Sage Journals: Discover world-class research

Abstract

Doxorubicin (DOX)-induced cardiotoxicity significantly impairs cancer patient survival rates. Eleutheroside E (EE), a polyphenolic compound with established cardioprotective properties against high-altitude myocardial injury and ischemia/reperfusion damage, has not previously been investigated in the context of DOX-induced cardiac toxicity. This study aimed to elucidate the therapeutic potential of EE against DOX-associated cardiotoxicity and its underlying mechanisms. Cardiomyocyte viability was quantified using the CCK-8 assay and Hoechst 33342/PI dual staining. Cardiac function was evaluated by echocardiography. Morphological alterations in cardiomyocytes were analyzed through phalloidin, hematoxylin-eosin (H&E), and wheat germ agglutinin staining. Ferroptosis-related biomarkers including malondialdehyde (MDA), Ptgs2 mRNA levels, Fe²⁺ concentration, and lipid peroxidation were assessed respectively. EE administration attenuated DOX-induced cardiomyocyte atrophy in-vitro and improved cardiac function in-vivo. Mechanistically, EE counteracted DOX-mediated suppression of Nrf2 expression and inhibited ferroptosis via activation of the Nrf2/SLC7A11/GPX4 signaling axis. siRNA-mediated Nrf2 knockdown partly abolished EE's cardioprotective effects. These findings conclusively demonstrate that EE mitigates DOX-induced cardiotoxicity through Nrf2-dependent ferroptosis regulation, highlighting its therapeutic potential for preventing chemotherapy-associated cardiac complications.

Keywords

Eleutheroside E doxorubicin-induced cardiotoxicity Nrf2/SLC7A11/GPX4 ferroptosis

Introduction

Doxorubicin (DOX), a potent anthracycline antibiotic, is a cornerstone in the treatment of various malignancies despite its well-documented dose-dependent cardiotoxicity.¹ Clinical evidence indicates that approximately 98% of DOX-induced cardiotoxic events occur within the first year following chemotherapy,^2,3 often progressing to heart failure and significantly compromising the therapeutic benefits for patients.²

The pathogenesis of DOX-induced cardiotoxicity involves multiple mechanisms, including oxidative stress, mitochondrial dysfunction, and emerging evidence suggests ferroptosis.^4,5 Ferroptosis, a newly proposed form of programmed cell death, is characterized by lipid peroxides and accumulation of intracellular iron⁶ that eventually leads to cell death.^7–9 It is noteworthy that new therapeutic drugs, such as herbal medicines or chemical modification,³ are urgently needed to reduce the ferroptosis.

The SLC7A11/GPX4 pathway system affects lipid peroxidation in DOX-induced cardiotoxicity.^10–14 Nuclear factor erythroid 2-related factor 2 (Nrf2), which regulates the expression of several antioxidant proteins to restore cellular homeostasis, has been shown to play a pivotal role in DOX-induced cardiotoxicity pathogenesis.^15,16 Notably, the Nrf2/SLC7A11/GPX4 signaling axis has been identified as a key regulator of ferroptosis, contributing to the alleviation of DOX-induced cardiotoxicity as demonstrated in previous studies.^14,17–19

Eleutherococcus senticosus (ES) is a medicinal plant belonging to the Araliaceae family,²⁰ which has been pharmacologically recognized as a rich source of bioactive polyphenols with demonstrated antioxidant, anti-influenza, and anti-inflammatory activities.^21,22 Among its major constituents, Eleutheroside B and Eleutheroside E (EE) are considered the primary bioactive components.²³ It was reported that EE ameliorated high-altitude heart injury by regulating NLRP3 inflammasome-mediated pyroptosis.²⁴ In addition, EE can not only reverse cerebral ischemia-reperfusion injury²⁵ but also protect against myocardial ischemia/reperfusion injury and decreases NF-κB activation.²⁶ However, whether EE alleviates dox-induced cardiotoxicity has not been determined.

In the study, the protective effects of EE against DOX-induced cardiotoxicity were investigated. We speculated that EE ameliorates dox-induced cardiac injury by inhibiting ferroptosis via the Nrf2/X-CT/GPX4 pathway.

Materials and Methods

Animal Model

All experimental procedures were approved by the Animal Ethics Committee of Southern Medical University (Approval No. LAEC2024020) and conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Male C57BL/6 mice (6-8 weeks old) were randomly divided into four experimental groups: (a) Sham group, (b) DOX group, (c) DOX + low-dose EE (50 mg/kg/day) group, and (d) DOX + high-dose (100 mg/ kg/day) EE group. To establish acute DOX-induced cardiotoxicity models, mice in DOX-treated groups received a single intraperitoneal (i.p.) injection of DOX (MCE, HY-15142) at a dose of 15 mg/kg.^27,28 Concurrently, EE-treated groups were administered EE (50 or 100 mg/kg/day, i.p.) for five consecutive days.^24,29 Body weight measurements and echocardiographic assessments were performed prior to sacrifice at day 5 post-treatment.²⁷ Mice were sacrificed after anesthesia for subsequent experiments.

Echocardiography

Cardiac function was assessed by transthoracic echocardiography (Vevo 2100 System). Two-dimensionally guided M-mode echocardiography was conducted to quantify left ventricular functional parameters, including fractional shortening (LVFS) and ejection fraction (LVEF).

