Sage Journals: Discover world-class research

Abstract

Background

Coronary heart disease (CHD) has a relatively high mortality rate. This study aims to explore the expression level of miR-3150b-3p in CHD and its potential mechanisms of action.

Method

This study collected basic information from 120 hypertensive patients and 110 CHD patients. Serum levels of miR-3150b-3p were quantified using qRT-PCR. The diagnostic value of miR-3150b-3p was evaluated through the ROC curve, and Pearson analysis tested its correlation with CHD severity. In vitro, ox-LDL was used to induce HVSMCs. Cell viability was assessed using the CCK-8 assay, inflammatory factors were measured by ELISA, and oxidative stress levels were evaluated by detecting superoxide dismutase activity and malondialdehyde content. miR-3150b-3p-ARL5B interaction was verified by luciferase assay and RIP.

Results

Serum miR-3150b-3p is up-regulated in CHD patients, correlates with disease severity. ROC curve demonstrated that miR-3150b-3p has robust diagnostic value. In vitro experiments demonstrated that the miR-3150b-3p inhibitor significantly reduced ox-LDL-induced inflammatory factors, increased SOD activity, and decreased MDA content. In addition, miR-3150b-3p was verified to target ARL5B.

Conclusions

The level of miR-3150b-3p in the serum of CHD patients is significantly elevated and positively correlated with disease-related indicators of CHD. miR-3150b-3p can regulate cellular functions and targetARL5B, providing a new potential target for the early diagnosis and treatment of CHD.

Keywords

coronary heart disease miR-3150b-3p ARL5B inflammation

Introduction

Coronary heart disease (CHD) is a cardiovascular condition caused by the narrowing of the coronary arteries, which can lead to angina or myocardial infarction.^1,2 CHD has become a global issue and is one of the leading causes of death, especially in developed countries.³ Hypertension is also a significant risk factor for cardiovascular diseases, exerting long-term effects on the cardiovascular system.⁴ Currently, the diagnosis of CHD primarily relies on symptoms, electrocardiograms, and angiography, while treatment often involves medication, intervention, or surgery,⁵ However, these methods still have limitations in early diagnosis, disease prognosis, and long-term efficacy.⁶ The pathological basis of CHD is atherosclerosis, characterized by lipid deposition and smooth muscle cell proliferation.⁷ The abnormal activity of these vascular smooth muscle cells (VSMCs) can lead to plaque rupture, resulting in acute coronary syndrome.⁸ For instance, miR-18a-5p⁹ and miR-30a-3p¹⁰ may play a significant role in disease progression by regulating VSMCs and could serve as potential therapeutic targets.

Therefore, in-depth research into the mechanisms of VSMCs is of significant importance for understanding the pathogenesis of CHD and developing new therapeutic strategies.

MicroRNA is a small non-coding RNA that^11–13 regulates cell proliferation, differentiation, apoptosis, and stress responses,¹⁴while CHD involves processes such as inflammation, lipid metabolism disorders, vascular endothelial dysfunction, and extracellular matrix remodeling.¹⁵ Current research on miR-3150b-3p primarily focuses on cervical cancer¹⁶ and lung squamous cell carcinoma.¹⁷ However, cardiac metastasis from cervical cancer and lung squamous cell carcinoma may affect cardiac function, indirectly correlating with the risk of CHD.^17–19 There are also literature reports indicating that RRAS2-hsa-miR-3150b-3p-ILF3-AS1 signaling axis plays a crucial role in atherosclerosis-related ischemic stroke.²⁰ miR-3150b-3p shows promise as a biomarker for cardiovascular risk assessment in patients with renal failure, but its mechanisms in disease and inflammation still require in-depth investigation.²¹ Therefore, this study hypothesizes that miR-3150b-3p may play a significant role in CHD and could potentially serve as a diagnostic marker or therapeutic target. However, its specific functions and mechanisms require further in-depth investigation.

ARL5B is a crucial small GTPase involved in maintaining intracellular homeostasis,²² and its dysfunction may disrupt Golgi apparatus function, increasing the risk of cardiovascular diseases.²³ The role of ARL5B in the blood-brain barrier suggests its potential involvement in the regulation of membrane trafficking and tight junctions.²⁴ Based on the above background, this study hypothesizes that miR-3150b-3p may influence cardiovascular cell function by targeting ARL5B, thereby playing a potential role in the pathogenesis of CHD, and further validation of this mechanism is conducted.

Given the current gaps and challenges in the research on miR-3250b-3p and ARL5B in CHD and hypertension. This article aims to delve into the clinical value of miR-3150b-3p in CHD and its regulatory role in VSMCs, with the goal of providing new theoretical foundations and potential targets for the diagnosis and treatment of CHD.

