DEHP and Its Metabolite MEHP Alter the Insr and Glut4 Gene Expression by Blunting the Interaction of Transcription Factors in L6 Myotubes

Abstract

Endocrine-disrupting chemicals (EDCs) play an important role in the incidence of type-2 diabetes. Di-2-ethyl hexyl Phthalate (DEHP) is one of the endocrine-disrupting chemicals used as a plasticizer to impart flexibility and softness to plastic-containing materials. Mono-2-ethylhexyl Phthalate (MEHP), a DEHP’s primary metabolite, is preferentially absorbed once metabolized. A previous study from our laboratory showed that DEHP and MEHP altered the key proteins such as insulin receptor (INSR) and glucose transporter-4 (GLUT4) in L6 myotubes. In a sequel to the previous study, the present study hypothesized that DEHP and its metabolite MEHP may alter the Insr and Glut4 gene expression in L6 myotubes. Therefore, to find out the molecular mechanism behind the decreased INSR and GLUT4 protein levels in the previous study, the direct effect of DEHP and its metabolite MEHP in regulating Insr and Glut4 gene transcription in L6 myotubes was studied. The L6 myotubes were exposed to 50 and 100 μM DEHP and MEHP for 24 h, followed by insulin stimulation for 20 min. We observed decreased Insr and Glut4 mRNA levels in DEHP and MEHP-treated groups. Western blot data showed decreased protein levels of MEF2A and MyoD in treated groups. ChIP assay detected a decreased association of MEF2A and MyoD to the Glut4 gene promoter and HMGA1 to the Insr gene promoter. The study revealed that DEHP and MEHP diminished the Insr and Glut4 gene expression through weakened interaction of their transcription factors on the respective promoter.

Keywords

DEHP MEHP MyoD myocyte enhancer factor 2A (MEF2A)high mobility group A1 (HMGA1)

Introduction

Worldwide, it is estimated that 537 million individuals have diabetes, and the incidence of type-2 diabetes is increasing at an alarming rate.¹ Type-2 diabetes (T2D) is a chronic metabolic disorder characterized by insulin resistance (IR) and pancreatic β- cell dysfunction associated with microvascular and macrovascular complications.^2–4 Apart from classical risk factors, Endocrine disrupting chemicals (EDCs) play a vital role in developing T2D.⁵ Di-2-ethyl hexyl phthalate (DEHP) is an ester of phthalic acid used to impart structural flexibility and pliability to polyvinyl chloride (PVC)-containing material. They are found in cosmetics, medical devices, industrial paints, solvents, and food packaging materials.^6,7 Since DEHP is not covalently bound to the matrix, it can easily leach into the air, food, and water upon repeated usage. Due to its widespread usage, humans are constantly exposed to DEHP through ingestion, inhalation, and dermal exposure.^8,9 DEHP absorbed in the body is rapidly metabolized by lipases and esterases to mono-2-ethylhexyl phthalate (MEHP) and 2-ethylhexanol.^10,11

Numerous epidemiological studies have reported that increased urinary DEHP metabolites were associated with the incidence of IR, T2D, and obesity in childhood and adolescent period.^12–17 Consistent with the epidemiological studies, experimental studies demonstrated the negative association of DEHP in the development of glucose intolerances, IR, and T2D.^18–20 It is shown that DEHP mediates its toxic effect through the primary metabolite, MEHP. The toxicity potency of MEHP is higher than DEHP.^11,21,22 Studies from our laboratory have shown that DEHP significantly reduces the gene expression of Insr, INSR and GLUT4 protein levels associated with impaired glucose oxidation in Chang liver cells and L6 myotubes.^23,24 DEHP exposure alters the expression of genes involved in hepatic fatty acid oxidation and disrupts lipid homeostasis in the liver.^25,26 Gestational and lactational exposure to DEHP showed impaired pancreatic β-cell function, glucose and insulin intolerances, hyperglycemia, hyperinsulinemia, and altered insulin signaling molecules in F1 offspring, leading to the development of T2D.^19,27 MEHP exposure increases the incidence of obesity by promoting adipocyte differentiation and increase in adipogenic markers such as adipocyte protein2 (aP2), lipoprotein lipase (LPL), and peroxisome proliferator-activated receptor gamma γ (PPARγ) were observed.²⁸ We analyzed the direct effect of DEHP and its primary metabolite MEHP on insulin signaling and GLUT4 translocating molecules in L6 myotubes. DEHP and MEHP altered the insulin signaling and GLUT4 translocating molecules, decreasing the cytosolic and plasma membrane GLUT4 protein. DEHP and its metabolite MEHP exert a toxic effect on GLUT4 protein and translocation of GLUT4 from the cytosol to the membrane; the toxic potency of MEHP is higher than DEHP in L6 myotubes.²⁹

Skeletal muscle is the primary tissue responsible for insulin-mediated glucose disposal.³⁰ Skeletal muscle accounts for about 70–80% of glucose disposal and helps in glucose homeostasis.³¹ Insulin binds to the INSR on the surface of muscle cells, triggering the autophosphorylation of the INSR and activating the signaling cascade necessary for the translocation of GLUT4 protein from the cytosol to the membrane.³⁰ We observed decreased INSR and GLUT4 protein levels upon DEHP and MEHP exposure in L6 myotubes.²⁹ INSR belongs to the ligand-activated receptor-tyrosine kinase family and is essential in metabolic regulation. Studies have reported that defects in INSR protein leads to loss of insulin sensitivity and impaired activation of downstream signaling molecules.^32–34 GLUT4 is a significant protein in skeletal muscle responsible for insulin-mediated glucose uptake.³⁵ Dysregulation of GLUT4 trafficking and expression is associated with the primary development of T2D.³⁶ The molecular mechanism by which DEHP and its metabolite MEHP decreased INSR and GLUT4 protein in L6 myotubes remains obscure. Therefore, we hypothesized that DEHP and MEHP exposure may alter the Insr and Glut4 gene expression by hampering the interaction of the corresponding transcription factors with the promoter region.