Isolation and Culture of Neonatal Rat Cardiomyocytes

Primary neonatal rat cardiomyocytes (NRCs) were isolated from 2-3-day-old Sprague-Dawley rats using established protocol.²⁷ Purified cardiomyocytes were cultured in high-glucose DMEM supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin, and 0.1 mM bromodeoxyuridine under standard conditions (37 °C, 5% CO₂). NRCs were randomly divided into four groups: (a) Control group, (b) EE group, (c) DOX group, and (d) DOX + EE group. NRCs were treated with 0.1 μM DOX or 12.5 μM EE for 48 h according to the experiment plan. Nrf2 siRNA (si-Nrf2) and negative control siRNA (si-NC) were introduced into the appropriate cell groups using the transfection method prescribed by the manufacturer (RIBOBIO, Guangzhou). The groups were designed as follows: (a) Control group; (b) DOX group, (c) DOX + EE group, (d) DOX + EE + si-NC group, and (e) DOX + EE + si-Nrf2 group.

Hematoxylin-Eosin Staining

Myocardial tissue sections (4 μm thickness) were deparaffinized with xylene and rehydrated through graded ethanol series prior to hematoxylin-eosin (H&E) staining. Next, stained sections were visualized under a bright-field microscope (Leica DMi8) and digitally captured. Quantitative morphometric analysis of cardiomyocyte cross-sectional areas was performed with ImageJ software.

Wheat Germ Agglutinin Staining

Paraffin-embedded heart slices (4-µm) were processed through standard paraffin embedding protocols followed by wheat germ agglutinin (WGA) staining. Fluorescent images were acquired using a confocal laser scanning microscope. The cardiomyocyte's surface area was measured by Image J software.

Cell Viability Assays

Cardiomyocyte vitality was assessed by Hoechst 33342/propidium iodide (PI) staining and CCK-8 assays. CCK-8 assay was performed according to manufacturer's protocol (Beyotime, Shanghai, C0042). Absorbance measurements at 450 nm (OD450) were obtained using a microplate reader (Thermo Varioskan LUX), and relative cell viability was calculated according to the OD450.

For the Hoechst 33342/PI staining, cells were stained with 10 μM PI (37 °C, 30 min) and 20 μM Hoechst 33342 (37 °C, 10 min) in dark conditions. Afterwards, the cardiomyocytes were photographed using a fluorescent microscope and analyzed by ImageJ. Viability index was calculated as (PI-positive cells / Hoechst-positive cells) × 100%.

Phalloidin Staining

Cardiomyocyte morphology was analyzed through phalloidin staining to visualize cellular outlines. Following staining by a phalloidin staining kit (Yeasen, Shanghai, 40737ES75), cardiomyocyte surface areas were quantified using ImageJ software with confocal microscopy images (Leica SP8) for measurement.

Western Blot

Proteins were extracted from both in-vitro NRCs and in-vivo cardiac tissues using the RIPA lysis buffer (Beyotime, P0013B) containing 1% protease/phosphatase inhibitor cocktail (MedChemExpress, HYK0021 and HY-K0010). Protein extraction procedures followed established methodologies.^27,30 Western blot analysis was performed with primary antibodies against: Nrf2 (1:1000, Cell Signaling Technology, 20733), GPX4 (1:1000, Proteintech, 16396-1-AP), SLC7A11 (1:1000, Proteintech, 32384-1-AP), and β-Actin (1:10000, Proteintech, 66009-1-Ig) as loading control.

Quantitative Real-Time PCR

Quantitative real-time PCR (qRT-PCR) was performed according to a previously described protocol.³⁰ The primer sequences were as follows: Ptgs2 (reverse: tcaggaagctccttatttccctt, forward: tgcactatggttacaaaagctgg), Nrf2 (reverse: tgccttcagtgtgcttctggttg, forward: gccttcctctgctgccattagtc), and Actb (reverse: gccggactcatcgtactcc, forward: gtgacgttgacatccgtaaaga).

Malondialdehyde Measurement

Malondialdehyde (MDA) levels in cardiomyocytes and myocardial tissues were quantified by lipid peroxidation assay kit (Beyotime, S0131S). Briefly, samples were homogenized in ice-cold lysis buffer and subsequently incubated with thiobarbituric acid at 100 °C for 15 min. Following centrifugation at 12,000×g for 10 min, the supernatant absorbance was measured at 532 nm using a microplate reader (Varioskan LUX, Thermo Scientific).

Measurement of Ferrous Ion

Ferrous ion (Fe²⁺) levels were evaluated using FerroOrange fluorescent probe according to manufacturer's protocol (Dojindo, Japan, F374). Briefly, cardiomyocytes were loaded with 1 μM FerroOrange fluorescent probe in serum-free medium (37 °C, 5% CO₂) for 30 min. Subsequently, cardiomyocytes were observed and images by a Leica SP8 confocal microscope, while fluorescence intensity was quantified by ImageJ software.