Materials and Methods

Research Subjects and Information Collection

This study enrolled 120 patients with hypertension (HTN, control group) and 110 patients with CHD who visited West China Hospital of Sichuan University from April 2024 to December 2024 and voluntarily signed informed consent forms. Inclusion criteria for the hypertension group: Untreated office blood pressure ≥140 mm Hg systolic or ≥90 mm Hg diastolic, confirmed on three separate days; Coronary angiography shows normal coronary arteries. Exclusion criteria for the hypertension group: Diagnosis of malignant tumors such as solid tumors or hematologic malignancies; Presence of hepatic or renal insufficiency; suffering from autoimmune diseases or infectious diseases; Patients with diabetes. Inclusion criteria for the CHD group: presence of typical angina symptoms, manifested as paroxysmal oppressive pain behind the sternum; The electrocardiogram shows ischemic changes, or myocardial ischemia episodes are recorded by ambulatory electrocardiogram monitoring; Coronary angiography or coronary CTA shows stenosis of ≥50% in the main branches of the coronary arteries. The exclusion criteria for CHD are consistent with those for hypertensive patients. All participating patients were first subjected to medical history collection and medical evaluation, excluding the aforementioned comorbidities, and had not taken any medications that might affect the expression of miR-3150b-3p or oxidative stress status within the three months prior to the commencement of the study.

Collect the basic information of the two study groups, including key indicators. Simultaneously, the Gensini score was calculated to assess the severity of coronary artery lesions.

Expression Detection of miR-3150b-3p

Take 5 mL of fasting venous blood, let it stand for 30 min, then centrifuge to obtain the upper serum, aliquot into RNase-free tubes, and store at −80°C. Total RNA was isolated using an RNA extraction kit (TIANGEN, Beijing, Biotech, China), and then the purified RNA was converted to cDNA with the HiScript II miRNA RT kit (Vazyme, Nanjing, China). Using miRNA-specific primers and probes, qRT-PCR detection was performed with three replicate wells for each sample. The primers used in reverse transcription and real-time quantitative PCR are as follows: The reverse transcription primer for miR-3150b-3p: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGAACCAA; U6 reverse transcription primer: 5′ AAAATATGGAACGCTTCACGAATTTG 3′; miR-3150b-3p (Forward Primer: 5′-TGAGGAGATCGUCGAGGTTGG-3′; Reverse Primer: 5′-TGGTGTCGTGGAGTCG-3′); U6 (Forward Primer: 5′-CTCGCTTCGGCAGCACA-3′; Reverse Primer: 5′-AACGCTTCACGAATTTGCGT-3′) ; ARL5B (Forward Primer: 5′-AGTGGGACTGGATAATGCAGGG-3′; Reverse Primer: 5′-ATCGCAGAGACTCCTGACCACC-3′); GAPDH (forward: 5′-GAAGGTGAAGGTCGGGAGTC-3′, reverse: 5′-GAAGATGGTGATGGGATTTC-3′). Among them, U6 and GAPDH were used as internal reference genes for miRNA and mRNA analysis, respectively, as their expression stability in serum has been validated by both literature and preliminary experiments,^25,26 and quantification was performed using the 2^−ΔΔCt method.

Cell Culture and ox-LDL Induction

Human vascular smooth muscle cells (HVSMCs) from ATCC (Manassas, VA) were cultured in RPMI-1640 with 10% FBS and 1% penicillin-streptomycin at 37 °C, 5% CO₂, with routine medium changes; logarithmic-phase cultures were used for experiments. Set up three independent cell culture experiments, with 5-8 replicate wells per group in each experiment. An atherosclerosis model was created in vitro with ox-LDL (50 μg/mL)²⁷: cells received either ox-LDL-supplemented or control medium. Incubate in the same incubator for 24-48 h to induce atherosclerosis-related changes in the cells.

Cell Transfection and Functional Analysis

Divide ox-LDL-induced HVSMCs into two groups: the negative control group and the miR-3150b-3p inhibitor group. Lipofectamine™ 3000 (Invitrogen, USA) mediated transfection per manufacturer instructions. When the cells reach 70%-80% confluency, seed them into 96-well plates. Mix the miR-3150b-3p inhibitor or negative control with the liposome transfection reagent, add serum-free medium, and incubate at room temperature for 15-20 min to form complexes. Then add the mixture to the cell plate and gently shake to ensure thorough contact. After transfection for 6 h, replace with complete medium and culture for another 48 h before experiments. The transfection efficiency of this study was evaluated by qRT-PCR, achieving 85%, indicating successful transfection.

