Sage Journals: Discover world-class research

Abstract

Phenotypic resistance to activated protein C (APC) is a complex mechanism associated with increased thrombosis risk. Activated protein C resistance (APCR) is mainly influenced by FV_Leiden mutation, and various other single nucleotide polymorphisms (SNPs) in FV gene are known to be associated with APCR. The aim of present study was to investigate the incidence and assess possible mechanisms of APCR in Indian patients with deep vein thrombosis (DVT). Three hundred and ten Doppler-proven patients with DVT were screened for APCR, and 50 APCR positive patients and 50 controls were typed for FV_Leiden, Hong Kong, Cambridge, HR2 haplotype, Glu666Asp, Ala485Lys, and Liverpool using either polymerase chain reaction (PCR)–restriction fragment length polymorphism or allele specific PCR. FV_Leiden was commonest cause of APCR (50%) in Indian patients with DVT being statistically significant (P = .001) compared to controls. FV Liverpool, FV Glu666Asp and FV Ala485Lys were studied for the first time in Indian population. FV Liverpool, FV Glu666Asp, Hong Kong, and Cambridge were found to be absent. High frequency of Ala485Lys in patients shows that it might be a risk factor contributing to APCR in Indian patients with DVT. HR2 haplotype was not associated with APCR; however, presence of homozygous HR2 haplotype in patients only indicates the role it might play in Indian APCR population. In conclusion, contribution of FV_Leiden causing APCR in Indian population is not as strong as previously reported in Western countries. The presence of other SNPs observed in the present study requires such studies on larger sample size to understand the molecular basis of defect.

Keywords

activated protein C resistance factor V polymorphism thrombosis

Introduction

Proteolytic inactivation of FVa and FVIIIa by activated protein C (APC) is a crucial mechanism involved in downregulation of the coagulation pathway. Activated protein C mediates cleavage of intact FV at positions arginine (Arg) 306, Arg506, and Arg679; which then inactivates FVIIIa, thus causing downregulation of the procoagulant activity of FV.¹ Functional abnormalities of this pathway manifesting in the form of phenotypic resistance to APC are associated with an increased risk of venous thromboembolism.² Activated protein C resistance (APCR) first observed in 1993³ occurs with a frequency of 20% to 60% in patients with venous thromboembolism.⁴ Activated protein C resistance is mainly caused by mutations in the FV gene. FV was first discovered in 1947⁵ and is an important enzyme required for maintaining normal hemostatic balance as it plays a dual role of being a procoagulant and an anticoagulant. The gene for FV is 80 kb in length and is located on chromosome 1q23.⁶ Various single nucleotide polymorphisms (SNPs) in the FV gene have been reported to be associated with APCR. FV_Leiden is the commonest cause of DVT with its frequency being 60% in patients with DVT and 2% to 15% in general population.⁷ Genetic basis of FV_Leiden was first described in 1994 when G to A substitution at position 1691 was shown to result in substitution of glutamine (Gln) in place of Arg at position 506, which is the prime target site for APC-mediated inactivation of FVa.⁸ In addition to FV_Leiden, the FV Hong-Kong and Cambridge are 2 mutations present at Arg306 APC cleavage site associated with reduced APC cofactor activity in FVIII inactivation and mild APCR.^9,10 R2 allele or HR2 haplotype either independently or in association with FV_Leiden mutation has also been reported to be associated with APCR. However, its role in causing APCR and thus increased risk of thrombosis is controversial.^11
–13 Another FV-related causes of APCR were associated with FV Liverpool, FV Glu666Asp, and FV Ala485Lys mutations and have not been previously studied in Indian population.^14
–16 An earlier study from our group reported only 50% of APCR positive patients to be carrying FV_Leiden mutation in patients with DVT.¹⁷ However, there was a major point of difference in the root cause of APCR in Indian population from the Caucasian population. This discrepancy increased the possibility that the Indian population having thrombosis with APCR may be carrying mutations other than FV_Leiden contributing toward APCR. The present study was undertaken to investigate the incidence and assess possible role of other FV SNPs with APCR in Indian patients with DVT.

Materials and Methods

Patient/Control Population

We screened 310 Doppler-proven patients with DVT in the time span of about 2 years (October 2011-August 2013) for APCR. Only patients with APCR positive (50 of 310) were included in the present study. The mean age of the patients was 41.1 ± 5.5 (range 23-54) years. Patients receiving thrombotic drugs or oral anticoagulants were excluded from the study, as were patients with malignancy, pregnancy, liver disease, acute thrombotic phase, and oral contraceptive users as these factors can affect APCR testing.

