Sage Journals: Discover world-class research

Abstract

Objective: Annexin-A1 (ANXA1) participates in regulating ferroptosis. Ferroptosis is involved in myocardial ischemia-reperfusion injury (MIRI). However, effect and mechanism of ANXA1 in ferroptosis after MIRI remain unclear. Materials and Methods: Gene expression omnibus database was used to screen differentially expressed genes (DEGs), and R package was used to visualize the volcano map and heat map of DEGs in MIRI. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes analyses were used to analyze the related signaling pathways and functions of DEGs. FerrDb database was used to find genes related to ferroptosis. H9c2 cells were cultured under hypoxia/reoxygenation (H/R). Quantitative real-time polymerase chain reaction and western blot detected mRNA and protein expression of relevant genes. Mitochondrial membrane potential was determined by JC-1. Cell viability was assessed using CCK-8. Levels of Fe²⁺, glutathione, malondialdehyde, and reactive oxygen species (ROS) were detected by kits. Results: Genes such as ANXA1 were highly expressed in MIRI compared to normal tissues. Hypoxic cardiomyocytes had enhanced viability after knocking down ANXA1. ANXA1 depletion improved ferroptosis and altered mitochondrial functioning in cardiomyocytes under H/R condition. Ferroptosis inducer Erastin reversed this phenomenon. Phosphorylation levels of c-Jun N-terminal kinase, P38, and Raf in H9c2 cells after ANXA1 silencing were increased. With treatment of RAF inhibitor Sorafenib, above results were reversed. ANXA1 depletion alleviated ferroptosis and mitochondrial damage by activating RAS/Raf/mitogen-activated protein kinase (MAPK) pathway in H/R-induced cardiomyocytes. Conclusions: ANXA1 knockdown reduces cardiomyocyte ferroptosis after MIRI by regulating RAS/Raf/MAPK signaling pathway, which provides new therapeutic targets for MIRI treatment.

Keywords

ANXA1 MAPK ferroptosis myocardial ischemia/reperfusion injury

Highlight

ANXA1 is highly expressed in myocardial ischemia/reperfusion injury (MIRI).

After silencing ANXA1, ferroptosis-induced MIRI improved.

After ANXA1 is silenced, the RAS/Raf/mitogen-activated protein kinase (MAPK) axis is activated.

ANXA1 regulates ferroptosis-induced MIRI by activating the RAS/Raf/MAPK axis.

Introduction

Myocardial infarction (MI) is the leading cause of death in the world.¹ Clinically, ischemic myocardial tissue is salvaged by prompt reperfusion to reduce infarct volume, maintaining left ventricular systolic function, and preventing heart failure. However, reperfusion technique itself can lead to cardiomyocyte damage and worsen heart disease. This is called myocardial ischemia-reperfusion injury (MIRI).² Available studies have shown that reperfusion-induced cardiac damage accounts for 50% of all MI.³ MIRI can be caused by complex mechanisms such as apoptosis, pyroptosis, necrosis, autophagy, insufficient energy supply, intracellular calcium overload, cellular inflammation, and oxidative stress.⁴ A variety of existing strategies to ameliorate ischemic MI and dysfunction have limited efficacy in animal models and clinical applications, suggesting that additional mechanisms require further investigation.

Annexin-A1 (ANXA1) is the first discovered member of the annexin family member and is expressed in the organs of nearly all animals. ANXA1 is involved in mechanisms related to membrane transport and regulates a series of calmodulin-dependent activities on the membrane surface, such as vesicle trafficking, membrane fusion in exocytosis, DNA replication, signaling, cell proliferation, apoptosis, and ion channel formation.⁵ ANXA1 exerts antiinflammatory effects by inhibiting granulocyte migration, which has been validated in various established models of acute, chronic, and systemic inflammatory responses.⁵ ANXA1 is also involved in the regulation of apoptosis. ANXA1 can affect the signal transduction process by activating the two main components of the mitogen-activated protein kinases (MAPKs) signaling pathway: p38 and c-Jun N-terminal kinase (JNK) signaling pathways, which in turn affects the signal transduction process and causes cells to shift from proliferation to apoptosis.⁶ ANXA1 also regulates cell proliferation. ANXA1 inhibits T-cell proliferation stimulated by the monoclonal antibody OKT3,⁷ and inhibits the motional signaling pathway induced by hepatocyte growth factor (HGF).⁸ However, whether ANXA1 participates in the regulation of MIRI and the regulatory mechanism is still unknown.

