi and Hamadani sheep may be achievable through the GnIH gene. Ewes were sexually mature, healthy, and 3 to 4 years old, and classified into 99 ewes-producing singletons and 101 ewes-producing twins. Animals were randomly selected from each breed at Babylon and Karbala stations. All animals were under the same conditions of management, feeding, and weather. In the breeding stations, several prolific traits were recorded, including twinning rate (the propensity to have more twin litters per 100 ewes at the same average lambing percentage), lambing rate, number of days to lambing (the number of days between the joining of rams until the subsequent lambing), age at first lambing (the age of the ewe at her first lambing), and litter size (the number of lambs born per ewe lambing).

Molecular analysis

DNA was extracted from whole sheep blood using a rapid salting-out technique.¹⁵ The NCBI Primer-BLAST server was used to design 3 genetic fragments that cover the coding regions of the GnIH gene. Using NCBI Primer-BLAST, 200 genetic sequences were amplified from the genetic material within GnIH.¹⁶ The Bioneer premix and Eppendorf thermal gradient apparatus were used to identify the optimal polymerase chain reaction (PCR) amplification conditions, as indicated in Table 1. The process involved an initial denaturation step at 94 °C for 5 minutes, followed by 30 cycles of 30 seconds of denaturation, 45 seconds of annealing, and 30 seconds of extension. A final extension was performed at 72 °C for 5 minutes, and then the samples were stored at 4 °C.¹⁷ The quality of the PCR products was assessed through electrophoresis in 2% agarose gels, and images were taken using a Chemidoc Gel Imager (Bio-Rad, Hercules, CA, USA).¹⁸

Table 1.

The oligonucleotide primer sets are designed for the amplification of the ovine GnIH gene.

Primer code	Locus	Sequence (5′-3′)	Binding coordinates in the genome		Amplicon length	Annealing temperature
Primer code	Locus	Sequence (5′-3′)	Start	Stop	Amplicon length	Annealing temperature
GnIH, exo1-F	Exon 1	TGTATAGACATCAGGCTGCACA	72260451	72260472	262 bp	60.9 °C
GnIH, exo1-R		ACAAAAGCACTAGACTCAGAACA	72260712	72260690		60.9 °C
GnIH, exo2-F	Exon 2	CTGCCGTCAACAAAATGCCA	72262131	72262150	275 bp	55.3 °C
GnIH, exo2-R		CCGGCAGGTCATGGAGTAAA	72262405	72262386		55.3 °C
GnIH, exo3-F	Exon 3	GTGGCAATGAGGCAGAGAGAT	72263560	72263580	284 bp	56.4 °C
GnIH, exo3-R		AGGGACAGGCTCCACATTTC	72263843	72263824

The symbols “F” and “R” refer to forward and reverse primers, respectively. The design was based on the ovine NCBI Reference Sequence NC_056057.1.

In light of the high accuracy of PCR single-strand conformation polymorphism (SSCP) for both the detection of known mutations and unknown mutations in PCR amplicons, a recently recommended rapid PCR-SSCP genotyping protocol was used. A genotype was determined for each PCR product using the technique described by Mohammed et al.¹⁹ The PCR product (10 μL) was mixed with 10 μL of SSCP loading buffer dye (Bio-Rad). The PCR/SSCP products were initially subjected to 95 °C for 7 minutes. Afterward, they were promptly cooled on ice for 10 minutes before undergoing separation on a non-denaturing polyacrylamide gel.²⁰ Electrophoresis was conducted in a vertical unit using a 1× TBE (Tris boric EDTA) buffer. A 10% SSCP gel was prepared using a mixture of acrylamide and bisacrylamide at a ratio of 37.5:1.²¹ The gel was electrophoresed at a constant current of 200 mA and a voltage of 100 V for 4 hours, at a running temperature of 4 °C. Silver nitrate was used as a staining agent in the gels, as described by Byun et al.²² A gel documentation system was used to photograph and analyze heterozygous and homozygous genotypes exhibiting different SSCP patterns. Polyacrylamide gel bands were detected using SSCP, followed by Sanger sequencing of all PCR products. BioEdit 7.1 and SnapGene Viewer 4.0.4 were used for analyzing the sequencing results. Based on the Ensemble Genome Browser 96 novelty detection, the observed variants were classified as novel. The ExPASy software was used to detect amino acid reading frames.²³ The next step involved comparing the amino acid sequences with those in the GnIH database using UniProtKB (http://www.uniprot.org/align/). The structure, function, and stability of mutant proteins were predicted using a variety of computational tools, including Sorting Intolerant From Tolerant (SIFT), PolyPhen-2, Provean, I-Mutant2, and Mupro.