Cell Viability Detection

The effect of miR-3150b-3p on the viability of ox-LDL-induced HVSMCs was analyzed using CCK-8. Seed transfected cells into a 96-well plate. At 0, 24, 48, and 72 h, add 10 μL CCK-8, incubate 2-4 h, then measure OD at 450 nm. Each sample was set up with 5-8 replicates, and the experiment was repeated 3 times.

Inflammatory Factor Testing

After transfection, the cells were collected, the supernatant was harvested, and the secretion of inflammatory factors by HVSMCs induced by ox-LDL was detected via ELISA (R&D Systems). During the experiment, strictly follow the instructions of the kit, add standards and samples to the enzyme-linked plate, incubate, wash, and then add enzyme-labeled reagents for color development. Finally, the OD values at the corresponding wavelengths were assayed using an ELISA reader, and the concentrations of each inflammatory factor were calculated based on the standard curve.

Oxidative Stress Detection

The SOD and MDA assay kits from Beyotime Biotechnology (Jiangsu, China) were used to measure the activity and content. Collect cells to extract proteins, measure protein concentration, add reagents for incubation and color development, then perform the assay to calculate SOD activity and MDA content.

Target Gene Prediction and Validation

Predict the downstream target genes of miR-3150b-3p through the TargetScan database and analyze its binding sites with potential target genes. The interaction between miR-3150b-3p and its target gene in HVSMCs was evaluated using the luciferase reporter assay. The ARL5B 3′UTR fragment was cloned into the luciferase reporter gene vector to construct the WT plasmid, while the MT plasmid was constructed by mutating the miR-3150b-3p binding site. The miR-3150b-3p mimic or negative control was co-transfected with WT or MT plasmids into HVSMCs. 48 h post - transfection, luciferase activity was assayed.

The experiment was conducted with the Magna RIP™ Kit (Millipore) following the manufacturer's instructions. Collect the transfected HVSMCs, lyse them with RIP buffer, and incubate the lysate with magnetic beads and specific antibodies (anti-AGO2) for immunoprecipitation. Afterwards, the magnetic beads were treated with proteinase K to extract the bound RNA, and the levels of miR-3150b-3p and ARL5B were detected by RT-qPCR.

Statistical Analysis

Data were analyzed via SPSS 26.0 and GraphPad Prism. Values are presented as mean ± SD. The specific dataset analyzed in this study includes baseline characteristics (LDL-C, HDL-C, CK-MB, Gensini score, and cTnI), miR-3150b-3p expression levels, inflammatory factors, oxidative stress indicators, and target gene validation results. Two-group comparisons used independent t-tests, and multi-group comparisons used ANOVA. Correlation analysis used Pearson's test. Significance was set at P < .05. Prior to data analysis, the Shapiro-Wilk normality test was conducted to confirm that the data followed a Gaussian distribution (P > .05). For categorical variables such as gender, smoking history, alcohol consumption history, and diabetes history, the chi-square test was used for statistical comparison. This study emphasizes data integrity and authenticity, retaining all original data, including outliers. Because these outliers may reflect specific physiological states, individual differences, or particular stages of diseases, they contribute to a comprehensive representation of the characteristics of the study population. Deleting or adjusting outliers may introduce subjective bias, affecting the objectivity and generalizability of the results.

Results

Baseline Characteristics

According to the baseline data (Table 1), there were significant differences in LDL-C (3.42 ± 0.96 vs 2.88 ± 0.96) and HDL-C (1.26 ± 0.11 vs 1.34 ± 0.09) levels between the CHD group and the hypertension group, with P < .001. Indicators such as CK-MB, Gensini score, and cTnI were only detected in the CHD group, with values of 66.02 ± 4.65, 57.03 ± 3.78, and 1.75 ± 0.18, respectively. However, there were no statistically significant differences in age, sex ratio, BMI, smoking, drinking, TG, and TC levels between the two groups of patients (all P > .05).

Table 1.

Summary of Baseline Characteristics.

Clinical Characteristics	HTN Patients(n = 120)	CHD Patients(n = 110)	P-Value
Age (years)	58.15 ± 3.27	58.36 ± 4.05	.665
Sex	82/38	83/27	.233
BMI (kg/m2)	22.1 ± 1.74	22.56 ± 3.26	.181
Smoking	33/87	23/87	.247
Drinking	37/83	30/80	.555
Diabetes mellitus (Y/N)	35/85	46/64	.045
TG (mmol/L)	1.31 ± 0.11	1.41 ± 0.74	.121
TC (mmol/L)	4.88 ± 1.48	4.89 ± 1.46	.949
LDL-C (mmol/L)	2.88 ± 0.96	3.42 ± 0.96	<.001
HDL-C (mmol/L)	1.34 ± 0.09	1.26 ± 0.11	<.001
CK-MB (U/L)	-	66.02 ± 4.65	-
Gensini score	-	57.03 ± 3.78	-
cTnI (ng/mL)	-	1.75 ± 0.18	-

Note: HTN, hypertension; CHD, coronary heart disease; BMI, body mass index; TG, triglyceride; TC, total cholesterol; LDL-C, low-density lipoprotein cholesterol; HDL-C, high-density lipoprotein cholesterol; CK-MB, creatine kinase-MB; cTnI, cardiac troponin I. M/F, male/female; Y/N, yes/no. The date was presented as mean ± SD), or percentage (/).