Fifty healthy controls of similar age-group (40.1 ± 5.2, range 23-52) were recruited from the same geographical area. The controls had no history of arterial and venous thrombotic diseases. All the patients as well as controls gave written consent to enter the study, and ethical clearance was obtained from Institute Ethics Committee of All India Institute of Medical Sciences, New Delhi, India.

Sample Collection and Plasma Separation

Blood samples (10 mL) were collected in siliconized glass containers, containing 3.2% trisodium citrate solution. Plasma was separated by centrifugation for 10 minutes at 2000g at room temperature and stored at −70°C till further use. Sample collection was delayed until at least 3 to 6 months following the acute thrombotic event to rule out the possibility of false-positive results.

Laboratory Testing

Activated protein C resistance was assessed by measuring the anticoagulant response in plasma on the addition of APC (Coatest; Chromogenix, Sweden). A ratio of <2.1 for the clotting time in the presence of APC/clotting time in the absence of APC was taken to represent APCR. All the APCR positive patients and controls were tested for FV_Leiden and other common FV mutations/polymorphisms, known to contribute to APCR. RNA-free genomic DNA was isolated from peripheral blood leukocytes using the Bioserve DNA isolation kit. DNA concentration was determined using NanoDrop device. Mutational analysis for FV_Leiden, Hong Kong, Cambridge, and HR2 haplotype was done by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP), and screening protocols are shown in Table 1. FV Liverpool, FV Glu666Asp, and FV Ala485Lys polymorphisms were identified using allele-specific PCR (Table 2).

Table 1.

PCR-RFLP Protocols of FV Variants.

Polymorphisms/Mutations	Primer Sequence (5′ > 3′)	Tm (°C)	Restriction Enzyme	PCR Product Size Before Digest	PCR Product Size After Digest
FV_Leiden or 1691 G>A or 506 Arg>Gly (=rs6025)	F: CATGAGAGAACATCGCCTCTG	58	MnlI	147bp	Normal:85, 37, 25 bp
	R: GACCTAACATGTTCTAGCCAGAAG				Heterozygous: 122, 85, 37, 25 bp
	R: GACCTAACATGTTCTAGCCAGAAG				Mutant: 122 and 25 bp
FV HR2 haplotype or 4070 A>G	F: CAAGTCCTTCCCCACAGATATA	58	RsaI	703 bp	Normal (R1R1): 703 bp
	R: AGATCTGCAAAGAGGGGCAT				Heterozygous (R1R2): 703, 492, 211 bp
	R: AGATCTGCAAAGAGGGGCAT				Mutant (R2R2): 492, 211 bp
FV Hongkong or 306 Arg >Gly	F: TCCCACCTCTTCATGTCCGCCTCTG	56	HpaII	252 bp	Normal: 252 bp
	R: CCAAACTAAAATGTTC AAAAATTGCCTGGGCATTA				Heterozygous:252, 198, 54 bp
	R: CCAAACTAAAATGTTC AAAAATTGCCTGGGCATTA				Mutant:198, 54 bp
FV Cambridge or 306 Arg >Thr	F: CCCACCTCTTCATGTCCGCCTCTG	56	MvaI	252 bp	Normal: 173, 53 bp
	R: CCAAACTAAAATGTTCAAAAATTG CCTGGGCATTA				Heterozygous:226, 173, 53 bp
	R: CCAAACTAAAATGTTCAAAAATTG CCTGGGCATTA				Mutant: 226 bp

Abbreviations: F, forward primer; R, reverse primer; PCR-RFLP, polymerase chain reaction–restriction fragment length polymorphism; Arg, arginine; Gly, glycine; Thr, threonine.

Table 2.