Data analysis

The genotypes and allele frequencies, observed (Ho) and expected (He) heterozygosities, and effective number of alleles (Ne) were calculated using the PopGen32 program, version 1.31.²⁴ The populations were assessed for Hardy-Weinberg equilibrium (HWE) using a chi-square test, as well as for polymorphism information content (PIC) based on the methodology outlined by Botstein et al.²⁵ PIC = 1 – $\sum_{i = 1}^{m} p_{i}^{2} - \sum_{i = 1}^{m - 1} \sum_{j = i + 1}^{m} 2 p_{i}^{2} p_{j}^{2},$ where p_i and p_j are the frequencies of the ith and jth alleles, respectively, and m is the number of alleles.

The association analysis of GnIH genotypes was conducted using IBM SPSS 23.0 (NY, USA) as follows:

Y_{ijkl} = μ + G_{i} + B_{j} + p_{j} + e_{ijkl}

where Y_ijkl = phenotype characteristics, μ = the mean of all traits, G_i = fixed effect of the ith genotype (i = TT, TC), B_j = fixed effect of the jth breed (j = 1, 2), Pk = fixed effect of the kth parity (k = 1, 2, 3), and e _ijkl = random error. The Tukey-Kramer test was used to determine whether there was a significant difference at the 0.05 and 0.01 levels of significance. Three reproductive traits were assessed using the chi-square test: lambing rate, survival rate, and litter size. Factor interactions, lambing season, and age, and their effects were excluded when they were not significant. The in silico tools SIFT, PolyPhen-2, PROVEAN, I-Mutant2.0, and Mupro were used to assess the potential damaging or non-damaging impacts of the identified missense variant on the GnIH protein’s structure, functions, and stability.

Results

Genotyping, sequencing of GnIH genes, and genetic diversity

All coding regions of the GnIH gene were screened by amplifying exon 1, exon 2, and exon 3 with PCR fragments of 262, 275, and 284 bp, respectively (Figure 1A). In the 275 bp and 284 bp amplicons, electrophoretic migrations showed monomorphism for the amplicons corresponding to exons 2 and 3. The 262 bp amplicons intended for amplification of exon 1 exhibited 2 distinct patterns of PCR-SSCP (Figure 1B). Sequencing experiments confirmed that c.122T>C occurred only in one variant of exon 1, indicating heterogeneity. As a result of the detected c.122T>C nucleic acid substitution, TT and TC genotypes were identified, corresponding to the homozygous T/T and heterozygous T/C patterns observed in the coding sequence of exon-1 amplicons, respectively (Figure 1C). Expasy-translate analysis showed that this nucleic acid substitution causes isoleucine to threonine substitution at position 24 of the mature GnIH protein (p.Ile>Thr24). This substitution was investigated using 5 computational tools: SIFT, PolyPhen-2, Provean, I-Mutant2, and Mupro to assess the potential deleterious or neutral consequences of this missense SNP on the structure, function, and stability of the protein. According to all computational analyses (Figure 1D), the effects were deleterious and reduced stability. In contrast to individuals with TT genotypes, individuals with TC genotypes exhibited adverse effects of this nsSNP on the scheduled biological activities of GnIH protein.

Figure 1.

An illustration of the PCR-SSCP-sequencing technique using the GnIH gene in Awassi ewes. (A) PCR-specific primers were designed to amplify 262 bp, 275 bp, and 284 bp in exon 1, exon 2, and exon 3, respectively. (B) PCR-SSCP genotyping confirmed homozygosity and heterozygosity in exon 1. (C) Electropherograms of DNA sequencing reveal a c.122T>C SNP in exon 1 of the TT genotype. (D) Implementation of 5 bioinformatics techniques to study the deleterious effects of the p.Ile>Thr24 SNP on the GnIH protein.