Ferroptosis is a new type of nonapoptotic cell death caused by intracellular Fe²⁺ overload, depletion of glutathione (GSH), and lipid peroxidation.⁹ Ferroptosis is linked to the pathogenesis of a variety of cardiovascular diseases including MIRI.¹⁰ In MIRI, the accumulation of Fe²⁺ and the depletion of reduced GSH lead to an overproduction of reactive oxygen species (ROS), leading to lipid peroxidation and ferroptosis. Therefore, increasing GSH content in cardiomyocytes, reducing lipid peroxides in cardiomyocytes, or improving Fe²⁺ homeostasis in cardiomyocytes to attenuate ferroptosis are promising strategies for improving myocardial injury. Although there have been some explorations of using drugs or nanoparticles to inhibit ferroptosis to protect MIRI,^11,12 not much has been done on its on-membrane molecular targets. Therefore, it is a shortcut to explore drugs that can target ferroptosis to achieve the goal of mitigating MIRI.

The MAPK family is a core member of the regulation of cell death, specifically the JNK MAPK family and the MAPK p38 family.¹³ Studies have also shown that p38 MAPK has protective or harmful effects on different myocardial injuries. For example, activation of p38 MAPK in mice accelerates acute myocardial injury and death, while the same activation in pigs has no similar effect.¹⁴ In addition, p38 kinase rescues myocardial injury by promoting angiogenesis after MI and participating in fighting cell death.¹⁵ These findings suggest that the role of p38 MAPKs in myocardial injury remains controversial. It has been shown that JNK MAPKs are widely involved in cell death signal transduction. JNK has been shown to play a key role in the apoptosis and programed cell death mechanisms of nonapoptosis, including pyroptosis, necrosis, ferroptosis, and autophagy.¹⁶ Most of the functions performed by JNK MAPKs may be related to their ability to regulate cell death through these programed cell death mechanisms. Fe²⁺ overload activates JNK MAPKs, which in turn enhances insulin sensitivity of human skeletal muscle cells, suggesting that the JNK MAPK pathway may be involved in the process of ferroptosis.¹⁷

This study aimed to investigate whether silencing of ANXA1 can ameliorate ferroptosis in MIRI and its mechanism. Understanding the role of ANXA1 in ferroptosis can provide insights into the molecular pathways involved in MIRI, potentially leading to the identification of novel therapeutic targets. By elucidating the mechanisms through which ANXA1 influences ferroptosis, this research may contribute to the development of strategies to mitigate cell death and improve cardiac function following ischemic events. Additionally, these findings can enhance our understanding of the interplay between different cell death pathways, such as apoptosis and ferroptosis, in the context of myocardial injury, thereby offering a broader perspective for cardiac protection and recovery.

Materials and Methods

Collection Datasets and Genes of Ferroptosis

Gene expression omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) is a high-throughput microarray and the next generation of functional genome sequence data set of an international public repository.¹⁸ We screened differentially expressed genes (DEGs) of ischemia/reperfusion (I/R) from three datasets derived from different samples: GSE160516,¹⁹ GSE4105,²⁰ and GSE10373. GSE160516 included four normal mouse heart tissue samples and 12 mouse I/R tissue samples. GSE4105 collected six pairs of normal rat heart tissue samples and I/R tissue samples. Three groups of H9c2 cells were sequenced by GSE103731. The related genes of ferroptosis were downloaded from the FerrDb database (http://www.zhounan.org/ferrdb/current/).²¹

Identification and Analysis of Common Differential Genes of Myocardial Reperfusion Injury and Ferroptosis

Identifying and analyzing the common DEGs of myocardial reperfusion injury and ferroptosis is the primary task of our research. Log2 fold change (FC)| > 2 and adjusted P < .05 were selected as the cutoff criteria for the identification of relevant DEG. Volcanic maps were created using the ggplot2 package of R²² to visually identify DEGs in the myocardial reperfusion injury dataset (GSE160516, GSE4105, GSE103731). By crossing the DEGs and hemozoin gene-related genes in three datasets, the ferroptosis-related DEGs in MIRI were obtained. Functional enrichment analysis of target genes using R-packs. Protein–protein interaction (PPI) is obtained through the STRING database (https://cn.string-db.org/) with a minimum confidence of 0.400.²³ The interacting network was then reconstructed and visualized using Cytoscape (3.7.2) software to obtain the pivot gene.²⁴