Materials and Methods

Chemicals and Reagents

All chemicals and reagents used in the present study were of molecular biology and analytical grade (AR), and they were purchased from Amersham Biosciences Ltd., UK; Sigma Aldrich, USA; Sisco Research Laboratories, Mumbai, India; and Bio-Rad Laboratories Inc., Hercules, USA. DEHP, MEHP, Dulbecco’s modified Eagle medium (DMEM), and 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) were obtained from Sigma Aldrich, USA. Fetal Bovine Serum (FBS), 2% horse serum, 0.25 % Trypsin, and Phosphate-buffered Saline (PBS) were obtained from Gibco, USA. A super-signal Chemiluminescence kit was obtained from Thermo Scientific. High mobility group A1 (HMGA1) (sc-8982), MyoD (sc-377460), Myocyte enhancer factor 2A (MEF2A) (sc-293456), and TATA binding protein (TBP) (sc-204) antibodies were purchased from Santa Cruz Biotechnology Inc. (Dallas, Texas, USA). Horseradish peroxidase (HRP)-conjugated secondary antibodies (goat anti-rabbit IgG (sc-2004) and rabbit anti-mouse IgG (sc-358914) were obtained from Santa Cruz Biotechnology (Dallas, Texas, USA).

Cell Culture

L6 myoblast cells were procured from the National Centre for Cell Science (NCCS), Pune. Cells were grown in DMEM containing 2% horse serum for seven days at 37°C in a humidified 5% CO₂ atmosphere to complete the conversion of myoblasts to myotubes. The following experimental design was framed after ensuring the complete conversion of myoblasts (mononucleated) to myotubes (multinucleated) through Giemsa staining and probing the myogenin level in myotubes at day 7 through immunoblot analysis.

DEHP and MEHP Treatment

L6 myotubes were serum-starved for 4 hr and treated with DEHP and MEHP as mentioned below. Group I serves as a control or basal. Group II—L6 myotubes were exposed to 100 nM insulin alone for 20 min at the terminal. Both DEHP (Group III and IV) and MEHP (Group V and VI) were dissolved in Dimethyl Sulfoxide (DMSO), exposed at 50 and 100 μM concentrations for 24 h, and at the terminal end, L6 myotubes were stimulated with 100 nM insulin for 20 mins (i.e., at the 24th hour). After treatment, samples were collected and stored at −80°C for further analysis.

Justification of DEHP and MEHP Concentrations

The estimated daily exposure of the U.S. population to DEHP ranges from 5.8 to 19 μg/kg/day, whereas exposure through medical settings may exceed 167.9 mg/day.³⁷ MEHP concentration in infant plasma is 15.1 μg/ml (equal to 54.25 μM) and in maternal and umbilical cord blood samples (11.87 μg/ml (42.6 μM) and 9.94 μg/ml (35.7 μM), respectively).³⁸ In blood transfusions, the replacement blood DEHP levels have been detected to range from 10 to 650 μg/ml (about 25–1600 μM). Hemodialysis averaged over a year results in an average of 640 μg/kg bw/day DEHP exposure.³⁷ In patients with long-term exposure to DEHP-containing devices, the serum level of DEHP ranges from 70 to 80 μg/ml. In neonates, DEHP concentrations range from 13.2 to 84.9 μg/ml following PVC catheter exchange transfusions. In addition, patients undergoing intensive medical care usually have markedly higher MEHP levels than healthy people. Individuals undergoing specific medical procedures may be exposed to even higher levels (more than 100-fold) via plastic medical devices.³⁷ DEHP and MEHP concentrations (50 and 100 μM) were selected based on the inhibitory concentration (IC₅₀) value through MTT assay and general, occupational, and medical exposure.

Cell Viability Assay

Cell viability was determined by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. Cells seeded in a 96-well plate were treated with DEHP and MEHP at different concentrations (0, 25, 50, 100, 150, and 200 μM) for 24 h. Next, 10 μL MTT stock solution (5 mg/ml in PBS) was added to each well and then incubated for 4 h. DMSO was added to dissolve any deposited formazan. The optical density was measured at 570 nm with a spectrophotometer.

Real-Time Polymerase Chain Reaction (RT-PCR)

Cells were washed with PBS three times, and then total RNA was collected with TRIzol reagent (Invitrogen, USA). The concentration and purity of RNA were assessed spectrophotometrically by measuring the absorbance at 260/280 nm. Approximately 2 μg total RNA was reverse transcribed into cDNA, and real-time PCR was performed with a SYBR Green Real-time PCR kit (Takara, Japan). The PCR amplification was performed on the CFX 96 Real-Time Software System (Bio-Rad, CA, USA). The results were calculated by normalizing the relative expression of the gene of interest with Tata binding protein (TBP), and the results expressed as fold changes. Details of the primer sequences are listed in Table 1.