Regarding genetic diversity, the results of HWE, genotypes, and allele frequencies for Awassi and Hamdani sheep are presented in Table 2. In a genetic diversity analysis of the GnIH gene, the genotype TT was the most frequent (n = 79 in Awassi and n = 41 in Hamadani). The TC genotype was prevalent at 0.39 (n = 51) in Awassi sheep and at 0.41 (n = 29) in Hamadani sheep. According to polymorphic information content (PIC) analysis, values below 0.25 were considered low, those between 0.25 and 0.5 were considered medium, and those above 0.5 were considered high. The c.122T>C locus showed a moderate level of polymorphism. A chi-square test revealed that the c.122T>C SNP significantly deviated from HWE in both the Awassi and Hamdani populations, with significance levels of P ⩽ .05.

Table 2.

Genetic diversity of the GnIH gene in Awassi and Hamdani ewes detected by PCR-SSCP.

Breed	Genotype frequencies (n)		Allele frequencies		Ho	He	Ne	χ²	PIC
Breed	TT	TC	T	C	Ho	He	Ne	χ²	PIC
Awassi	0.61 (79)	0.39 (51)	0.80	0.20	0.39	0.32	1.46	7.56	0.27
Hamdani	0.58 (41)	0.41 (29)	0.79	0.21	0.41	0.33	1.49	4.58	0.28

Abbreviations: χ², chi-square; He, expected heterozygosity; Ho, observed heterozygosity; n, number of individuals; Ne, effective allele frequency; PIC, polymorphism information content.

All chi-square tests have 1 degree of freedom and are within the significance level P ⩽ .05.

Association analysis

In an association analysis, the c.122T>C SNP did not result in a significant difference (P ⩾ .01) in survival rate between TT and TC genotyped ewes. At the same c.122T>C locus, the TC genotype was significantly associated (P ⩽ .01) with larger litter size, higher twinning rates, increased lambing rates, and fewer days of lambing (Table 3). Compared with the TT genotype, the TC genotype produced 1.69 lambs per ewe in Awassi and 1.59 lambs per ewe in Hamdani. This observation indicated a potential association between ewes with the TC genotype and a higher litter size. Consequently, these traits were positively correlated with the SNP c.122T>C.

Table 3.

The association between GnIH genetic polymorphism and reproductive performance in Awassi and Hamdani ewes.

Breed	Genotypes	Birth type (%)		Lambing rate (%)	Survival rate %	Days to lambing (LSM ± SE)	Litter size (LSM ± SE)
Breed	Genotypes	Singleton	Twin	Lambing rate (%)	Survival rate %	Days to lambing (LSM ± SE)	Litter size (LSM ± SE)
A) Awassi	TT	41 (51.89%)	38 (48.10%)	96	116 (99.14%)	170^b ± 7.58	1.48^b ± 0.11
	TC	16 (31.37%)	35 (68.62%)	84	85 (98.83%)	161^a ± 9.21	1.69^a ± 0.19
	P-value	.001	.002	.02	.51	.02	.03
B) Hamdani	TT	30 (73.17%)	11 (26.82%)	93	51 (98.07%)	172^b ± 8.33	1.27^b ± 0.20
	TC	12 (41.37%)	17 (58.62%)	81	45 (97.82%)	163^a ± 7.41	1.59^a ± 0.11
	P-value	.003	.001	.03	.30	.04	.006

Abbreviation: LSM ± SE, least square means ± standard error.

a,b

Significant differences in means are represented by differences in the same column within each classification, the P value with statistical significance is indicated in bold numbers.