Expression Characteristics and Correlation Analysis of miR-3150b-3p in CHD

Compared to the hypertension group (1.00 ± 0.12), miR-3150b-3p in CHD was markedly increased (Figure 1A, 1.18 ± 0.11, P < .0001). ROC curve analysis demonstrated that miR-3150b-3p exhibited good diagnostic efficacy for CHD, with an AUC of 0.880 (95% CI: 0.657-0.812, P < .0001). At the optimal diagnostic threshold of 1.075, the sensitivity reached 82.7%, and the specificity was 74.2% (Figure 1B). Furthermore, miR-3150b-3p showed significant positive correlations with LDL-C (r = 0.829, Figure 1C), CK-MB (r = 0.812, Figure 1E), Gensini score (r = 0.781, Figure 1F), and cTnI (r = 0.758, Figure 1G), P < .0001. miR-3150b-3p was negatively correlated with HDL-C (r = -0.840, Figure 1D).

Figure 1.

The Expression of miR-3150b-3p in CHD and its Relationship with Clinical Indicators. (A) the Expression of miR-3150b-3p in the Hypertension and CHD Groups (****p < .0001); (B) Evaluation of the Diagnostic Efficacy of miR-3150b-3p; miR-3150b-3p Showed Significant Positive Correlations with LDL-C (C), HDL-C (D), CK-MB (E), Gensini Score (F), and CTnI (G),****P < .0001.

Multifactorial Logistic Regression Analysis of Risk Factors for CHD

The results of the multifactorial logistic regression analysis revealed that LDL-C (OR = 2.35, 95% CI = 1.15-4.78, P < .001), HDL-C (OR = 0.19, 95% CI = 2.58-10.82, P < .001), and miR-3150b-3p (OR = 11.80, 95% CI = 5.78-24.06, P < .001) were significant predictors of CHD occurrence (Table 2). The associations of age, gender, BMI, TG, and TC with CHD were relatively weak (P > .05).

Table 2.

Logistic Regression Analysis Predicts Risk Factors for CHD Occurrence.

Clinical Characteristics	Multivariate Logistics Analysis
Clinical Characteristics	OR	95% CI	P-Value
Age (years)	1.04	(0.52–2.08)	.920
Sex	1.33	(0.59–2.97)	.495
BMI (kg/m2)	1.57	(0.78–3.16)	.203
TG (mmol/L)	1.97	(0.97–3.99)	.097
TC (mmol/L)	1.82	(0.9–3.69)	.019
LDL-C (mmol/L)	2.35	(1.15–4.78)	<.001
HDL-C (mmol/L)	0.19	(0.09–0.39)	<.001
miR-3150b-3p	11.80	(5.78–24.06)	<.001

Note: OR odds ratio; CI confdence interval; BMI, body mass index; TG, triglyceride; TC, total cholesterol; LDL-C, low-density lipoprotein cholesterol; HDL-C, high-density lipoprotein cholesterol.

Analysis of the Role of miR-3150b-3p in ox-LDL-Induced HVSMCs

The in vitro experiments in this study further elucidate the role of miR-3150b-3p in ox-LDL-induced HVSMCs. Compared to the control group, ox-LDL induction significantly upregulated the expression of miR-3150b-3p (P < .0001), and the use of miR-3150b-3p inhibitor effectively reversed this change (Figure 2A, P < .01). The cell viability assay results showed that ox-LDL treatment significantly reduced cell viability (P < .0001), while the addition of the miR-3150b-3p inhibitor significantly restored cell viability (Figure 2B, P < .01). Further detection of inflammatory factors revealed that, compared to the control group, the ox-LDL group exhibited significantly elevated levels of TNF-α (Figure 2C), IL-6 (Figure 2D), and IL-1β (Figure 2E) (P < .0001). The miR-3150b-3p inhibitor significantly reduced the levels of these inflammatory factors (P < .0001). In addition, oxidative stress indicators revealed that the SOD activity (Figure 2F) was decreased and the MDA content (Figure 2G) was increased in the ox-LDL group. However, the miR-3150b-3p inhibitor significantly increased SOD activity (P < .01) and decreased MDA content (P < .01), thereby ameliorating the oxidative stress state induced by ox-LDL.

Figure 2.