Table 1.

Primers Used for Real-Time PCR.

Gene	Primer Sequence (5’ – 3’)	Amplicon Size
	F-Forward Primer
	R-Reverse Primer
Insr	GCCATCCCGAAAGCGAAGATC (F)	225
Insr	TCTGGGGAGTCCTGATTGCAT (R)	225
Glut4	GGGCTGTGAGTGAGTGCTTTC (F)	155
Glut4	CAGCGAGGCAAGGCTAGA (R)	155
β-actin	CTGTGTGGATTGGTGGCTCT (F)	133
β-actin	GCTCAGTAACAGTCCGCCTA (R)	133

Nuclear Lysate Preparation

Nuclear lysate fractions from control and treated cells were prepared as Im et al³⁹ described. Briefly, cells were scraped with buffer (1 ml) containing 20 mM Tris/HCl (pH7.4), 10 mM EDTA, 10 mM EGTA, 0.25 M sucrose, proteases (1 M dithiothreitol and 0.1 M PMSF), 2 mM MgCl2 and 1x protease inhibitor cocktail (5 mM leupeptin, 5 mM pepstatin, 5 mM chymostatin and 5 mM aprotinin). The cell suspension was kept on ice for 10 min and centrifuged for 5 min at 2500× g at 4°C. The pellet was resuspended in 1 ml buffer, including protease inhibitor cocktail, and centrifuged at 1000× g for 5 min at 4°C. The pellet was again resuspended with buffer C (300 μl) [20 mM Hepes (pH 7.6), 1.5 mM MgCl2, 0.42 M NaCl, 2.5% glycerol, 1 mM EDTA, 1 mM EGTA, and protease inhibitor cocktail] and sonicated (20 pulse) and stored at −80°C for future use. MEF2A, MyoD, and HMGA1 levels were estimated by Western blot analysis, and TBP was a loading control in the nuclear lysate.

Western Blotting

Protein concentration was estimated using the method of Lowry et al,⁴⁰ using bovine serum albumin (BSA) as a standard. The lysate proteins (50 μg/lane) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10% gel) and transferred by electroblotting to polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories Inc.). The membranes were blocked with 5% non-fat dry milk and probed with the primary antibodies [HMGA1, MEF2A, MyoD] (1:1000). Following incubation, the blot was washed three times (5 min each with Tris-buffered saline containing Tween-20 (TBS-T)). After washing with TBS-T, membranes were incubated for 1 h with horseradish peroxidase-conjugated rabbit-anti-mouse or goat-anti-rabbit antibodies (1:5000) (GeNei, Bangalore, India). The specific signals and protein bands were captured using an enhanced chemiluminescence (ECL) detection system (Gel DocTM XR + System, Bio-Rad Laboratories, CA) and quantified using Quantity One image analysis software by Bio-Rad Laboratories, CA. Later, the membranes were incubated in a stripping buffer at 50°C for 30 min. After this, the membrane was reprobed using a TBP antibody (1:1000).

Chromatin Immunoprecipitation (ChIP) Assay

To check the binding of HMGA1 with the Insr promoter region and MEF2A with the Glut4 promoter, a ChIP assay was performed as recommended by the manufacturer’s instructions using EZ ChIP Chromatin Immunoprecipitation kit, Upstate Biotech (Merck Millipore). Briefly, the cells were washed with PBS and cross-linked with 1% formaldehyde for 15 min at room temperature. To quench the reaction, 125 mM glycine was added, gently mixed, and cells were incubated for 5 min. The cells were scraped with ice-cold PBS containing protease inhibitor and centrifuged at 700× g for 5 min at 4°C, and the resulting pellet was washed. The lysate was centrifuged, and the pellet was dissolved in 1 ml of SDS lysis buffer (with 5 μl of protease inhibitor). An aliquot of supernatant can be stored at −80°C. To check the chromatin shearing, lysates were sonicated on ice with 10 pulses for the 20 s (4–5 times) with 60 s ice rest, resulting in 200–1000 bp chromatin fragments. Once shearing was completed, samples were centrifuged at 12000× g at 4°C for 10 min, and the supernatants were stored. An aliquot of the supernatant was used as Input (positive control). A dilution buffer with protease inhibitor was added to the supernatants (10-fold). Then, 60 μl of protein G agarose (Millipore) was added to the mixture and kept on a rotating plate at 4°C for 1 h. Then it was centrifuged at 4000× g, and the supernatant was removed and stored for future use. To the supernatant, the primary antibody (MEF2A/HMG-1 antibody) or a normal rabbit IgG was incubated at 4°C overnight under rotation. Again, to the immunocomplexes, 60 μl of protein G agarose was added (Millipore) and incubated for 1 h at 4°C with rotation. Then the samples were washed with low-salt immune complex buffer (3–5 min, 1 wash), high-salt immune complex buffer (twice), LiCl immune complex buffer (1 wash), and twice with TE buffer containing 10 mM Tris HCl, pH 7.5; and 1 mM EDTA buffer. The precipitated chromatin was eluted using 200 μl of an elution buffer containing 20% sodium dodecyl sulfate (SDS), 1M NAHCO₃ and incubated for 15 min at room temperature (RT). Then, the mixture was centrifuged at 4000× g, and the supernatant was collected. The same step was repeated twice, and the supernatant was collected. Then, 5 M NaCl was added to the sample and incubated for 5 h at 65°C to reverse the cross-linking. Then, proteinase K and RNase A were added to the above mixture and incubated at 45°C for 2 h. The DNA was purified using phenol/chloroform. The interaction was checked using specific primers against the MEF2A and HMGA1 response elements in Glut4 and Insr promoter, respectively, and amplification was done. The amplified PCR product was assessed by 2% agarose gel electrophoresis and normalized with input DNA. The primer sequences are listed in Table 2.