Discussion

Genomic tools are truly remarkable because they reveal the specific genes that are crucial in influencing a wide range of reproductive traits. This capability enables us to achieve significant genetic advancements that will last.²⁶ There are many genetic variants associated with litter size in sheep, such as the c.382C>A variant of the BMP2 gene,²⁷ the g.22645332G>T variant of the PTX3 gene,²⁸ as well as the rs399534524 locus in CLSTN2 and the rs407142552 locus in CTH.²⁹ According to Li et al,³⁰ the variants c.1057-4C>T in NOX4 and c.1983C>T in PDE11A are significantly associated with sheep litter size. Moreover, several loci have been associated with litter size in sheep, including the g.4054427728A>G HRG locus and the g.421655951C>T FETUB locus.³¹ Tao et al³² also found that WWC2 (g.14962207C>T), SLK (g.27108855G>A), ARHGEF9 (g.48271079), and FSHR (g.80789180T>G) affected sheep litter size. The above findings indicate the crucial role of genetic variation in influencing livestock reproduction. However, only one study has shown that the GnIH gene exhibits genetic variability in livestock reproduction. Two GnIH gene variants, g.C1837G and g.G3195A, have been identified in 2 breeds of Chinese dairy goats that are associated with litter size. These polymorphisms are identified through DNA sequencing and restriction fragment length polymorphism analysis.⁶ In sheep, there is no information available regarding the role of GnIH in controlling litter size, and no research has been done on the variation of GnIH in Awassi and Hamdani sheep. Awassi and Hamdani breeds are widespread in Middle Eastern countries.^33,34 There are differences among breeds based on their morphological characteristics. The external environment and specific living conditions can affect sequence variation in Awassi and Hamdani breeds.^35,36 The Awassi sheep are renowned for their ability to adapt to adverse conditions,³⁷ while the Hamdani sheep originated in Iraq, where they flourish in the natural environment, yielding abundant amounts of meat, wool, and milk.³³ However, their reproductive rates are lower than those of Karakul and Assaf.³⁶ Therefore, the present study fills a knowledge gap by presenting new genotypic data and association findings.

This study found that the SNP c.122T>C located in the GnIH gene was associated with reproductive traits in Awassi and Hamdani sheep. Statistical analysis revealed that there is a significant association (P ⩽ .01) between the c.122T>C mutation and prolificacy, as the TC genotype showed higher litter size, twinning rate, lambing rate, and fewer days to lambing compared with the TT genotypes. Therefore, the c.122T>C SNP mutation had a positive effect on these traits. This may be due to that GnIH reduces sheep and cattle LH and follicle-stimulating hormone (FSH) production by directly suppressing GnRH.⁶ In addition, GnIH regulates calcium flux, synthesis of gonadotropin subunits, and secretion of gonadotropins in pituitary gonadotropes both in vitro and in vivo, showing that it is a peptide that negatively affects sheep reproduction.^38,39 The gonads, brain, and pituitary are the primary targets of GnIH and its receptor.⁴⁰ Furthermore, follicle granulosa cells express the GnIH and GnIH receptors, indicating that GnIH is involved in the production of gonadal steroid hormones and the maturation of germ cells through paracrine or autocrine mechanisms. Estradiol and progesterone are synthesized by granulosa cells under FSH and LH stimulation to facilitate follicle maturation and ovulation. As a result, GnIH inhibits folliculogenesis at granulosa cells of the porcine ovary and reduces central signaling pathways including cyclin-B1 levels and extracellular signal-regulated kinase 1/2.⁴¹ Any detrimental effect on this inhibitor could therefore have a positive effect on reproduction. In this study, one missense SNP (p.Ile>Thr24) was discovered with a notably higher frequency in twin ewes genotyped from a 262 bp amplicon. A missense variant results in amino acid substitutions that could be tolerated, partially acceptable, or deleterious for protein function. As a result of this direct impact, freely available computational tools are increasingly enabling the prediction of missense variants.⁴² Based on these considerations, numerous computer-based analyses confirmed the detrimental effects of the missense p.Ile>Thr24 SNP on the structure, biological functions, and stability of GnIH, which adversely affects its ability to perform its function. Consequently, the higher frequency of p.Ile>Thr24 results in damaged GnIH synthesis, leading to increased prolificacy in Awassi and Hamdani ewes. This study found that the GnIH gene may affect the reproductive performance of sheep breeds. The polymorphisms of the GnIH gene make it a promising candidate for marker-assisted selection, with the potential to significantly increase the litter sizes of ewes in the future. However, further studies with a larger sample size and more extensive records are needed. In addition, genome-wide association studies of Awassi and Hamdani sheep are expected to uncover genetic markers associated with litter size. This gene also requires further research in other sheep breeds to identify more polymorphisms, compare gene sequencing, and trace the evolutionary relationships among sheep breeds.