Cell Culture

H9c2 cells were purchased from BeiNa Biological Technology Co., Ltd. The cells were treated with hypoxia/reoxygenation (H/R) to simulate the MIRI state. Cells were seeded in DMEM medium (Invitrogen) containing 10% serum (Invitrogen) in a 37 °C in a 5% CO₂ incubator. The gas condition was changed to 0.1% O₂, 5% CO₂, and 95% N_2. The cells were incubated under hypoxic conditions for 6 h, followed by reoxygenation at 37 °C with 95% air and 5% CO₂ for 12 h.²⁵ Erastin, a cell-permeable quinazolinone, is commonly used as an inducer of ferroptosis. H9c2 cells were treated with Erastin (5μM) for 18 h to induce ferroptosis.

Quantitative Real-Time Polymerase Chain Reaction

The levels of ANXA1 (forward: CATGTACGTTGCTATCCAGGC, reverse: CTCCTTAATGTCACGCACGAT), Pcolce (forward: TTCAGATTGACGGCGTCTCC, reverse: AGCCTCCATCCACAAGAACG), and S100a11 (forward: ATGGCAAAAATCTCCAGCCCTAC, reverse: GGGTCCTCAGGTCCGCTTCT) in cells were detected by quantitative real-time polymerase chain reaction (qPCR).²⁶ Briefly, total RNA was extracted using Trizol reagents (Invitrogen, Carlsbad, CA, USA). The quality and quantity of RNA were determined by agarose gel electrophoresis, and the A260/A280 ratio was determined by spectrophotometer. The A260/A280 ratio of all RNA preparations is about 1.8 to 2.0. mRNA reverse transcription kit (CW2569; Using CWBIO and synthetic cDNA. The reaction parameters set by the qPCR instrument are: 95 °C for 10 min, 95 °C for 15 s, 58 °C for 30 s, 68 °C for 60 s, and 45 cycles. β-actin (forward: CATGTACGTTGCTATCCAGGC, reverse: CTCCTTAATGTCACGCACGAT) was used as the internal reference of mRNA.

Plasmid Construction and Transfection

Sh-ANXA1 (SS Sequence:5'-GGAAUAUGUUCAAGCUGUAAA-3’, AS Sequence:5'-UACAGCUUGAACAUAUUCCUG-3’), and the negative control vector (sh-NC: SS Sequence:5′-UAGCGACUAAACACAUCAAUU-3′, AS Sequence:5′-UUGAUGUGUUUAGUCGCUAUU-3′) were synthesized by GenePharma (Shanghai, China), and packaged in a lentiviral vector. When the cells grew to 50–60% confluence, the cells were washed with ice PBS and replaced with serum-free medium. The cells were transfected with lentiviral vectors in the presence of 10 μg/mL polybenzene and treated with puromycin for one week. The procedure is performed for cell transfection was performed according to the manufacturer's instruction of lipobacteridamine 2000. At 28 h after transfection, Western blot was used to detect the knockdown efficiency.

CCK-8 Assay

Cell viability was analyzed using Cell counting kit-8 (CCK-8, Beyotime, Shanghai, China) according to manufacturer's protocols. Cells were seeded and cultured into 96-well microplates at 5 × 10³/well density in a 100-liter medium (Corning, USA). After 24 h, 10 μL CCK-8 reagent was added to each well and continue incubating for 2 h. All experiments were repeated in triplicate. A 450 nm cell-free well was mapped using a microplate reader as a blank collection for absorption (Bio-Rad, Hercules, California, USA). OD450 nm was used to represent cell proliferation.

ROS Detection

To detect cellular redox capacity and lipid ROS levels in H9c2 cells, ROS assay kits (cats) were used (No. S0033S, Biyang Taim Institute of Biotechnology). After culturing H9c2 cells for a certain period, the cells were washed with PBS and the cells were counted by flow cytometry (BD Biosciences). FlowJo (version 10.6.2; Ryujo LLC) was used for the analysis of mean fluorescence intensity.

Biochemical Detection

Measurement of Fe²⁺, GSH, and malondialdehyde (MDA) levels.

After H9c2 cells were cultured to a fixed number, the relevant substances were quantitatively detected using the reduced GSH detection kit (Nanjing Jiancheng Institute of Bioengineering), Ferro Orange (Dojindo Molecular Technologies, Inc.) and MDA detection kit (Nanjing Jiancheng Institute of Bioengineering).