Table 2.

Primers for ChIP Assay.

Gene - Protein	Primer Sequence (5′ – 3′)	Amplicon Size
	F-Forward Primer
	R-Reverse Primer
Insr - HMGA1	TAGGAACCTTGGAACTCTTTGGG (F)	170
Insr - HMGA1	AGCTTGTAAGTGCTGGGTTCG (R)	170
Glut4 - MEF2A	CATCTCCTTGTGGGAAGCGAGTC (F)	246
Glut4 - MEF2A	CTCCAGCAGGGTGACACAGAGCC (R)	246

Statistical Analysis

For each set of results, independent trials were repeated at least three times. The data were subjected to a one-way Analysis of Variance (ANOVA) followed by Students Newman–Keul’s (SNK) test to assess the significance between mean values of the control and experimental groups, using computer-based software Graph Pad Prism 5. The values are expressed as mean ± standard error of the mean (SEM), and P < 0.05 is considered statistically significant.

Results

The cell viability of L6 myotubes upon DEHP and MEHP exposure was determined by MTT assay. L6 myotubes were exposed to different concentrations of DEHP and MEHP (0, 25, 50, 100, 150, 200 μM). We observed that cell viability was significantly decreased below 50 % in 150 and 200 μM DEHP and MEHP concentrations. So, in the current study, 50 and 100 μM DEHP and MEHP concentrations were considered for further experimental analysis (Figure 1).

Figure 1.

Effect of DEHP and MEHP on the cell viability in L6 myotubes. Viability of the cells was measured by MTT assay. Each bar represents mean ± SEM of 3 separate experiments. Significance at P < .05. a: compared to Control.

DEHP and MEHP Decreased the Insr mRNA Level

The IR mRNA level is shown in Figure 1. Insr mRNA was significantly decreased in 100 μM DEHP and at both concentrations of MEHP compared to the control and insulin-alone treated groups. There was no change observed between the control and insulin-alone treated group (Figure 2).

Figure 2.

Effect of DEHP and MEHP on Insr mRNA in L6 myotubes. Each bar represents mean ± SEM of 3 separate experiments. Significance at P < .05. a: compared to Control; b: compared to Control + 100 nM insulin; c: compared to 50 μM DEHP; d: compared to 100 μM DEHP. Results are expressed as fold change from control.

DEHP and MEHP on HMGA1 Protein Level

Immunoblot detection of proteins in the nuclear fraction of L6 myotubes revealed unaltered protein levels of HMGA1 transcription factor controlling Insr expression in DEHP and MEHP-treated groups compared to the control (Figure 3).

Figure 3.

Effect of DEHP and MEHP on HMGA1 protein in L6 myotubes. Each bar represents mean ± SEM of 3 separate experiments.

DEHP and MEHP Hampered the Interaction Between the HMGA1-Insr Gene in L6 Myotubes

Through ChIP analysis, the interaction of HMGA-1 on the Insr promoter was studied. Compared to the control, the binding of HMGA1 on the Insr promoter was significantly decreased in DEHP and MEHP-treated groups at both concentrations (Figure 4).

Figure 4.

Effect of DEHP and MEHP on chromatin immunoprecipitation (ChIP) of HMGA1-Insr gene in L6 myotubes. The quantity of precipitated DNA was normalized to 1% of the input and each bar represents mean ± SEM of 3 separate experiments. Significance at P < .05. a: compared to Control; b: compared to Control + 100 nM insulin; c: compared to 50 μM DEHP.

DEHP and MEHP Debilitated Glut4 mRNA Level

Glut4 mRNA was significantly decreased in 100 μM DEHP and at both concentrations of MEHP compared to control and insulin-alone treated groups. No significant change was observed between the control and insulin-alone treated group (Figure 5).

Figure 5.

Effect of DEHP and MEHP on Glut4 mRNA in L6 myotubes. Each bar represents mean ± SEM of 3 separate experiments. Significance at P < .05. a: compared to Control; b: compared to Control + 100 nM insulin; c: compared to 50 μM DEHP; d: compared to 100 μM DEHP. Results are expressed as fold change from control.

Effect of DEHP and MEHP on MEF2A and MyoD Transcription Factors Regulating Glut4 gene Expression in L6 Myotubes

Immunoblot detection of proteins in the nuclear fraction showed decreased protein levels of MEF2A transcription factor at both concentrations of MEHP compared to the control. No significant change was observed in DEHP-treated groups compared to the control group. MyoD protein level significantly decreased in the 100 μM MEHP-treated group compared to the control group. There was no change in DEHP-treated groups compared to the control (Figure 6).

Figure 6.

Effect of DEHP and MEHP on MEF2A and MyoD proteins in L6 myotubes. Each bar represents mean ± SEM of 3 separate experiments. Significance at P < .05. a: compared to Control; b: compared to Control + 100 nM insulin; c: compared to 50 μM DEHP; d: compared to 100 μM DEHP; e: compared to 50 μM MEHP.