Evaluation of Oxidative Stress

As previously described,³⁰ intracellular reactive oxygen species (ROS) and lipid peroxidation levels were quantified using 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA, 10 μM) and C11-BODIPY (10 μM) respectively.³⁰ Cells were loaded with DCFH-DA or C11-BODIPY in serum-free medium (37 °C, 30 min, 5% CO₂) followed by incubation with 20 μM Hoechst 33342 solution for 10 min and three PBS washes. Fluorescence imaging was performed using a Leica SP8 confocal microscope, while fluorescence intensity was quantified by ImageJ software.

Statistical Analysis

Data are expressed as mean ± standard deviation (SD). Statistical comparisons were performed using one-way ANOVA with Tukey's post-hoc analysis in GraphPad Prism (v8.0). P-values less than .05 were considered statistically significant.

Results

EE Attenuates DOX-Induced Cardiomyocyte Toxicity In-Vitro

To investigate the cytotoxicity of EE, NRCs were exposed to varying EE concentrations (12.5, 25, 50, and 100 μM) for 48 h. As shown in Figure 1A, EE treatment demonstrated no significant effect on cardiomyocyte viability compared to untreated controls across all tested concentrations. Subsequent evaluation of EE's protective capacity against DOX-induced cardiotoxicity revealed that co-treatment with 12.5 µM EE and 0.1 µM DOX for 48 h produced the most significant attenuation of cytotoxic effects (Figure 1B). Based on these findings, 12.5 µM EE was selected for subsequent experimental analyses.

Figure 1.

EE attenuates DOX-induced cardiotoxicity in-vitro. (A, B) NRC viability was quantified using CCK-8 assay with absorbance measurement at 450 nm (OD450) (n = 6-8). (C, D) Cellular morphology was analyzed by phalloidin staining to delineate cardiomyocyte boundaries. Cross-sectional areas were quantified using ImageJ (n = 6). Scale bar: 100 μm. (E, F) Cellular damage was assessed via Hoechst 33342/PI dual staining. Apoptotic index was calculated as PI⁺/Hoechst⁺ cell ratio using ImageJ (n = 6). Scale bar: 250 μm. Data are presented as mean ± SD and statistically analyzed using one-way ANOVA. ns: not significant. * P < .05, ** P < .01, *** P < .001.

Morphometric analysis through phalloidin staining revealed DOX-induced cardiomyocyte atrophy, while the reduction of cellular surface area was reversed by EE co-treatment (Figure 1C and D). Cell injury quantification via Hoechst 33342/PI dual staining showed a marked reduction in cell injury index in EE co-treated groups compared to DOX-only exposure (Figure 1E and F). Collectively, these results demonstrate that EE effectively mitigates DOX-induced cardiotoxicity in-vitro through preservation of cardiomyocyte morphology and reduction of cell injury.

EE Ameliorates DOX-Induced Cardiotoxicity In-Vivo

To evaluate the cardioprotective efficacy of EE against DOX-induced cardiotoxicity in-vivo, acute Dox-induced cardiotoxicity models of mouse were established. Echocardiographic analysis demonstrated that EE co-treatment (50 or 100 mg/kg/day) significantly attenuated DOX-induced impairment of left ventricular function, as evidenced by preserved left ventricular ejection fraction (LVEF) and fractional shortening (LVFS) compared to DOX-only treated animals (Figure 2A-C).

Figure 2.

EE attenuates DOX-induced cardiotoxicity in-vivo. (A-C) Cardiac function was assessed via two-dimensional M-mode echocardiography. Both low- (50 mg/kg/day, i.p.) and high-dose (100 mg/kg/day, i.p.) EE significantly improved left ventricular ejection fraction (LVEF) and fractional shortening (FS) in DOX-treated mice (n = 4). (D) Heart weight-to-body weight (HW/BW) ratio was calculated (n = 6). (E-F) Cardiac cross-sectional area was quantified using ImageJ software following hematoxylin-eosin (H&E) staining (n = 5). Scale bar: 1 mm. (G-H) Cardiomyocyte boundaries were delineated by wheat germ agglutinin (WGA) staining. Cellular cross-sectional areas were quantified using ImageJ (n = 6), Scale bar: 50 μm. Data are presented as mean ± SD and statistically analyzed using one-way ANOVA. ns: not significant. * P < .05, ** P < .01, *** P < .001.

Meanwhile, DOX administration markedly reduced the heart weight-to-body weight (HW/BW) ratio relative to controls, whereas EE treatment dose-dependently reversed this pathological reduction (Figure 2D). H&E staining and WGA staining revealed significant myocardial atrophy in DOX-treated mice, characterized by decreased cardiac cross-sectional area and reduced cardiomyocyte surface area compared to controls. Both low- and high-dose EE treatments effectively mitigated this DOX-induced myocardial atrophy (Figure 2E-H).

Collectively, these findings establish that EE confers protection against DOX-induced cardiotoxicity in-vivo through preservation of cardiac structure and function.

EE Inhibits DOX-Induced Ferroptosis In-Vitro

Ferroptosis is characterized by lipid peroxides and accumulation of intracellular iron. Thus, intracellular ROS were first quantified by DCFH-DA assays. As shown in Figure 3A and B, DOX exposure significantly increased ROS levels compared to controls (P < .01), while EE co-treatment partially reversed this oxidative stress. Consistent with DCFH-DA assays, C11-BODIPY staining confirmed that EE treatment reduced the oxidized/non-oxidized fluorescence ratio compared to DOX-only group (Figure 3C and D). DOX administration elevated MDA levels versus controls, indicative of enhanced lipid peroxidation. EE treatment attenuated DOX-induced MDA accumulation (Figure 3E), demonstrating EE's capacity to inhibit lipid peroxidation.