Conclusions

The GnIH gene of Awassi and Hamdani sheep breeds had a significant impact on litter size when the SNP c.122T>C was present. The TC genotype was linked to increased litter sizes, higher twinning rates, improved lambing rates, and a shorter time to lambing compared with the TT genotype in ewes. Individuals with TC genotypes showed better reproductive traits compared with those with TT genotypes. Marker-assisted selection makes it possible to choose individuals with increased litter sizes and high prolific qualities in both sheep breeds. Selecting sheep with TC genotypes and conducting future studies with larger sample sizes and more sophisticated techniques to determine whether this gene is associated with high prolificacy is crucial.

Footnotes

Funding:

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Declaration of conflicting interests:

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Author Contributions

Both authors contributed equally. In addition, both authors reviewed and approved the final manuscript.

Ethical Approval

This research was approved by Al-Qasim Green University’s research committee and was conducted according to the international guidelines on animal care and use (Agri, No. 01, 7, 22).

ORCID iD

Tahreer M Al-Thuwaini

Data Availability Statement

All data generated or analyzed during this study are included in this manuscript and its information files.

References

Fathy

Gouda

Gafer

Galal

Nowier

AM.

Genetic polymorphism in melatonin receptor 1A and arylalkylamine N-acetyltransferase and its impact on seasonal reproduction in Egyptian sheep breeds. Arch Anim Breed. 2018;61:505-516. doi:10.5194/aab-61-505-2018

Tesema

Deribe

Kefale

, et al. Survival analysis and reproductive performance of Dorper x Tumele sheep. Heliyon. 2020;6:e03840. doi:10.1016/j.heliyon.2020.e03840

AL-Jaryan

AL-Thuwaini

Merzah

Alkhammas

AH.

Reproductive physiology and advanced technologies in sheep reproduction. Rev Agric Sci. 2023;11:171-180. doi:10.7831/ras.11.0_171

Alkhammas

Al-Thuwaini

TM.

Association of birth type and LHX4 gene polymorphism with reproductive hormones, growth hormone, and prolactin in Awassi ewes. Mol Biol Rep. 2023;50:3951-3956. doi:10.1007/s11033-023-08285-9

El-Mansy

Naiel

MAE

Abu El-Naser

, et al. The growth hormone gene polymorphism and its relationship to performance and carcass features in Egyptian Awassi lambs. Heliyon. 2023;9:e14194. doi:10.1016/j.heliyon.2023.e14194

Bao

Hou

, et al. Two single nucleotide polymorphisms in the caprine GnIH gene are associated with litter size. Czech J Anim Sci. 2017;62:269-275. doi:10.17221/58/2016-CJAS

Han

Cao

Meng

Zeng

Surgical castration but not immuncastration is associated with reduced hypothalamic GnIH and GHRH/GH/IGF-I axis function in male rats. Theriogenology. 2016;86:657-665. doi:10.1016/j.theriogenology.2016.02.020

Tsutsui

Ubuka

GnIH control of feeding and reproductive behaviors. Front Endocrinol (Lausanne). 2016;7:170. doi:10.3389/fendo.2016.00170

Teo

Phon

Parhar

The role of GnIH in biological rhythms and social behaviors. Front Endocrinol (Lausanne). 2021;12:728862. doi:10.3389/fendo.2021.728862

10.

Ubuka

Tsutsui

Reproductive neuroendocrinology of mammalian gonadotropin-inhibitory hormone. Reprod Med Biol. 2019;18:225-233. doi:10.1002/rmb2.12272

11.

Huang

Zhu

, et al. Identification and association of single-nucleotide polymorphisms in gonadotropin-inhibitory hormone (GnIH) gene with egg production traits in Erlang mountainous chickens. Genet Mol Res. 2015;14:294-303. doi:10.4238/2015.January.23.3

12.