Effect of DEHP and MEHP on MEF2A- Glut4 Gene Interaction in L6 Myotubes

The binding of MEF2A on the Glut4 promoter region was significantly decreased in DEHP and MEHP-treated groups compared to the control (Figure 7).

Figure 7.

Effect of DEHP & MEHP on chromatin immunoprecipitation (ChIP) of MEF2A-Glut4 gene in L6 myotubes. The quantity of precipitated DNA was normalized to 1% of the input and each bar represents mean ± SEM of 3 separate experiments. Significance at P < .05. a: compared to Control; b: compared to Control + 100 nM insulin; c: compared to 50 μM DEHP; d: compared to 100 μM DEHP; e: compared to 50 μM MEHP.

Discussion

The current study aims to identify the reason behind the decreased INSR and GLUT4 protein levels upon DEHP and MEHP exposure in L6 myotubes. Insr mRNA was significantly reduced at 100 μM DEHP and at both concentrations of MEHP (50 and 100 μM). This may be one of the reasons for the decreased INSR protein level observed in our previous study.²⁹ To gain further insight into the reduced levels of Insr mRNA, we studied the transcription factor that regulates Insr. HMGA1 is one of the architectural transcription factors that bind to adenine-thymine (A-T) rich regions of DNA.⁴¹

The HMGA1 protein level in the nuclear fraction was unaltered in treated groups compared to the control. Though the HMGA1 protein levels were unaltered, DEHP and MEHP diminished the interaction of the HMGA1 transcription factor on the Insr promoter. The decreased interaction might be due to increased free fatty acid levels following exposure to DEHP and MEHP, as observed in trophoblast cells.⁴² Elevated free fatty acid increases the levels of PKCε, then the phosphorylated PKCε translocated to the nucleus, further it phosphorylates HMGA1, thereby inhibiting the binding of HMGA1 to the insulin promoter.^43,44 Phosphorylated HMGA1 has reduced DNA binding activity.^45–47 Based on the literature, it is proposed that increased free fatty acid production upon DEHP and MEHP exposure may have contributed to the impaired binding of HMGA1 to the Insr gene promoter. It is emphatic from the previous studies that impaired interaction of HMGA1 with Insr gene promoter region has resulted in a drastic reduction of Insr gene expression since HMGA1 could not transactivate and recruit transcription factors like Specificity protein1 (Sp1) and CCAAT-enhancer binding protein beta (cEBPβ) to initiate Insr gene expression.^48,49 To be concise, DEHP and MEHP do not impact the HMGA1 protein level; irrespective of the level of the HMGA1 transcription factor, the binding of HMGA1 on the Insr promoter is crucial for initiating Insr transcription.

Glut4 mRNA was significantly decreased in DEHP (100 μM) and MEHP (50 and 100 μM)-treated groups compared to the control. The decreased Glut4 mRNA may be one of the reasons for the decreased GLUT4 protein in the cytosol.²⁹ A series of transcription factors, such as MEF2A, MEF2D, and MyoD, regulate Glut4 gene transcription. The nuclear fraction of MEF2A protein level was significantly decreased at both concentrations of MEHP-treated groups compared to the control. The MyoD transcription factor decreased in the 100 μM MEHP-treated group compared to the control group. Loss of MEF2A isoform and reduced binding activity is associated with decreased Glut4 gene expression in skeletal muscle and heart of diabetic mice.⁵⁰ MEF2A and MyoD proteins decreased upon MEHP exposure, which may be the result of the direct effect of MEHP on transcription factors. Though DEHP does not affect the MEF2A and MyoD transcription factors, the Glut4 mRNA was decreased upon DEHP exposure. Therefore, to elucidate the molecular mechanism behind decreased Glut4 mRNA upon DEHP and MEHP exposure, a ChIP assay was performed to check the binding of transcription factors MEF2A and MyoD on the Glut4 promoter region.

MEF2A response element of the Glut4 gene promoter contains an AT-rich consensus sequence that initiates transcription.⁵¹ Interestingly, both DEHP and MEHP-treated groups registered a significant decrease in the binding of MEF2A with the Glut4 promoter. The previous study has suggested that DEHP exposure during gestation increased the HDAC2 expression in the gastrocnemius muscle of F1 offspring, which ultimately resulted in a tight chromatin structure where the chromatin is inaccessible to transcription factors.¹⁹ Histone deacetylation removes the acetyl groups and causes chromatin remodeling, resulting in a heterochromatin structure that recruits repressor protein (MEF2D) towards the promoter complex and hinders MEF2A interaction in human embryonic kidney and fibroblast cells.^52,53 In addition, the DNA methyltransferases (DnMTs) level was increased upon DEHP exposure, which silenced the Glut4 gene expression in F1 offspring.¹⁹ Despite the unaltered level of MEF2A, DEHP exposure impaired the interaction between MEF2A and the Glut4 gene promoter. A study has reported that DEHP binds to the AT-rich region of the calf thymus DNA.⁵⁴ Since the MEF2A response element has an AT-rich region in the Glut4 gene promoter, the binding of DEHP is likely to hamper the interaction between MEF2A and the Glut4 gene promoter. The MEF2A and MyoD protein levels were reduced upon MEHP exposure, which would have contributed to the decreased percentage of the interaction of the transcription factor MEF2A with the Glut4 gene promoter compared to DEHP. A study has shown the interaction of phthalic acid ester (DEHP) predominantly with thymine in DNA minor grooves.⁵⁵ However, further study is required to understand better the differential toxic effect of DEHP and its primary metabolite MEHP on Insr and Glut4 gene expression.