Figure 3.

EE inhibits DOX-induced ferroptosis via oxidative stress modulation in-vitro. (A, B) Intracellular oxidative stress in NRCs was quantified using DCFH-DA fluorescence staining (n = 6). Fluorescence intensity was analyzed using ImageJ software. Scale bar: 250 μm. (C, D) Lipid peroxidation was assessed via C11-BODIPY staining. The oxidized/non-oxidized fluorescence ratio was calculated to evaluate lipid ROS levels (n = 4). Scale bar: 250 μm. (E) Malondialdehyde (MDA) levels were determined spectrophotometrically at 532 nm (n = 4). (F) Ptgs2 mRNA expression levels were analyzed by qRT-PCR and normalized to Actb (n = 5). (G, H) Ferrous ion was quantified via FerroOrange fluorescent probe staining and analyzed using ImageJ software (n = 5). Scale bar: 25 μm. Data are presented as mean ± SD and statistically analyzed using one-way ANOVA. ns: not significant. * P < .05, ** P < .01, *** P < .001.

Meanwhile, ferrous ion quantification by FerroOrange fluorescent probe revealed an increase in intracellular levels of Fe²⁺ in DOX-treated cardiomyocytes compared to control, which was significantly attenuated by EE co-treatment (Figure 3G). Complementary analysis of ferroptosis marker prostaglandin endoperoxide synthase 2 (Ptgs2) via qRT-PCR also demonstrated the upregulation of Ptgs2 mRNA in DOX-exposed cells, with EE treatment reducing this elevation (Figure 3F).

These results collectively demonstrated that EE inhibited Dox-induced ferroptosis in-vitro.

EE Activates Nrf2/SLC7A11/GPX4 Pathway

Given that Nrf2/SLC7A11/GPX4 signaling axis has been identified as a key regulator of ferroptosis, we subsequently determine whether EE affected the ferroptosis by regulating Nrf2/SLC7A11/GPX4 signal pathway. Western blot analysis revealed that EE treatment significantly upregulated Nrf2 protein expression in DOX-exposed NRCs (Figure 4A and B). Concomitant increases in ferroptosis-inhibitory proteins SLC7A11 and GPX4 were observed in EE co-treated groups compared to DOX-only controls (Figure 4A, C, and D).

Figure 4.

EE rescues DOX-induced suppression of the Nrf2/SLC7A11/GPX4 axis. (A-D) In-vitro Western blot analysis of GPX4, SLC7A11, and Nrf2 protein expression in neonatal rat cardiomyocytes (n = 6). (E-H) In-vivo Western blot analysis of GPX4, SLC7A11, and Nrf2 protein levels in myocardial tissues (n = 6). (I-K) In-vivo qRT-PCR quantification of Nfe2l2 (Nrf2) and Ptgs2 mRNA levels normalized to Actb (β-actin) (n = 5). Data are presented as mean ± SD and statistically analyzed using one-way ANOVA. ns: not significant. * P < .05, ** P < .01, *** P < .001.

Consistent with in-vitro findings, DOX administration in mice downregulated cardiac Nrf2/SLC7A11/GPX4 pathway components versus sham controls. EE treatment (50 and 100 mg/kg) reversed these effects, restoring the levels of Nrf2, SLC7A11, and GPX4 expression (Figure 5A-D). Simultaneously, EE also abolished DOX-induced Ptgs2 mRNA overexpression in-vivo.

Figure 5.

Nrf2 knockdown reversed EE-mediated ferroptosis protection in-vitro. (A-B) Western blot analysis validated Nrf2 knockdown efficiency and its downstream effects on SLC7A11 and GPX4 protein expression in neonatal rat cardiomyocytes (NRCs) (n = 6). (C-D) qRT-PCR quantification of Nfe2l2 (Nrf2) and Ptgs2 mRNA levels normalized to Actb (n = 6). (E-F) Lipid ROS levels were assessed via C11-BODIPY staining (n = 4). Scale bar: 250 μm. (G) Malondialdehyde (MDA) levels were determined spectrophotometrically at 532 nm (n = 4). (H) Intracellular Fe²⁺ levels were quantified using FerroOrange fluorescence staining (n = 5). Scale bar: 25 μm. Data are presented as mean ± SD and statistically analyzed using one-way ANOVA. ns: not significant. * P < .05, ** P < .01, *** P < .001.

Collectively, these findings establish that EE reversed Dox-induced inhibition of cardiac Nrf2/SLC7A11/GPX4 pathway, which might be responsible for cardioprotection of EE against Dox-induced ferroptosis.