Maddineni

Ocón-Grove

Krzysik-Walker

Hendricks

3rd Ramachandran

Gonadotropin-inhibitory hormone (GnIH) receptor gene is expressed in the chicken ovary: potential role of GnIH in follicular maturation. Reproduction. 2008;135:267-274. doi:10.1530/REP-07-0369

13.

Mamutse

Purwantini

Susanto

Sodiq

. Determining the polymorphism of V397I SNP of growth differentiation factor 9 (GDF9) gene in Indonesian Saanen Goats. In: Isnaeni

Rusdin

Kimestri

Salido

Nurhayu Tasse

IAM

, eds. International Conference on Improving Tropical Animal Production for Food Security. Atlantis Press; 2022:155-158.

14.

Yao

Liu

Effects of SNPs in AANAT and ASMT genes on milk and peripheral blood melatonin concentrations in Holstein cows (Bos taurus). Genes. 2022;13:1196. doi:10.3390/genes13071196

15.

Al-Shuhaib Mohammed Baqur

. A universal, rapid, and inexpensive method for genomic DNA isolation from the whole blood of mammals and birds. J Genet. 2017;96:171-176. doi:10.1007/s12041-017-0750-6

16.

Coulouris

Zaretskaya

Cutcutache

Rozen

Madden

TL.

Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012;13:1-11. doi:10.1186/1471-2105-13-134

17.

Al-Thuwaini

Kareem

ZA.

Novel missense variant L46Q of fatty acid synthase gene and fatty acids content in Awassi sheep. Acta Sci Anim Sci. 2022;44:2022. doi:10.4025/actascianimsci.v44i1.56273

18.

Al-Thuwaini

Association between polymorphism in BMP15 and GDF9 genes and impairing female fecundity in diabetes type 2. Middle East Fertil Soc J. 2020;25:1-10. doi:10.1186/s43043-020-00032-5

19.

Mohammed

Al-Thuwaini

Al-Shuhaib

MBS

. High association of a novel variant in the adiponectin gene with the litter size in Awassi ewes. J Saudi Soc Agric Sci. 2022;21:296-301. doi:10.1016/j.jssas.2021.09.007

20.

Ali

Kadhim

Al-Thuwaini

TM.

Genetic variants of the bone morphogenetic protein gene and its association with estrogen and progesterone levels with litter size in Awassi ewes. Iraqi J Vet Sci. 2022;36:1017-1022. doi:10.33899/IJVS.2022.132903.2143

21.

Al-Jumaili

Kadhim

Al-Thuwaini

TM.

Polymorphism of the ADIPOQ gene and its association with productive traits in Awassi Ewes. Mol Biol Rep. 2023;50:913-917. doi:10.1007/s11033-022-07975-0

22.

Byun

Fang

Zhou

Hickford

JGH

. An effective method for silver-staining DNA in large numbers of polyacrylamide gels. Anal Biochem. 2009;385:174-175. doi:10.1016/j.ab.2008.10.024

23.

Gasteiger

Gattiker

Hoogland

Ivanyi

Appel

Bairoch

ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003;31:3784-3788. doi:10.1093/nar/gkg563

24.

Yeh

Yang

Boyle

. Microsoft Window-Based Freeware for Population Genetic Analysis (POPGENE), Ver. 1.31. University of Alberta; 1999.

25.

Botstein

White

Skolnick

Davis

RW.

Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet. 1980;32:314-331.

26.

Stafuzza

Silva

RMDO

Fragomeni

BDO

Masuda

Huang

Gray

Lourenco

DAL

. A genome-wide single nucleotide polymorphism and copy number variation analysis for number of piglets born alive. BMC Genom. 2019;20:1-11. doi:10.1186/s12864-019-5687-0

27.

Imran

Al-Thuwaini

TM.

The novel C268A variant of BMP2 is linked to the reproductive performance of Awassi Hamdani sheep. Mol Biol Rep. 2024;51:267. doi:10.1007/s11033-024-09274-2

28.