Limitations of the Present Study

We studied the basal Insr and Glut4 transcriptional activity after exposing L6 myotubes to DEHP and MEHP, followed by insulin stimulation for 20 min. Further experiments should focus on exposing L6 myotubes to insulin for 4 to 5 h to study the insulin-mediated Insr and Glut4 transcription upon DEHP and MEHP exposure. Future studies must elucidate the molecular mechanism behind the decreased MEF2A and HMGA-1 transcription factors upon DEHP and MEHP exposure. We did not include the non-insulin-stimulated DEHP and MEHP control groups in the current study due to many (six) groups and a previous study from our laboratory has shown that DEHP (without insulin) exposure (50 and 100 μM) concentrations significantly decreased the INSR and GLUT4 proteins compared to the control. Future studies are warranted to study the effect of DEHP and MEHP during non-insulin-stimulated conditions.

Conclusion

DEHP and its metabolite MEHP exposure decreased the Insr and Glut4 mRNA, which is mediated by the diminished interaction of HMGA1 and MEF2A transcription factors with the promoter region of the Insr and Glut4 genes, respectively. Despite DEHP and MEHP exerting their toxic effect on genes regulating glucose disposal, the toxicity potential of MEHP is greater than that of DEHP.

Footnotes

Author Contributions

Viswanathan, Mangala Priya contributed to conception and design, contributed to acquisition, analysis, and interpretation, drafted manuscript, and critically revised manuscript; Mullainadhan, Vigneswari contributed to analysis and interpretation and drafted manuscript; Karundevi, Balasubramanian contributed to conception and design, contributed to analysis and interpretation, drafted manuscript, and critically revised manuscript. All authors gave final approval and agree to be accountable for all aspects of work ensuring integrity and accuracy.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the DST PURSE Phase II Programme, which provided Ms. V. Mangala Priya with a Junior Research Fellowship (JRF) and financial assistance to the Department of Endocrinology through the UGC-SAP-DSA program in the form of infrastructural facilities.

ORCID iD

Balasubramanian Karundevi

References

International Diabetes Federation . IDF Diabetes Atlas. 10th ed. Brussels, Belgium: International Diabetes Federation; 2021. Available at: https://www.diabetesatlas.org

Ashcroft

Rorsman

. Diabetes mellitus and the β cell: the last ten years. Cell. 2012;148(6):1160-1171. doi:10.1016/j.cell.2012.02.010

Deshpande

Harris-Hayes

Schootman

. Epidemiology of diabetes and diabetes-related complications. Phys Ther. 2008;88(11):1254-1264. doi:10.2522/ptj.20080020

Rahman

Ismail

Rashid

. Diabetes-associated macrovasculopathy: pathophysiology and pathogenesis. Diabetes Obes Metab. 2007;9(6):767-780. doi:10.1111/j.1463-1326.2006.00655.x

Song

Chou

Baecker

, et al. Endocrine-disrupting chemicals, risk of type 2 diabetes, and diabetes-related metabolic traits: a systematic review and meta-analysis. J Diabetes. 2016;8(4):516-532. doi:10.1111/1753-0407.12325

Heudorf

Mersch-Sundermann

Angerer

. Phthalates: toxicology and exposure. Int J Hyg Environ Health. 2007;210(5):623-634. doi:10.1016/j.ijheh.2007.07.011

Koniecki

Wang

Moody

Zhu

. Phthalates in cosmetic and personal care products: concentrations and possible dermal exposure. Environ Res. 2011;111(3):329-336. doi:10.1016/j.envres.2011.01.013

Koch

Lorber

Christensen

Pälmke

Koslitz

Brüning

. Identifying sources of phthalate exposure with human biomonitoring: results of a 48h fasting study with urine collection and personal activity patterns. Int J Hyg Environ Health. 2013;216(6):672-681. doi:10.1016/j.ijheh.2012.12.002

Weiss

Gustafsson

Gerde

Bergman

Lindh

Krais

. Daily intake of phthalates, MEHP, and DINCH by ingestion and inhalation. Chemosphere. 2018;208:40-49. doi:10.1016/j.chemosphere.2018.05.094

10.

Albro

Lavenhar

. Metabolism of di(2-ethylhexyl)phthalate. Drug Metab Rev. 1989;21(1):13-34. doi:10.3109/03602538909029953

11.

Koch

Preuss

Angerer

. Di(2-ethylhexyl)phthalate (DEHP): human metabolism and internal exposure-- an update and latest results. Int J Androl. 2006;29(1):155-185. doi:10.1111/j.1365-2605.2005.00607.x

12.

Stahlhut

van Wijngaarden

Dye

Cook

Swan

. Concentrations of urinary phthalate metabolites are associated with increased waist circumference and insulin resistance in adult U.S. males. Environ Health Perspect. 2007;115(6):876-882. doi:10.1289/ehp.9882

13.

Hatch

Nelson

Qureshi

, et al. Association of urinary phthalate metabolite concentrations with body mass index and waist circumference: a cross-sectional study of NHANES data, 1999-2002. Environ Health. 2008;7:27. doi:10.1186/1476-069X-7-27

14.