Nrf2 Knockdown Inhibited EE-Mediated Ferroptosis Protection In-Vitro

To investigate the mechanistic role of the Nrf2/SLC7A11/GPX4 pathway in EE-mediated protection, Nrf2 expression was genetically silenced by si-RNA. Western blot analysis conﬁrmed the efﬁciency of Nrf2 knockdown by si-Nrf2 at the protein level (Figure 6A and B). Meanwhile, Nrf2 knockdown also partly abolished EE-induced increases in ferroptosis-inhibitory proteins SLC7A11 and GPX4 in DOX-treated cardiomyocytes (Figure 6A and B). qRT-PCR analysis revealed that Nrf2 knockdown reversed EE-mediated suppression of Ptgs2 mRNA in DOX-treated cardiomyocytes (Figure 6C and D).

Figure 6.

Nrf2 knockdown abolishes EE-mediated cardioprotection in-vitro. (A, B) Cardiomyocyte morphology was analyzed by phalloidin staining, with cross-sectional areas quantified using ImageJ software (n = 6). Scale bar: 100 μm. (C, D) Apoptotic index was assessed via Hoechst 33342/PI dual staining, calculated as the ratio of PI⁺ to Hoechst⁺ cells (n = 6). Scale bar: 250 μm. Data are presented as mean ± SD and statistically analyzed using one-way ANOVA. ns: not significant. * P < .05, ** P < .01, *** P < .001.

As for lipid peroxidation, C11-BODIPY staining and MDA quantification demonstrated partly abolition of EE's anti-lipid peroxidation effects upon Nrf2 knockdown (Figure 6E-G). In addition, intracellular levels of Fe²⁺ increase in the DOX + EE + si-Nrf2 group, compared to that in the DOX + EE group, suggesting that Nrf2 knockdown also reversed EE-induced decrease in ferrous ion.

Collectively, these findings demonstrate that Nrf2 signaling is indispensable for EE's cardioprotective effects against DOX-induced ferroptosis.

Nrf2 Knockdown Inhibited EE-Mediated Cardioprotection In-Vitro

Following confirmation that Nrf2 silencing negates EE's anti-ferroptotic effects, we further investigated its impact on cytoprotection. Hoechst 33342/PI dual staining demonstrated increase in PI-positive cells in the DOX + EE + siNrf2 group versus DOX + EE controls (Figure 6A and B). Phalloidin-based morphometric analysis revealed a corresponding reduction in cardiomyocyte surface area in Nrf2-deficient groups compared to EE-treated cells (Figure 6C and D), indicating abolition of EE's anti-atrophic effects. Taken together, these results demonstrated that knockdown of Nrf2 abolished the cardioprotective effects of EE in-vitro.

Discussion

DOX, a broad-spectrum anthracycline chemotherapeutic, remains a first-line oncology agent whose clinical utility is constrained by dose-dependent cardiotoxicity.^31–33 This study provides mechanistic evidence that EE mitigates DOX-associated cardiac injury through ferroptosis inhibition.

EE has demonstrated cardioprotective efficacy against diverse cardiovascular pathologies, including high-altitude-induced cardiac injury,²⁴ and myocardial ischemia-reperfusion injury.²⁶ Consistent with previously reported cardioprotective effects, this study demonstrates that EE not only prevented cardiomyocyte injury in in-vitro DOX-induced myocardial injury models but also preserves cardiac function in in-vivo murine models. Although chronic DOX-induced myocardial injury models predominantly manifest compensatory hypertrophy or decompensated cardiac enlargement, accumulating evidence from in-vivo and in-vitro studies demonstrates that acute DOX exposure induces cardiomyocyte atrophy, characterized by reduced surface area of cardiomyocyte.^34–36 This observation supports the hypothesis that in acute DOX cardiotoxicity models, cardiomyocyte atrophy constitutes a pathognomonic morphological alteration associated with myocardial damage.³⁷ In this study, morphometric analysis also revealed DOX-induced cardiomyocyte atrophy, while the reduction of cellular surface area was reversed by EE co-treatment. Collectively, these findings establish that EE confers protection against DOX-induced cardiotoxicity.

Emerging evidence has established ferroptosis—an iron-dependent cell death pathway driven by lipid peroxidation—as a critical mediator in the pathogenesis of DOX-induced cardiotoxicity.³⁸ Notably, EE exhibits documented antioxidant properties, demonstrating neuroprotective efficacy against radiation-induced cerebral injury through oxidative damage mitigation.^39,40 Complementary studies also reveal EE's capacity to attenuate hypoxia-reoxygenation injury in H9c2 cardiomyocytes via oxidative stress reduction and metabolic pathway reprogramming.²⁶ Given the central role of lipid peroxidation in ferroptosis pathogenesis, we hypothesized whether EE attenuates DOX-induced cardiotoxicity via suppression of ferroptosis pathways. Through DCFH-DA assays, C11-BODIPY staining and MDA measurement, we confirmed the EE's capacity to inhibit lipid peroxidation. Meanwhile, EE also reduced intracellular Fe²⁺ accumulation and decreased ferroptosis marker Ptgs2 mRNA level, supporting the theory that EE could prevent ferroptosis induced by DOX.