Measurement of Mitochondrial Membrane Potential

Mitochondrial membrane potential was measured in H9c2 cells using a mitochondrial membrane potential kit and JC-1 staining (Beijing Solarbio Technology Co., Ltd According to the kit, H9c2 cells were cultured into a fixed number of six-well plates, stained with JC-1 for 20 min, and subjected to mitochondrial membrane potential analysis by flow cytometry (BD Biosciences).

Western Blot

RIPA lysis buffer was employed to extract the total proteins in cells and tissues. Each group of proteins was quantified using a BCA kit (Biosharp, Anhui Biosharp, China), followed by mixing with sodium lauryl sulfate-polyacrylamide gel running buffer. The proteins were adsorbed on a polyvinylidene fluoride membrane. The membrane was then blocked in 5% bovine serum albumin (BSA) for 1 h. ANXA1(1:2000; ab214486; Abcam), Pcolce(1:1000; SAB2108318; Sigma), S100a11(1:2000; abx103775; Abbexa), JNK(1:2000; #9258; Cellsignal), p-JNK(1:2000; (Thr183/Tyr185) #4668; Cellsignal), AMPK(1:2000; #9212; Cellsignal), p-AMPK (1:2000; (Thr172) #2535; Cellsignal), Raf(1:2000; #4432; Cellsignal), p-Raf (1:2000; (Ser259) #9421; Cellsignal), ACSL(1:2000, #4047, Cellsignal), GPX4(1 : 200, ab125066, Abcam), SLC7A11(1:2000, #98051, Cellsignal), β-actin(AB8226, Abcam), and GAPDH (AB9485, Abcam), all of the above primary antibodies need to be incubated overnight before use. Next, the horseradish peroxidase (HRP)-labeled secondary antibody IgG-HRP (BL003A; Bio Sharp) was used to incubate with the membrane for 1 h. Final exposure was performed using ECL chemiluminescence substrate (Biosharp). The expression of the protein of interest was determined using the expression of GAPDH as an internal reference.

Statistical Analysis

Statistical analysis was performed using GraphPad Prism 8.0 software (GraphPad Software, San Diego CA, USA). Data are presented as standard deviation. An unpaired t-test matching normal distribution was performed between the two groups. One-way analysis of variance and Tukey's post-hoc test were performed to compare multiple groups. The P < .05 indicated a statistically significant difference.

Results

Screening of Potential Targets for Ferroptosis

Based on the GEO database, we studied the gene expression in I/R and corresponding normal tissues. We obtained 983, 571, 1047 significant DEGs (|log2Fold Change|>1, P < .05) from three datasets of I/R-GSE160516, GSE4105, GSE103731 (Figure 1A-C). At the same time, we retrieved and downloaded 487 genes related to ferroptosis from the FerrDB database website. To explore the mechanism of ferroptosis in MIRI, we intersected the differential genes of the three datasets with ferroptosis genes to obtain 148 DEGs of MIRI related to ferroptosis (Figure 1D), which were potential therapeutic targets for ferroptosis in MIRI. To further explore the functions of these differences and identify the key candidate pathways, we performed GO functional analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, mainly focusing on functions such as Fe²⁺ homeostasis, ferroptosis, etc. The main enrichment pathway was the MAPK signaling pathway (Figure 1E). Subsequently, we used the STRING database to obtain proteins relevant to the therapeutic target, and the Cytoscape (3.7.2) software was used to screen for 10 pivot genes: ANXA1, S100a11, CD53, CYBB, NOX4, NOX1, TP53, SLC1A5, SLC38A1, KRAS (Figure 1F). Prognostic analysis showed that high expression of ANXA1 and S100a11 was associated with poor prognosis of MIRI patients (Figure 1G). qPCR and Western blot were used to verify the expression of the hub gene in H9c2 cardiomyocytes. The results showed that ANXA1 and S100a11 were highly expressed in H9c2 cells, and ANXA1 was more significantly expressed in MIRI than S100a11 (Figure 1H and I). Thus, the results above elucidate that ANXA1 is highly expressed in MIRI.

Figure 1.