Trasande

Sathyanarayana

Spanier

Trachtman

Attina

Urbina

. Urinary phthalates are associated with higher blood pressure in childhood. J Pediatr. 2013;163(3):747-753.e1. doi:10.1016/j.jpeds.2013.03.072

15.

Smerieri

Testa

Lazzeroni

, et al. Di-(2-ethylhexyl) phthalate metabolites in urine show age-related changes and associations with adiposity and parameters of insulin sensitivity in childhood. PLoS One. 2015;10(2):e0117831. doi:10.1371/journal.pone.0117831

16.

Tsai

Lin

Hou

, et al. Effects of high di(2-ethylhexyl) phthalate (DEHP) exposure due to tainted food intake on pre-pubertal growth characteristics in a Taiwanese population. Environ Res. 2016;149:197-205. doi:10.1016/j.envres.2016.05.005

17.

Duan

Sun

Han

Chen

. Association between phthalate exposure and glycosylated hemoglobin, fasting glucose, and type 2 diabetes mellitus: a case-control study in China. Sci Total Environ. 2019;670:41-49. doi:10.1016/j.scitotenv.2019.03.192

18.

Martinelli

Mocchiutti

Bernal

. Effect of di(2-ethylhexyl) phthalate (DEHP) on lipolysis and lipoprotein lipase activities in adipose tissue of rats. Hum Exp Toxicol. 2010;29(9):739-745. doi:10.1177/0960327110361750

19.

Rajesh

Balasubramanian

. Phthalate exposure in utero causes epigenetic changes and impairs insulin signalling. J Endocrinol. 2014;223(1):47-66. doi:10.1530/JOE-14-0111

20.

Zhao

, et al. Integrated metabolomics and transcriptomics reveal di(2-ethylhexyl) phthalate-induced mitochondrial dysfunction and glucose metabolism disorder through oxidative stress in rat liver. Ecotoxicol Environ Saf. 2021;228:112988. doi:10.1016/j.ecoenv.2021.112988

21.

Wang

Craig

Basavarajappa

Hafner

Flaws

. Mono-(2-ethylhexyl) phthalate induces oxidative stress and inhibits growth of mouse ovarian antral follicles. Biol Reprod. 2012;87(6):152. doi:10.1095/biolreprod.112.102467

22.

Zhou

Guo

Wang

, et al. Mono-(2-ethylhexyl) phthalate (MEHP)-induced telomere structure and function disorder mediates cell cycle dysregulation and apoptosis via c-myc and its upstream transcription factors in a mouse spermatogonia-derived (GC-1) cell line. Toxics. 2023;11(5):448. doi:10.3390/toxics11050448

23.

Rengarajan

Parthasarathy

Anitha

Balasubramanian

. Diethylhexyl phthalate impairs insulin binding and glucose oxidation in chang liver cells. Toxicol In Vitro. 2007;21(1):99-102. doi:10.1016/j.tiv.2006.07.005

24.

Rajesh

Balasubramanian

. Di(2-ethylhexyl)phthalate exposure impairs insulin receptor and glucose transporter 4 gene expression in L6 myotubes. Hum Exp Toxicol. 2014;33(7):685-700. doi:10.1177/0960327113506238

25.

Liang

Zhang

Yan

Luan

. Di-2-ethylhexyl phthalate disrupts hepatic lipid metabolism in obese mice by activating the LXR/SREBP-1c and PPAR-α signaling pathways. Sci Total Environ. 2024;914:169919. doi:10.1016/j.scitotenv.2024.169919

26.

Tian

Shang

, et al. Differential disruption of glucose and lipid metabolism induced by phthalates in human hepatocytes and white adipocytes. Toxics. 2024;12(3):214. doi:10.3390/toxics12030214

27.

Rajagopal

Bhaskaran

Karundevi

. Maternal di-(2-ethylhexyl) phthalate exposure alters hepatic insulin signal transduction and glucoregulatory events in rat F₁ male offspring. J Appl Toxicol. 2019;39(5):751-763. doi:10.1002/jat.3764

28.

Hao

Cheng

Xia

. The endocrine disruptor mono-(2-ethylhexyl) phthalate promotes adipocyte differentiation and induces obesity in mice. Biosci Rep. 2012;32(6):619-629. doi:10.1042/BSR20120042

29.

Viswanathan

Mullainadhan

Chinnaiyan

Karundevi

. Effects of DEHP and its metabolite MEHP on insulin signalling and proteins involved in GLUT4 translocation in cultured L6 myotubes. Toxicology. 2017;386:60-71. doi:10.1016/j.tox.2017.05.005

30.

Merz

Thurmond

. Role of skeletal muscle in insulin resistance and glucose uptake. Compr Physiol. 2020;10(3):785-809. doi:10.1002/cphy.c190029

31.

DeFronzo

Tripathy

. Skeletal muscle insulin resistance is the primary defect in type 2 diabetes. Diabetes Care. 2009;32(Suppl 2):S157-S163. doi:10.2337/dc09-S302

32.

Chen

Huang

Chen

. Insulin receptor trafficking: consequences for insulin sensitivity and diabetes. Int J Mol Sci. 2019;20(20):5007. doi:10.3390/ijms20205007

33.

Wang

Zhou

Palyha

. Restoration of insulin receptor improves diabetic phenotype in T2DM mice. JCI Insight. 2019;4(15):e124945. doi:10.1172/jci.insight.124945

34.

Goldfine

. The insulin receptor: molecular biology and transmembrane signaling. Endocr Rev. 1987;8(3):235-255. doi:10.1210/edrv-8-3-235

35.