Since Nrf2/SLC7A11/GPX4 signaling axis has been identified as a key regulator of ferroptosis in DOX-induced cardiotoxicity,^14,17–19 we speculated whether EE prevent DOX-induced ferroptosis by regulating Nrf2/SLC7A11/GPX4 signaling axis. Experimental evidence revealed that EE upregulated nuclear Nrf2 expression and subsequent activation of downstream antioxidants SLC7A11 and GPX4, which was consistent with previous findings in MPTP-induced Parkinson's disease models.⁴¹ Genetic validation through Nrf2 silencing abolished EE-mediated cardioprotection, restoring lipid peroxidation to DOX-levels and increasing intracellular Fe²⁺ accumulation and ferroptosis marker Ptgs2 mRNA level. These findings confirm that EE suppressed ferroptosis via Nrf2/SLC7A11/GPX4 signaling.

Nrf2 is a critical regulator of cellular ferroptosis resistance, with its activity controlled by a complex upstream regulatory network. Specifically, the Keap1-Cul3 E3 ubiquitin ligase complex binds to Nrf2, mediating its constitutive ubiquitination and degradation.^42,43 However, under oxidative stress or electrophilic stimuli, Keap1 undergoes conformational change and releases Nrf2. This enables Nrf2 to escape degradation, leading to increased protein levels and functional activation.^42,43 Additionally, kinase signaling pathways—including PI3K/AKT and AMPK—enhance Nrf2 transcriptional activity through phosphorylation, representing another essential upstream regulatory mechanism.^28,44 Through molecular docking, we found that EE was predicted to form several hydrogen bonds and a Pi-Sigma interaction with Keap1 (Figure S1). Moreover, molecular dynamics simulations were employed to assess the stability of the EE-Keap1 complex. Root mean square deviation (RMSD, Figure S2) and radius of gyration (Rg, Figure S3) analyses exhibited minimal structural fluctuations and a compact conformation, respectively. The root mean square fluctuation (RMSF, Figure S4) profile demonstrated limited mobility of amino acid residues. Collectively, these results indicate that the EE-Keap1 complex exhibits stable structural properties. EE may activate the Nrf2/SLC7A11/GPX4 pathway by binding to Keap1, thereby inhibiting Keap1-mediated Nrf2 degradation.

Nevertheless, there are some limitations in our study. One limitation is that we did not investigate whether EE regulated pyroptosis in DOX-treated cardiomyocytes. It was reported that EE reduces inflammation and pyroptosis in the hearts of high-altitude-induced heart injury rats.²⁴ Given that pyroptosis also serves as a critical mechanism underlying DOX-induced cardiomyocyte toxicity,^45,46 it is plausible that EE may exert cardioprotective effects through pyroptosis inhibition. Another limitation of this study is the lack of experimental validation confirming the direct interaction between EE and Keap1, or specifically whether EE inhibits Keap1-mediated Nrf2 degradation through binding to Keap1. These issues should be addressed in further studies.

In summary, our study demonstrated that EE reduced DOX-induced cardiotoxicity by activating Nrf2/SLC7A11/GPX4 signaling axis and subsequently preventing ferroptosis. EE may serve as a promising candidate to protect against DOX-induced cardiotoxicity.

Supplemental Material

sj-docx-1-cpt-10.1177_10742484261428559 - Supplemental material for Eleutheroside E Attenuates Doxorubicin-Induced Cardiotoxicity by Suppressing Ferroptosis Through Activation of the Nrf2/SLC7A11/GPX4 Signaling Pathway

Supplemental material, sj-docx-1-cpt-10.1177_10742484261428559 for Eleutheroside E Attenuates Doxorubicin-Induced Cardiotoxicity by Suppressing Ferroptosis Through Activation of the Nrf2/SLC7A11/GPX4 Signaling Pathway by Peng Sun, MD, Liheng Chen, MD, XiangzhouChen, MD, Xuwei Zhang, MD, Junjie Guan, MD, Hongwei Mo, MD, Yu Liang, MD, Jingchao Li, MD, Jing Yan, MD, DeshuChen, MD, Chongbin Zhong, MD, and Pingzhen Yang, MD in Journal of Cardiovascular Pharmacology and Therapeutics

Supplemental Material

sj-pdf-2-cpt-10.1177_10742484261428559 - Supplemental material for Eleutheroside E Attenuates Doxorubicin-Induced Cardiotoxicity by Suppressing Ferroptosis Through Activation of the Nrf2/SLC7A11/GPX4 Signaling Pathway

Supplemental material, sj-pdf-2-cpt-10.1177_10742484261428559 for Eleutheroside E Attenuates Doxorubicin-Induced Cardiotoxicity by Suppressing Ferroptosis Through Activation of the Nrf2/SLC7A11/GPX4 Signaling Pathway by Peng Sun, MD, Liheng Chen, MD, XiangzhouChen, MD, Xuwei Zhang, MD, Junjie Guan, MD, Hongwei Mo, MD, Yu Liang, MD, Jingchao Li, MD, Jing Yan, MD, DeshuChen, MD, Chongbin Zhong, MD, and Pingzhen Yang, MD in Journal of Cardiovascular Pharmacology and Therapeutics

Footnotes

ORCID iD

Pingzhen Yang

Ethics Approval and Consent to Participate

The animal experiments were performed with the approval of the Ethics Committee for Animal Experimentation of the Zhujiang Hospital of Southern Medical University (approval number: LEAC2024020) on Feb. 21, 2024. All animal care and experiments were carried out according to the Guidelines for the Care and Use of Laboratory Animals formulated by the Ministry of Science and Technology of China.