Imran

Al-Thuwaini

. The novel PTX3 variant g.22645332G> T is strongly related to Awassi and Hamdani sheep litter size. Bioinform Biol Insights. 2024;1818:11779322241248912. doi:10.1177/11779322241248912

29.

Liu

Chu

Detection of polymorphisms in six genes and their association analysis with litter size in sheep. Anim Biotechnol. 2024;35:2309954. doi:10.1080/10495398.2024.2309954

30.

Gong

Wang

, et al. Screening of litter-size-associated SNPs in NOX4, PDE11A and GHR genes of sheep. Animals. 2024;14:767. doi:10.3390/ani14050767

31.

Ren

Wang

Chu

Polymorphisms of the HRG, FETUB, and GUCY1A1 genes and their association with litter size in sheep. Arch Anim Breed. 2024;67:153-161. doi:10.5194/aab-67-153-2024

32.

Tao

Liu

Association analysis of polymorphisms in SLK, ARHGEF9, WWC2, GAB3, and FSHR genes with reproductive traits in different sheep breeds. Front Genet. 2024;15:1371872. doi:10.3389/fgene.2024.1371872

33.

Al-Barzinji

YM.

Molecular analysis of FecGH gene in Hamdani sheep breed in Iraqi Kurdistan region. Iraqi J Agric Sci. 2022;53:1.

34.

Al-Thuwaini

Al-Hadi

ABA

. Association of lamb sex with body measurements in single and twin on the Awassi ewes. Adv Anim Vet Sci. 2022;10:1849-1853. doi:10.17582/journal.aavs/2022/10.8.1849.1853

35.

Bingöl

Some growth, reproduction and lactation characteristics of hamdani sheep. Yuzuncu Yil Univ J Agric Sci. 2018;28:161-167. doi:10.29133/yyutbd.307464

36.

Ajafar

Kadhim

AL-Thuwaini

TM.

The reproductive traits of sheep and their influencing factors. Rev Agric Sci. 2022;10:82-89. doi:10.7831/ras.10.0_82

37.

Al-Thuwaini

TM.

The relationship of hematological parameters with adaptation and reproduction in sheep; a review study. Iraqi J Vet Sci. 2021;35:575-580. doi:10.33899/ijvs.2020.127253.1490

38.

Kriegsfeld

Ubuka

Bentley

Tsutsui

Seasonal control of gonadotropin-inhibitory hormone (GnIH) in birds and mammals. Front Neuroendocrinol. 2015;37:65-75. doi:10.1016/j.yfrne.2014.12.001

39.

Clarke

Bartolini

Conductier

Henry

BA.

Stress increases gonadotropin inhibitory hormone cell activity and input to GnRH cells in ewes. Endocrinology. 2016;157:4339-4350. doi:10.1210/en.2016-1513

40.

Rezazadeh

Shirazi

MRJ

Zamiri

, et al. Seasonal changes in hypothalamic gonadotropin inhibitory hormone expression in the paraventricular nucleus of chukar partridge (Alectoris chukar). Anim Reprod. 2018;14:452-458. doi:10.21451/1984-3143-AR893

41.

Fang

, et al. The effects of RFRP-3, the mammalian ortholog of GnIH, on the female pig reproductive axis in vitro. Mol Cell Endocrinol. 2013;372:65-72. doi:10.1016/j.mce.2013.03.015

42.

Al-Thuwaini

Al-Shuhaib

MBS

Hussein

ZM.

A novel T177P missense variant in the HSPA8 gene associated with the low tolerance of Awassi sheep to heat stress. Trop Anim Health Prod. 2020;52:2405-2416.

Reproduction of Awassi and Hamdani Sheep Is Associated With a Novel Missense SNP (p.24Ile>Thr) of the GnIH Gene

Abstract

Objectives:

Methods:

Results:

Conclusion:

Keywords

Introduction

Materials and Methods

Sheep population

Molecular analysis

Data analysis

Results

Genotyping, sequencing of GnIH genes, and genetic diversity

Association analysis

Discussion

Conclusions

Footnotes

Funding:

Declaration of conflicting interests:

Author Contributions

Ethical Approval

ORCID iD

Data Availability Statement

References