Bryant

Govers

James

. Regulated transport of the glucose transporter GLUT4. Nat Rev Mol Cell Biol. 2002;3(4):267-277. doi:10.1038/nrm782

36.

Stöckli

Fazakerley

James

. GLUT4 exocytosis. J Cell Sci. 2011;124(Pt 24):4147-4159. doi:10.1242/jcs.097063

37.

Kavlock

Boekelheide

Chapin

, et al. NTP Center for the Evaluation of Risks to Human Reproduction: phthalates expert panel report on the reproductive and developmental toxicity of di(2-ethylhexyl) phthalate. Reprod Toxicol. 2002;16(5):529-653. doi:10.1016/s0890-6238(02)00032-1

38.

Sjöberg

Bondesson

Sedin

Gustafsson

. Exposure of newborn infants to plasticizers. Plasma levels of di-(2-ethylhexyl) phthalate and mono-(2-ethylhexyl) phthalate during exchange transfusion. Transfusion. 1985;25(5):424-428. doi:10.1046/j.1537-2995.1985.25586020115.x

39.

Kwon

Kim

Ahn

. Regulation of glucose transporter type 4 isoform gene expression in muscle and adipocytes. IUBMB Life. 2007;59(3):134-145. doi:10.1080/15216540701313788

40.

Lowry

Rosebrough

Farr

Randall

. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193(1):265-275.

41.

Bustin

Reeves

. High-mobility-group chromosomal proteins: architectural components that facilitate chromatin function. Prog Nucleic Acid Res Mol Biol. 1996;54:35-100. doi:10.1016/s0079-6603(08)60360-8

42.

Cook

Knipp

. Effects of di-(2-ethylhexyl)-phthalate (DEHP) and its metabolites on fatty acid homeostasis regulating proteins in rat placental HRP-1 trophoblast cells. Toxicol Sci. 2005;84(2):287-300. doi:10.1093/toxsci/kfi083

43.

Bhattacharya

Dey

Roy

. Molecular mechanism of insulin resistance. J Biosci. 2007;32(2):405-413. doi:10.1007/s12038-007-0038-8

44.

Dey

Bhattacharya

Roy

Bhattacharya

. Fatty acid represses insulin receptor gene expression by impairing HMGA1 through protein kinase Cepsilon. Biochem Biophys Res Commun. 2007;357(2):474-479. doi:10.1016/j.bbrc.2007.03.183

45.

Reeves

Beckerbauer

. HMGI/Y proteins: flexible regulators of transcription and chromatin structure. Biochim Biophys Acta. 2001;1519(1-2):13-29. doi:10.1016/s0167-4781(01)00215-9

46.

Edberg

Adkins

Springer

Reeves

. Dynamic and differential in vivo modifications of the isoform HMGA1a and HMGA1b chromatin proteins. J Biol Chem. 2005;280(10):8961-8973. doi:10.1074/jbc.M407348200

47.

Sgarra

Rustighi

Tessari

, et al. Nuclear phosphoproteins HMGA and their relationship with chromatin structure and cancer. FEBS Lett. 2004;574(1-3):1-8. doi:10.1016/j.febslet.2004.08.013

48.

Foti

Iuliano

Chiefari

Brunetti

. A nucleoprotein complex containing Sp1, C/EBP beta, and HMGI-Y controls human insulin receptor gene transcription. Mol Cell Biol. 2003;23(8):2720-2732. doi:10.1128/MCB.23.8.2720-2732.2003

49.

Dey

Mukherjee

Basu

, et al. Inhibition of insulin receptor gene expression and insulin signaling by fatty acid: interplay of PKC isoforms therein. Cell Physiol Biochem. 2005;16(4-6):217-228. doi:10.1159/000089847

50.

Thai

Guruswamy

Cao

Pessin

Olson

. Myocyte enhancer factor 2 (MEF2)-binding site is required for GLUT4 gene expression in transgenic mice. Regulation of MEF2 DNA binding activity in insulin-deficient diabetes. J Biol Chem. 1998;273(23):14285-14292. doi:10.1074/jbc.273.23.14285

51.

Andrés

Cervera

Mahdavi

. Determination of the consensus binding site for MEF2 expressed in muscle and brain reveals tissue-specific sequence constraints. J Biol Chem. 1995;270(40):23246-23249. doi:10.1074/jbc.270.40.23246

52.

Zhao

Sternsdorf

Bolger

Evans

Yao

. Regulation of MEF2 by histone deacetylase 4- and SIRT1 deacetylase-mediated lysine modifications. Mol Cell Biol. 2005;25(19):8456-8464. doi:10.1128/MCB.25.19.8456-8464.2005

53.

Grégoire

Xiao

Nie

, et al. Histone deacetylase 3 interacts with and deacetylates Myocyte enhancer factor 2. Mol Cell Biol. 2007;27(4):1280-1295. doi:10.1128/MCB.00882-06

54.

Pan

Zhang

Gong

. Characterization of the groove binding between di-(2-ethylhexyl) phthalate and calf thymus DNA. Int J Biol Macromol. 2017;101:736-746. doi:10.1016/j.ijbiomac.2017.03.136

55.

Cheng

Qin

Yang

, et al. Non-covalent binding interaction between phthalic acid esters and DNA. Environ Int. 2022;161:107095. doi:10.1016/j.envint.2022.107095