The Effect of miR-3150b-3p on ox-LDL-Induced HVSMCs. (A) ox-LDL Significantly Upregulated the Expression of miR-3150b-3p (P < .0001), and the miR-3150b-3p Inhibitor Reversed This Change (**P < .01); (B) ox-LDL Induction Reduced Cell Viability (****P < .0001), and the miR-3150b-3p Inhibitor Significantly Restored Cell Viability (**P < .01); ox-LDL Induction Significantly Increased the Levels of TNF-α (C), IL-6 (D), and IL-1β (E), While the miR-3150b-3p Inhibitor Markedly Reduced Their Levels (****P < .0001); ox-LDL Decreased SOD Activity (**P < .01, F) and Increased MDA Content (****P < .0001, G), and the miR-3150b-3p Inhibitor Reversed These Changes.

Validation of the Targeting Relationship Between miR-3150b-3p and ARL5B

TargetScan predicts that miR-3150b-3p binds to the 3′UTR of ARL5B with complete seed sequence complementarity (Figure 3A). The luciferase reporter gene assay validated the binding relationship between miR-3150b-3p and ARL5B. Compared to the NC-mimic group, the relative luciferase activity of WT-ARL5B in the miR-mimic group was significantly reduced (P < .0001), while MT-ARL5B showed no significant changes, indicating that miR can bind to and inhibit ARL5B expression (Figure 3B). In addition, compared to the IgG group, the level of ARL5B mRNA in the Ago2 antibody-enriched complex was significantly reduced (Figure 3C, P < .001).

Figure 3.

Validation of the Relationship Between miR-3150b-3p and ARL5B. (A) the Binding Site of miR-3150b-3p with the 3′UTR of ARL5B; (B) the miR-3150b-3p Mimic Significantly Reduced the Luciferase Activity of WT-ARL5B (****p < .0001), While no Significant Change was Observed in MT-ARL5B. (C) RIP Experiments Confirmed the Interaction Between miR-3150b-3p and ARL5B.

Discussion

CHD, as a common cardiovascular condition that poses a serious threat to human health, imposing a heavy burden on families and society. In-depth research into the pathogenesis of CHD, as well as the identification of effective diagnostic markers and therapeutic targets, is crucial for improving patient prognosis.

MicroRNAs (miRNAs) are non-coding RNAs with regulatory roles,²⁰ and their levels reflect cellular states, serving as potential biomarkers for disease diagnosis.^28,29 miR-3150b-3p, as a novel miRNA, holds potential diagnostic and therapeutic value in various diseases. In hepatocellular carcinoma (HCC) linked to hepatitis B virus, miR-3150b-3p binds to ASCL1′s 3′UTR, silences it, alters von Willebrand factor expression, and modulates the malignant progression of tumors.³⁰ In HCC, miR-3150b-3p suppresses HCC cell proliferation, migration, and invasion by targeting circNEIL3 and LAMC1.³¹ Similarly, In atherosclerotic plaque-related ischemic stroke (IS), miR-3150b-3p in the RRAS2-ILF3-AS1 regulatory axis may play a key role in IS progression.²⁰ A new study indicates that the expression of miR-3150b-3p is significantly upregulated in patients with CHD,³² which is consistent with the findings of this study. This study also found that miR-3150b-3p was upregulated in the serum of patients with CHD, closely associated with the severity of the condition, and may be involved in the pathological process of CHD. Indicators such as LDL-C, HDL-C, CK-MB, Gensini score, and cTnI are related to the occurrence and progression of CHD, playing a crucial role in its diagnosis, risk assessment, and prognosis evaluation.³² The findings of this study are consistent with these reported trends, showing a significant positive correlation between miR-3150b-3p and the aforementioned indicators (P < .0001). Compared with other miRNAs, the miR-3150b-3p in this study demonstrated significant advantages in the diagnosis of CHD, with an AUC of 0.880, which is higher than that of let-7c (0.654)、miR-155 (0.620)、miR-145 (0.670)、miR-92a (0.520) and miR-22-3p (0.642).^33,34 These results collectively support the potential of miR-3150b-3p as a biomarker and therapeutic target in CHD.