Allele Specific PCR Protocol for FV Variants.^a

	Primer Sequence (5′>3′)	Tm (°C)	Internal Control Product Size	Allele-Specific Product Size
FV Liverpool or 359 Ile>Thr	ICF: CATTGCTGCAGAGGAAGTCA	60	205 bp	126 bp
	WTF: TTTGGATAATTTCTCAAACCAACT
	MF: TTTGGATAATTTCTCAAACCAACC
	CR: GGACCCAAAATCCCATCTTC
FV Glu666Asp	ICF: AAGAAGCAAAAAGCTGAGGCTGA	59	195 bp	142 bp
	WTF: ATGATGATGAAGACTCATATGGG
	MF: ATGATGATGAAGACTCATATGGC
	CR: TAATGCTGCAGCCAGTCTGT
FV Arg485 Lys or 1628 G>A or (rs6020)	ICF: CCTATACTTATAAGTGGAACATC	59	247 bp	167 bp
	WTF: AGTGACGTGGACATCATGCG
	MTF: AGTGACGTGGACATCATGCA
	CR: TTGTCCTCAAGGTACCAGCTT

Abbreviations: ICF, internal control forward, WTF, wild type forward; MF, mutant forward; CR, common reverse; PCR, polymerase chain reaction; Ile, isoleucine; Thr, threonine; Lys, lysine; Arg, arginine.

^aWTF and MF different from each other in only one nucleotide, the nucleotide is underlined.

Statistical Analysis

SPSS software (Stata Statistical Software, Release 12.0; Illinois) was used for statistical analysis. Pearson chi-square has been used for P value calculations except where number <5 were encountered in which case fisher exact test was used. A P value <.05 is taken as statistically significant. All P values are 2-tailed.

Results

Of the 310 patients, 50 (50 of 310 = 16.1%) were found to be APCR positive. None of the 50 controls were positive for APCR. Table 3 shows the comparison of the various congenital causes of APCR with respect to healthy controls. FV_Leiden accounted for 50% (25 of 50) of all APCR positive patients in the present study, and the difference in the group frequencies compared with controls was found to be statistically significant (P = .001). FV HR2 haplotype was seen in 16% (8 of 50) of patients and 10% (5 of 50) of controls but this difference was not statistically significant (P = .554). Four patients showed coexistence of FV_Leiden mutation with HR2 haplotype. FV Ala485Lys polymorphism was seen in 26% (13 of 50) of patients and 14% (7 of 50) of controls, and this difference was not associated with APCR (P = .134). Ten percentage (5 of 50) of patients were double heterozygotes for FV_Leiden and FV Ala485Lys polymorphisms. None of the patients and controls carried the FV Hong-Kong, Cambridge, Liverpool, and Glu666Asp mutations.

Table 3.

Comparison of Frequency of Congenital Causes of APCR in Patients With DVT Against Controls.

	Patients	Controls
FV Variants	(n = 50)	(n = 50)	P Value
FV Leiden	25 (50)	0 (0)	<.001
FVL homozygous mutant	2 (4)	0	.494
FVL heterozygous mutant	23 (46)	0	<.001
FV HR2 haplotype	8 (16)	5 (10)	.554
FV HR2 homozygous (R1R1)	2 (4)	0	.494
FV HR2 heterozygous (R1R1)	6 (12)	5 (10)	.749
FV Ala485Lys	13 (26)	7 (14)	.134
FV Hong Kong/Cambridge	–	–	–
FV Liverpool	–	–	–
FV Glu666Asp	–	–	–

Abbreviations: APCR, activated protein C resistance; DVT, deep vein thrombosis.

P value < .05 was considered statistically significant.

Pearson chi-square and Fisher exact test has been used for P value calculation.

Discussion

Activated protein C resistance, a poor anticoagulant response of APC in hemostasis, is the most common cause of DVT. A large number of studies from the caucasian as well as Asian population have stressed on the association of APCR with DVT. However, the strength of association between DVT and various risk factors contributing to APCR still remains to be elucidated. The prevalence of APCR varies from population to population. The frequency of APCR among patients with venous thrombosis, depending on the selection criteria, ranges from 20% to 60%. Our present study showed a prevalence rate of 16.1% (50 of 310), which is somewhat lower than 20% (31 of 155) of prevalence rates obtained by our previous group¹⁷ and higher than 12.5% obtained by Bhattacharyya et al in north Indian population.¹⁸

Inherited APCR because of the FV_Leiden mutation has been shown to be clearly associated with APCR in population with thrombosis.^3,8,19 Present study showed APCR at a higher frequency than FV_Leiden mutation. We identified only 50% of APCR positive patients carrying FV_Leiden mutation. Our group had earlier reported similar findings,¹⁷ although the proportion of patients showing APCR and carrying FV_Leiden mutation was slightly higher (51.6%) in that study. This percentage is much lower than that for caucasians which is estimated at 95%.^3,8,20 This discrepancy increased the possibility that the Indian population having thrombosis with APCR may be carrying mutations other than FV_Leiden contributing toward APCR.