Author Contributions

C.Z. and P.Y. conceived and designed the study. P.S., L.C., X.C., X.Z., J.G., and H.M. conducted the literature review and data curation. P.S., L.C., and C.Z. drafted the manuscript with critical revisions from Y.L., J.Y., D.C., and J.L. who carried out the experimental validation. All authors reviewed and approved the final version of the manuscript.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the Science and Technology Program of Guangzhou (2023A04J2408, 2023A04J2411, and 2023A04J2412).

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability

The original data analyzed during the current study are available from the corresponding author upon reasonable request.

Supplemental Material

Supplemental material for this article is available online.

References

Mattioli

Ilari

Colotti

Mosca

Fazi

Colotti

, et al. Doxorubicin and other anthracyclines in cancers: Activity, chemoresistance and its overcoming. Mol Aspects Med. 2023;93:101205.

Cardinale

Colombo

Bacchiani

, et al. Early detection of anthracycline cardiotoxicity and improvement with heart failure therapy. Circulation. 2015;131(22):1981-1988.

Chen

Shi

Dai

. Research progress of therapeutic drugs for doxorubicin-induced cardiomyopathy. Biomed Pharmacother. 2022;156:113903.

Rawat

Jaiswal

Khurana

Bhatti

Navik

, et al. Doxorubicin-induced cardiotoxicity: An update on the molecular mechanism and novel therapeutic strategies for effective management. Biomed Pharmacother. 2021;139:111708.

Kong

Guo

Song

, et al. Underlying the mechanisms of doxorubicin-induced acute cardiotoxicity: Oxidative stress and cell death. Int J Biol Sci. 2022;18(2):760-770.

Chen

Kang

Kroemer

Tang

, et al. Broadening horizons: The role of ferroptosis in cancer. Nat Rev Clin Oncol. 2021;18(5):280-296.

Cao

Yin

, et al. Ferroptosis: Past, present and future. Cell Death Dis. 2020;11(2):88.

Tang

Chen

Kang

Kroemer

, et al. Ferroptosis: Molecular mechanisms and health implications. Cell Res. 2021;31(2):107-125.

Stockwell

. Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell. 2022;185(14):2401-2421.

10.

Ursini

Maiorino

. Lipid peroxidation and ferroptosis: The role of GSH and GPx4. Free Radic Biol Med. 2020;152:175-185.

11.

Ursini

Bosello Travain

Cozza

, et al. A white paper on phospholipid hydroperoxide glutathione peroxidase (GPx4) forty years later. Free Radic Biol Med. 2022;188:117-133.

12.

Koppula

Zhuang

Gan

. Cystine transporter SLC7A11/xCT in cancer: Ferroptosis, nutrient dependency, and cancer therapy. Protein Cell. 2021;12(8):599-620.

13.

Jiang

Wang

Zhang

, et al. ATF4 Protects against sorafenib-induced cardiotoxicity by suppressing ferroptosis. Biomed Pharmacother. 2022;153:113280.

14.

Zhang

Pan

Huang

, et al. Hydrogen sulfide protects cardiomyocytes from doxorubicin-induced ferroptosis through the SLC7A11/GSH/GPx4 pathway by Keap1 S-sulfhydration and Nrf2 activation. Redox Biol. 2024;70:103066.

15.

Torrente

DeNicola

. Targeting NRF2 and its downstream processes: Opportunities and challenges. Annu Rev Pharmacol Toxicol. 2022;62:279-300.

16.

Mirzaei

Zarrabi

Hashemi

, et al. Nrf2 signaling pathway in chemoprotection and doxorubicin resistance: Potential application in drug discovery. Antioxidants (Basel). 2021;10(3).

17.

Jiang

Chen

Tian

, et al. Tanshinone I inhibits doxorubicin-induced cardiotoxicity by regulating Nrf2 signaling pathway. Phytomedicine. 2022;106:154439.

18.

Liu

Chen

Han

, et al. SLC7A11/GPX4 Inactivation-Mediated ferroptosis contributes to the pathogenesis of triptolide-induced cardiotoxicity. Oxid Med Cell Longev. 2022;2022:3192607.

19.

Wang

Huang

, et al. Astragaloside IV regulates the ferroptosis signaling pathway via the Nrf2/SLC7A11/GPX4 axis to inhibit PM2.5-mediated lung injury in mice. Int Immunopharmacol. 2022;112:109186.

20.

Ferns

Yan

, et al. Acanthopanax senticosus: Photochemistry and anticancer potential. Am J Chin Med. 2016;44(8):1543-1558.

21.

Luo

Wei

, et al. Natural medicines for the treatment of fatigue: Bioactive components, pharmacology, and mechanisms. Pharmacol Res. 2019;148:104409.

22.

Lau

Yue

Chan

, et al. A review on the immunomodulatory activity of Acanthopanax senticosus and its active components. Chin Med. 2019;14:25.

23.

Yang

Liu

Yang

, et al. Tea saponin additive to extract eleutheroside B and E from Eleutherococcus senticosus by ultrasonic mediation and its application in a semi-pilot scale. Ultrason Sonochem. 2022;86:106039.

24.