HVSMCs are a crucial cell type in the vascular system, playing a significant role in maintaining vascular contraction, relaxation functions, and the integrity of the vascular wall.^35–37 ox-LDL is a significant inducer of atherosclerosis, capable of triggering a series of pathological changes in HVSMCs.^38,39 Ox-LDL significantly affects HVSMCs by promoting inflammation, enhancing cell adhesion, inducing apoptosis, and stimulating extracellular matrix synthesis.⁴⁰ For example, the ox-LDL-induced HVSMCs cell model significantly promotes cell proliferation and migration while inhibiting cell apoptosis, simulating the pathological environment of coronary atherosclerosis.⁴¹ In this study, ox-LDL induced HVSMCs to reduce cell viability and exacerbate inflammatory responses and oxidative stress. Furthermore, in the ox-LDL-induced HVSMCs cell model, miR-3150b-3p expression was up-regulated, and its inhibition can effectively alleviate the pathophysiological changes induced by ox-LDL. Therefore, miR-3150b-3p may act as a driving factor for VSMC injury. The downregulation of miR-483-5p promotes the survival ability of HUVECs and inhibits the apoptosis of HUVECs.⁴² This study further revealed that the inhibition of miR-3150b-3p effectively alleviates the pathophysiological changes induced by ox-LDL. This echoes the finding that elevated levels of miR-3150b-3p in clinical samples are associated with CHD indicators. This further confirms the bidirectional causal relationship between miR-3150b-3p and VSMC injury, as well as its potential as a driving factor. Therefore, the comprehensive diagnosis integrating in vitro study results with clinical context is conducive to the development of miR-3150b-3p as a potential biomarker and therapeutic target for CHD, providing a theoretical basis for future clinical applications.

ARL5B (ADP-ribosylation factor-like protein 5B) is a small GTPase that participates in various intracellular processes such as vesicular transport, signal transduction, and cytoskeletal reorganization.^43,44 Studies have shown that ARL5B can act as a negative regulator of the MDA5 signaling pathway, inhibiting MDA5-mediated production of type I interferons and pro-inflammatory cytokines, thereby preventing excessive inflammation and the occurrence of autoimmune responses.⁴⁵ This study confirmed the miR-3150b-3p and ARL5B binding, indicating miR-3150b-3p may play a significant role through ARL5B, which warrants further in-depth investigation. However, there is currently no direct research exploring the therapeutic potential of ARL5B in vivo, particularly in the context of cardiovascular diseases. Therefore, future studies could further investigate the regulatory role of ARL5B in in vivo models to evaluate its therapeutic effects.

This study comprehensively explored the role of miR-3150b-3p in CHD through clinical and cellular research, but there are still some limitations. Firstly, the small sample size might lead to selection bias, compromising the generalizability of the findings. Secondly, although in vitro cell experiments provide insights into molecular mechanisms for research, cell models cannot fully replicate the complex physiological and pathological environments in vivo. Future studies should expand the sample size to enhance the generalizability of the results, while also developing in vivo animal models to more accurately simulate the human environment, in order to comprehensively explore the role of miR-3150b-3p in CHD.

Conclusion

In this study, miR-3150b-3p was significantly upregulated in the serum of CHD patients and positively correlated with the severity of the disease, demonstrating its potential as a diagnostic marker.In vitro experiments have demonstrated that the miR-3150b-3p inhibitor can reduce inflammatory factors and improve oxidative stress levels. Furthermore, the study confirmed that miR-3150b-3p binds to ARL5B, revealing its molecular mechanism. These findings provide new biomarker candidates for CHD diagnosis and lay the foundation for developing therapeutic strategies based on miR-3150b-3p.

Footnotes

Abbreviations

ORCID iD

Wei Wang

Funding

The authors received no financial support for the research, authorship, and/or publication of this article.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

References

Ciardiello

Martini

Napolitano

Tabernero

Cervantes

. Clinical management of metastatic colorectal cancer in the era of precision medicine. CA Cancer J Clin. 2022;72(4):372–401.

Kim

. Cow's milk intake and risk of coronary heart disease in Korean postmenopausal women. Nutrients. 2022;14(5):1092.

, et al. Improved lipidomic profile mediates the effects of adherence to healthy lifestyles on coronary heart disease. Elife. 2021;10:e60999

Ghaffari

Aghajari

Ghasemi

Ghandi

Falahati

. Evaluation of blood pressure in pediatric survivors of acute lymphoblastic leukemia and healthy children; A case-control study. Adv Biomed Res. 2022;11(1):40.

Lim

Yao

Huang

, et al. A unique recombinant fluoroprobe targeting activated platelets allows in vivo detection of arterial thrombosis and pulmonary embolism using a novel three-dimensional fluorescence emission computed tomography (FLECT) technology. Theranostics. 2017;7(5):1047–1061.

Liu

Zhang

Wang

. The therapeutic effect and targets of cellulose polysaccharide on coronary heart disease (CHD) and the construction of a prognostic signature based on network pharmacology. Front Nutr. 2022;9:986639.

Meng

Yao

Wang

, et al. Knockdown of GAS5 inhibits atherosclerosis progression via reducing EZH2-mediated ABCA1 transcription in ApoE(-/-) mice. Mol Ther Nucleic Acids. 2020;19:84–96.