Various mutations in the FV gene excluding FV_Leiden, particularly at the other cleavage sites of FV gene, Arg306 and Arg679, have the potential to contribute to the APCR. FV Hong-Kong and Cambridge are 2 mutations present at Arg306 APC cleavage site associated with reduced APC cofactor activity in FVIII inactivation and mild APCR. Genotyping for the Hong Kong/Cambridge mutations in our study did not reveal a single mutant type (homozygote or heterozygote) of these mutations in either patients or controls. This can be expected as these mutations have shown to be of very rare occurrence similar to other Asian population.^9,10,21 FV HR2 haplotype showed a prevalence rate of 8 (16%) and 5 (10%) in the patient and control population, respectively, which was not significantly different (P = .554). Genotyping for the FV HR2 haplotype showed a prevalence rate of 12% and 10% for the R1R2 heterozygous genotype in the patients and control population respectively, which was not significantly different (P value = .749). However, the presence of 2 patients with the FV HR2 homozygous condition and absence in control population indicate that FV HR2 in its homozygous mutant (R2R2) form may be contributory toward APCR. A large sample size is required to find out the correct association of HR2 haplotype with APCR.

Another FV-related cause for APCR is associated with FV Liverpool (Ile359Thr) and FV Glu666Asp mutations. As per our best knowledge, the present study has studied these mutations in Indian population with thrombosis for the first time. Genotyping for the FV Liverpool and FV Glu666Asp mutations in our study population showed that both mutations were absent in all the patients and controls. Recently, Xing-Guang et al described low prevalence of FV Glu666Asp mutations in Chinese patients with DVT as well as they did not found significant association of Glu666Asp mutation with APCR.¹⁵ It can be assumed that these mutations may be very rare in Asian Indian population. FV Ala485Lys polymorphism in our study was not associated with APCR in patients with DVT when compared with controls (P = .134). Our result is corresponding with a previous study where no association between FV Ala485Lys polymorphism and APCR in patients with DVT was observed in a Thai population with DVT.²²

However, Le et al reported that individuals who were homozygous or heterozygous for the Ala485Lys polymorphism had significantly lower normalized APC ratios than those with the normal genotype in the patients with coronary artery disease.¹⁶ In our study, no patients and control were homozygous for the polymorphism that might reflect our finding. Ala485Lys polymorphism occurs in a highly conserved α-loop in the A2 domain, and its location is close to position Arg506. We can guess that the Lys residue may affect loop structure and cleavage site of Arg506 of APC inactivation. Unfortunately, no study explains the molecular mechanism of APCR in carriers of the Ala485Lys polymorphism. In the present study, only FV_Leiden was observed to be associated with APCR, whereas rests of the FV polymorphisms/mutations were not significantly associated with APCR. It is quite possible that acquired factors like presence of FVIII, LAC, and β2 glycoproteins might contribute to APCR in FV_Leiden-negative patients with thrombosis.

In conclusion, FV_Leiden is the major cause of inherited APCR in Indian patients with DVT. However, unlike in the West, FV_Leiden mutation may not contribute to APCR as strongly in the Asian Indian population as it does in the Caucasian population. Other rare SNPs like Hong-Kong, Cambridge, FV Liverpool, and FV Glu666Asp are very rare in Indian population similar to other Asian studies. Presence of 2 patients with FV HR2 homozygous condition in APCR patients indicates that FV HR2 in its homozygous mutant form may be contributory toward the APCR. A high frequency of Ala485Lys in the present study shows that it might be a risk factor contributing to APCR in Indian patients with DVT. Future studies with a larger sample size are required to make a correct assessment posed by these FV SNPs.

Footnotes

Acknowledgments

Authors would like to thank Indian Council of Medical Research (ICMR) for providing funds in the lab and Senior Research Fellowship to AS and Department of Science and Technology for providing INSPIRE-Junior Research Fellowship to TB.

Author Contributions

RS was the principal investigator of the work. AS designed the study, performed experimental studies, compiled the data, and contributed to writing. TB performed data analysis and contributed to writing. AB, RR, RK, and KK drafted the manuscript. MM and MAJ provided valuable clinical input and reviewed the manuscript. All the authors read and approved the final manuscript.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

Kalafatis

Rand

Mann

. The mechanism of inactivation of human factor V and human factor Va by activated protein C. J Biol Chem. 1994;269(50):31869–31880.

Castoldi

Rosing

. APC resistance: biological basis and acquired influences. J Thromb Haemost. 2010;8(3):445–453.