Jia

Shen

Zhao

, et al. Eleutheroside E from pre-treatment of Acanthopanax senticosus (Rupr.etMaxim.) Harms ameliorates high-altitude-induced heart injury by regulating NLRP3 inflammasome-mediated pyroptosis via NLRP3/caspase-1 pathway. Int Immunopharmacol. 2023;121:110423.

25.

Liu

Gao

. Eleutheroside E alleviates cerebral ischemia-reperfusion injury in a 5-hydroxytryptamine receptor 2C (Htr2c)-dependent manner in rats. Bioengineered. 2022;13(5):11718-11731.

26.

Wang

Yang

. Eleutheroside E decreases oxidative stress and NF-κB activation and reprograms the metabolic response against hypoxia-reoxygenation injury in H9c2 cells. Int Immunopharmacol. 2020;84:106513.

27.

Chen

Zhong

, et al. Elabela ameliorates doxorubicin-induced cardiotoxicity by promoting autophagic flux through TFEB pathway. Pharmacol Res. 2022;178:106186.

28.

Zhang

Kong

, et al. FNDC5 Alleviates oxidative stress and cardiomyocyte apoptosis in doxorubicin-induced cardiotoxicity via activating AKT. Cell Death Differ. 2020;27(2):540-555.

29.

Wang

Shen

Pei

, et al. Eleutheroside B ameliorated high altitude pulmonary edema by attenuating ferroptosis and necroptosis through Nrf2-antioxidant response signaling. Biomed Pharmacother. 2022;156:113982.

30.

Zhong

Que

, et al. Amine oxidase copper-containing 3 aggravates cardiac remodelling by generating hydrogen peroxide after myocardial infarction. J Pathol. 2023;260(2):190-202.

31.

Shabalala

Muller

CJF

Louw

Johnson

, et al. Polyphenols, autophagy and doxorubicin-induced cardiotoxicity. Life Sci. 2017;180:160-170.

32.

Wang

Zhang

Xiao

, et al. Molecular mechanisms of doxorubicin-induced cardiotoxicity: Novel roles of sirtuin 1-mediated signaling pathways. Cell Mol Life Sci. 2021;78(7):3105-3125.

33.

Pharoah

Zhang

Khodade

, et al. Hydropersulfides (RSSH) attenuate doxorubicin-induced cardiotoxicity while boosting its anticancer action. Redox Biol. 2023;60:102625.

34.

Hullin

Métrich

Sarre

, et al. Diverging effects of enalapril or eplerenone in primary prevention against doxorubicin-induced cardiotoxicity. Cardiovasc Res. 2018;114(2):272-281.

35.

Xia

Chen

Liu

Fletcher

Jensen

Cheng

, et al. Doxorubicin induces cardiomyocyte apoptosis and atrophy through cyclin-dependent kinase 2-mediated activation of forkhead box O1. J Biol Chem. 2020;295(13):4265-4276.

36.

Yamamoto

Hoshino

Ito

, et al. Atrogin-1 ubiquitin ligase is upregulated by doxorubicin via p38-MAP kinase in cardiac myocytes. Cardiovasc Res. 2008;79(1):89-96.

37.

Chen

Yan

Yang

. Cardiomyocyte atrophy, an underestimated contributor in doxorubicin-induced cardiotoxicity. Front Cardiovasc Med. 2022;9:812578.

38.

Liang

Feng

Zandkarimi

, et al. Ferroptosis surveillance independent of GPX4 and differentially regulated by sex hormones. Cell. 2023;186(13):2748-2764.e22.

39.

Gębalski

Małkowska

Gawenda-Kempczyńska

, et al. Eleutherococcus divaricatus fruits decrease hyaluronidase activity in blood serum and protect from antioxidative damages in in vitro model. Int J Mol Sci. 2024;25(4).

40.

Song

Duan

, et al. The therapeutic effect of acanthopanax senticosus components on radiation-induced brain injury based on the pharmacokinetics and neurotransmitters. Molecules. 2022;27(3).

41.

Yao

Liao

Qiu

, et al. Effect of Eleutheroside E on an MPTP-induced Parkinson's disease cell model and its mechanism. Molecules. 2023;28(9).

42.

Shanmugam

Challa

Litovsky

, et al. Enhanced Keap1-Nrf2 signaling protects the myocardium from isoproterenol-induced pathological remodeling in mice. Redox Biol. 2019;27:101212.

43.

Kang

, et al. Erianin alleviates doxorubicin-induced cardiotoxicity by activating the Keap1-Nrf2 signaling pathway. Phytomedicine. 2025;141:156684.

44.

Wang

Chen

Zhou

, et al. Ferroptosis is essential for diabetic cardiomyopathy and is prevented by sulforaphane via AMPK/NRF2 pathways. Acta Pharm Sin B. 2022;12(2):708-722.

45.

Fang

Yang

, et al. Amentoflavone mitigates doxorubicin-induced cardiotoxicity by suppressing cardiomyocyte pyroptosis and inflammation through inhibition of the STING/NLRP3 signalling pathway. Phytomedicine. 2023;117:154922.

46.

Zhang

Jin

Zhang

, et al. USP14 Modulates cell pyroptosis and ameliorates doxorubicin-induced cardiotoxicity by deubiquitinating and stabilizing SIRT3. Free Radic Biol Med. 2024;225:741-757.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.52 MB

0.92 MB