Wang

Han

, et al. Dopamine D₄ receptors inhibit proliferation and migration of vascular smooth muscle cells induced by insulin via down-regulation of insulin receptor expression. Cardiovasc Diabetol. 2014;13(1):97.

Zhan

Zhong

Tang

, et al. microRNA-18a-5p promotes vascular smooth muscle cell phenotypic switch by targeting Notch2 as therapeutic targets in vein grafts restenosis. Eur J Pharmacol. 2024;985:177097.

10.

Zhang

Chen

Niu

Luo

. MicroRNA-30a-3p: A potential noncoding RNA target for the treatment of arteriosclerosis obliterans. Aging. 2023;15(21):11875–11890.

11.

Tabari

Scholl

Steffens

, et al. Impact of Zika virus infection on human neural stem cell MicroRNA signatures. Viruses. 2020;12(11):1219.

12.

Kodahl

Lyng

Binder

, et al. Novel circulating microRNA signature as a potential non-invasive multi-marker test in ER-positive early-stage breast cancer: A case control study. Mol Oncol. 2014;8(5):874–883.

13.

Xie

Chen

, et al. miR-3687 overexpression promotes bladder cancer cell growth by inhibiting the negative effect of FOXP1 on cyclin E2 transcription. Mol Ther. 2019;27(5):1028–1038.

14.

Jiang

Guo

Lin

Tao

. miR-205 inhibits the development of hypertrophic scars by targeting THBS1. Aging. 2020;12(21):22046–22058.

15.

Song

Qiao

Chen

, et al. Identification of key genes as early warning signals of acute myocardial infarction based on weighted gene correlation network analysis and dynamic network biomarker algorithm. Front Immunol. 2022;13:879657.

16.

Wang

. MiR-3150b-3p inhibits the proliferation and invasion of cervical cancer cells by targeting TNFRSF11a. J Invest Med. 2020;68(6):1166–1170.

17.

Zhao

Tang

. LncRNA RP11-116G8.5 promotes the progression of lung squamous cell carcinoma through sponging miR-3150b-3p/miR-6870-5p to upregulate PHF12/FOXP4. Pathol Res Pract. 2021;226:153566.

18.

Anjum

Eajaz

Gaffar

Ling

. Myocardial invasion of squamous cell lung carcinoma presenting as STEMI. Heart Views. 2022;23(3):177–180.

19.

Simek

Sturdza

Knoth

, et al. Cardiac metastasis in uterine cervical cancer : A systematic review and case study. Strahlenther Onkol. 2025;201(1):71–81.

20.

Zhang

Han

Wang

. Uncovering candidate mRNAs, signaling pathways and immune cells in atherosclerotic plaque and ischemic stroke. Int J Gen Med. 2023;16:2999–3012.

21.

Kuscu

Mallisetty

Naik

, et al. Circulating microRNA profiles for premature cardiovascular death in patients with kidney failure with replacement therapy. J Clin Med. 2023;12(15):5010.

22.

Shi

Chen

Mahajan

, et al. Amino acids stimulate the endosome-to-Golgi trafficking through ragulator and small GTPase Arl5. Nat Commun. 2018;9(1):4987.

23.

Raja

Fonseka

Ganenthiran

Andrea Ruiz

Liu

. The multifaceted roles of ER and Golgi in metabolic cardiomyopathy. Front Cardiovasc Med. 2022;9:999044.

24.

Bangsow

Baumann

Bangsow

, et al. The epithelial membrane protein 1 is a novel tight junction protein of the blood-brain barrier. J Cereb Blood Flow Metab. 2008;28(6):1249–1260.

25.

Kunjithapatham

Geschwind

Devine

, et al. Occurrence of a multimeric high-molecular-weight glyceraldehyde-3-phosphate dehydrogenase in human serum. J Proteome Res. 2015;14(4):1645–1656.

26.

Liu

Zhao

Sun

, et al. Overexpression of small nucleolar RNA SNORD1C is associated with unfavorable outcome in colorectal cancer. Bioengineered. 2021;12(1):8943–8952.

27.

Wang

Liu

Chen

, et al. Dysfunctional endothelial-derived microparticles promote inflammatory macrophage formation via NF-кB and IL-1β signal pathways. J Cell Mol Med. 2019;23(1):476–486.

28.

Bartel

. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–297.

29.

Vishnubalaji

Shaath

Elkord

Alajez

. Long non-coding RNA (lncRNA) transcriptional landscape in breast cancer identifies LINC01614 as non-favorable prognostic biomarker regulated by TGFβ and focal adhesion kinase (FAK) signaling. Cell Death Discov. 2019;5(1):109.

30.