Dahlback

Carlsson

Svensson

. Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc Natl Acad Sci U S A. 1993;90(3):1004–1008.

Nicolaes

Dahlback

. Factor V and thrombotic disease: description of a janus-faced protein. Arterioscler Thromb Vasc Biol. 2002; 22(4):530–538.

Owren

. Parahaemophilia; haemorrhagic diathesis due to absence of a previously unknown clotting factor. Lancet. 1947;1(6449):446–448.

Kane

Ichinose

Hagen

Davie

. Cloning of cDNAs coding for the heavy chain region and connecting region of human factor V, a blood coagulation factor with four types of internal repeats. Biochemistry. 1987;26(20):6508–6514.

Rees

Cox

Clegg

. World distribution of factor V Leiden. Lancet. 1995;346(8893):1133–1134.

Bertina

Koeleman

Koster

. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature. 1994;369(6475):64–67.

Williamson

Brown

Luddington

Baglin

. Factor V Cambridge: a new mutation (Arg306-->Thr) associated with resistance to activated protein C. Blood. 1998;91(4):1140–1144.

10.

Chan

Lee

Kwong

Lam

Liang

. A novel mutation of Arg306 of factor V gene in Hong Kong Chinese. Blood. 1998;91(4):1135–1139.

11.

Luddington

Jackson

Pannerselvam

Brown

Baglin

. The factor V R2 allele: risk of venous thromboembolism, factor V levels and resistance to activated protein C. Thromb Haemost. 2000;83(2):204–208.

12.

Bernardi

Faioni

Castoldi

. A factor V genetic component differing from factor V R506Q contributes to the activated protein C resistance phenotype. Blood. 1997;90(4):1552–1557.

13.

Faioni

Franchi

Bucciarelli

. Coinheritance of the HR2 haplotype in the factor V gene confers an increased risk of venous thromboembolism to carriers of factor V R506Q (factor V Leiden). Blood. 1999;94(9):3062–3066.

14.

Mumford

McVey

Morse

. Factor V I359 T: a novel mutation associated with thrombosis and resistance to activated protein C. Br J Haematol. 2003;123(3):496–501.

15.

Xin-Guang

Yong-Qiang

Shu-Jie

Lian-Kai

Hua-Cong

. Prevalence of the Factor V E666D Mutation and Its Correlation With Activated Protein C Resistance in the Chinese Population. Clin Appl Thromb Hemost. 2015;21(5):480–483.

16.

. Association of the R485 K polymorphism of the factor V gene with poor response to activated protein C and increased risk of coronary artery disease in the Chinese population. Clin Genet. 2000;57(4):296–303.

17.

Biswas

Bajaj

Ranjan

. Factor V Leiden: is it the chief contributor to activated protein C resistance in Asian-Indian patients with deep vein thrombosis? Clin Chim Acta. 2008;392(1-2):21–24.

18.

Bhattacharyya

Kannan

Chaudhry

Saxena

. Venous thrombosis: prevalence of prothrombotic defects in north Indian population. Indian J Pathol Microbiol. 2003;46(4):621–624.

19.

Zoller

Svensson

Dahlback

. Identification of the same factor V gene mutation in 47 out of 50 thrombosis-prone families with inherited resistance to activated protein C. J Clin Invest. 1994;94(6):2521–2524.

20.

Van Cott

Soderberg

Laposata

. Activated protein C resistance, the factor V Leiden mutation, and a laboratory testing algorithm. Arch Pathol Lab Med. 2002;126(5):577–582.

21.

Hiyoshi

Hashimoto

Tagawa

Arnutti

Prayoonwiwat

Tatsumi

. A Thai patient with the mutation of Arg306 of FV gene identical to the Hong Kong but not to the Cambridge type. Thromb Haemost. 1999;82(5):1553–1554.

22.

Hiyoshi

Arnutti

Prayoonwiwat

. A polymorphism nt 1628G-->A (R485 K) in exon 10 of the coagulation factor V gene may be a risk factor for thrombosis in the indigenous Thai population. Thromb Haemost. 1998;80(4):705–706.

Prevalence of Factor V Genetic Variants Associated With Indian APCR Contributing to Thrombotic Risk

Abstract

Keywords

Introduction

Materials and Methods

Patient/Control Population

Sample Collection and Plasma Separation

Laboratory Testing

Statistical Analysis

Results

Discussion

Footnotes

Acknowledgments

Author Contributions

Declaration of Conflicting Interests

Funding

References