Zhu

Deng

Liang

. Hepatitis B virus X protein promotes VWF-mediated HCC progression through ST8SIA6-AS1/miR-3150b-3p/ASCL1 axis. Eur J Pharmacol. 2025;991:177315.

31.

Zhang

Jiang

Bao

. Circular ribonucleic acid nei-like deoxyribonucleic acid glycosylase 3 governs the microribonucleic acid −3150b-3p/laminin subunit gamma 1 network to partially promote the development of hepatocellular carcinoma. Hepatol Res. 2021;51(6):702–714.

32.

Wang

Liu

, et al. Identification and analysis of differential miRNA-mRNA interactions in coronary heart disease: An experimental screening approach. Front Cardiovasc Med. 2023;10:1186297.

33.

Zhang

Guo

Zhong

. miR-22-3p as a potential biomarker for coronary artery disease based on integrated bioinformatics analysis. Front Genet. 2022;13:936937.

34.

Qian

Song

, et al. BMP4-mediated Browning of perivascular adipose tissue governs an anti-inflammatory program and prevents atherosclerosis. Redox Biol. 2021;43:101979.

35.

Zhang

Qiu

Jiang

. Sulforaphane attenuates angiotensin II-induced vascular smooth muscle cell migration via suppression of NOX4/ROS/Nrf2 signaling. Int J Biol Sci. 2019;15(1):148–157.

36.

Park

Kim

Cha

, et al. TAK-733 inhibits inflammatory neointimal formation by suppressing proliferation, migration, and inflammation in vitro and in vivo. Exp Mol Med. 2018;50(4):1–12.

37.

Dai

Chi

Rong

. Long non-coding RNA MEG8 suppresses hypoxia-induced excessive proliferation, migration and inflammation of vascular smooth muscle cells by regulation of the miR-195-5p/RECK axis. Front Mol Biosci. 2021;8:697273.

38.

Liu

Sun

Zhao

, et al. Ginkgolide B inhibits JAM-A, Cx43, and VE-cadherin expression and reduces monocyte transmigration in oxidized LDL-stimulated human umbilical vein endothelial cells. Oxid Med Cell Longevity. 2015;2015:907926.

39.

Huang

Tang

Wang

Liu

Chen

Sun

. A circular RNA, circUSP36, accelerates endothelial cell dysfunction in atherosclerosis by adsorbing miR-637 to enhance WNT4 expression. Bioengineered. 2021;12(1):6759–6770.

40.

Wang

Chen

, et al. Metformin improved oxidized low-density lipoprotein-impaired mitochondrial function and increased glucose uptake involving akt-AS160 pathway in raw264.7 macrophages. Chin Med J. 2019;132(14):1713–1722.

41.

Yuan

Wang

. Protective effect of liquiritin on coronary heart disease through regulating the proliferation of human vascular smooth muscle cells via upregulation of sirtuin1. Bioengineered. 2022;13(2):2840–2850.

42.

Zhu

Liang

Gao

, et al. MiR-483-5p downregulation alleviates ox-LDL induced endothelial cell injury in atherosclerosis. BMC Cardiovasc Disord. 2023;23(1):521.

43.

Jaimon

Tripathi

Khurana

Ghosh

Sugatha

Datta

. Binding with heat shock cognate protein HSC70 fine-tunes the Golgi association of the small GTPase ARL5B. J Biol Chem. 2021;297(6):101422.

44.

Fremont-Debaene

Faure-Dupuy

. [HRV16 inhibits bacterial clearance in a ARL5b-dependent manner]. médecine/Sciences. 2024;40(6-7):492–494.

45.

Kitai

Takeuchi

Kawasaki

, et al. Negative regulation of melanoma differentiation-associated gene 5 (MDA5)-dependent antiviral innate immune responses by arf-like protein 5B. J Biol Chem. 2015;290(2):1269–1280.

miR-3150b-3p Promotes Vascular Smooth Muscle Cell Injury by Targeting ARL5B

Abstract

Background

Method

Results

Conclusions

Keywords

Introduction

Materials and Methods

Research Subjects and Information Collection

Expression Detection of miR-3150b-3p

Cell Culture and ox-LDL Induction

Cell Transfection and Functional Analysis

Cell Viability Detection

Inflammatory Factor Testing

Oxidative Stress Detection

Target Gene Prediction and Validation

Statistical Analysis

Results

Baseline Characteristics

Expression Characteristics and Correlation Analysis of miR-3150b-3p in CHD

Multifactorial Logistic Regression Analysis of Risk Factors for CHD

Analysis of the Role of miR-3150b-3p in ox-LDL-Induced HVSMCs

Validation of the Targeting Relationship Between miR-3150b-3p and ARL5B

Discussion

Conclusion

Footnotes

Abbreviations

ORCID iD

Funding

Declaration of Conflicting Interests

References