ANXA1 was highly expressed in MIRI and is associated with ferroptosis. (A-C). Volcanic map of GSE160516(A), GSE4105(B), and GSE10373(C). (D). Venn Diagram of ferroptosis-related genes and differentially expressed genes (DEGs). (E). GO and KEGG analysis of ferroptosis-related DEGs. (F). Protein and protein interaction network of ferroptosis-related DEGs. (G). Prognosis value of ANXA1 and S100a11. (H-I). H9c2 cardiomyocytes were cultured under H/R condition. Both qPCR (H) and Western Blot (I) showed that ANXA1 and S100a11 were highly expressed in MIRI in vitro.

Knockdown of ANXA1 Enhanced Cardiomyocyte Viability

To explore the specific function of ANXA1, we knocked down ANXA1 in H9c2 cells. Compared with the NC group, ANXA1 expression was significantly reduced in the sh-ANXA1 group (Figure 2A). Next, H9c2 cells were transfected with sh-ANXA1, and then cultured under H/R condition. CCK-8 assay showed that ANXA1 expression was inversely correlated with cell viability, that is, decreased ANXA1 expression promoted cardiomyocyte viability (Figure 2B).

Figure 2.

Knockdown of ANXA1 can inhibit iron death and mitochondrial changes in cardiomyocytes. (A). H9c2 cells were transfected with sh-ANXA1-1, sh-ANXA1-2, or sh-ANXA1-3. The transfection efficiency of ANXA1 knockdown was detected by Western Blot. Next, H9c2 cells were transfected with sh-ANXA1, and then cultured under H/R condition. (B). CCK-8 assay was performed to measure transfected cell viability after H/R exposure. (C). The change of Fe²⁺ content after knocking down ANXA1. (D). ROS levels in cells and lipids were detected. (E). GSH and MDA levels were detected. (F). Western Blot analysis of ferroptosis markers. (G). Flow cytometry was used to measure intracellular JC-1 levels. (H-J). The expression of Fe²⁺ (H), GSH (I), and MAD (J) changed after erastin treatment.

Knockdown of ANXA1 Inhibited Cardiomyocyte Ferroptosis and Altered Mitochondrial Function

To explore the mechanism by which ANXA1 regulates MIRI, we examined the markers of ferroptosis and mitochondrial function. Compared with control cardiomyocytes, the content of Fe²⁺ and MDA in H/R-treated cardiomyocytes significantly increased (Figure 2C), and the content of GSH significantly decreased (Figure 2E), while this trend was reversed in the sh-ANXA1 group, suggesting that ANXA1 depletion can improve ferroptosis in cardiomyocytes under H/R condition.

Compared with control cardiomyocytes, intracellular and intracolipoid ROS levels were significantly increased in the H/R group, while knockdown of ANXA1 decreased intracellular and intracolipoid ROS expression (Figure 2D). The expression of ferroptosis-related proteins, such as ASCL4, SCL7A11, and GPX4, was significantly changed. The expression of ASCL4 was increased in the H/R group and decreased in the sh-ANXA1 group. However, the changes of SCL7A11 and GPX4 were opposite to those of ASCL4 (Figure 2F). Furthermore, flow cytometry was used to measure intracellular JC-1 levels. H/R-treated cells showed a decrease in mitochondrial JC-1 levels, while sh-ANXA1 recovered JC-1 levels after H/R treatment (Figure 2G).

Erastin Reversed the Level of Ferroptosis in H9c2 Cardiomyocytes After ANXA1 Knockdown

To further investigate whether ANXA1 can regulate hypoxia damage in H9c2 cardiomyocytes by regulating ferroptosis, H9c2 cells were transfected with sh-ANXA1, and then exposed to H/R and Erastin. Erastin is an agonist of ferroptosis. On the one hand, Erastin inhibits voltage-dependent anion channels (VDAC2/VDAC3) on the mitochondrial membrane, increases ROS production, and leads to oxidative stress. On the other hand, Erastin can also reduce cellular uptake of cystine by directly inhibiting System-xc activity. A decrease in cystine intake, one of the raw materials of GSH, inevitably leads to a decrease in intracellular GSH synthesis. Our results confirmed that compared to cardiomyocytes under H/R condition, Erastin restored the Fe²⁺ concentration in H/R-treated H9c2 cells with ANXA1 silencing (Figure 2H), reducing the production of reduced GSH (Figure 2I). Furthermore, compared to the NC group, in H/R-treated H9c2 cells after ANXA1 knockdown, Erastin treatment significantly increased final lipid peroxide MDA levels (Figure 2J). These results suggest that ANXA1 can activate ferroptosis in the pathogenesis of MIRI.

Depletion of ANXA1 Activated the RAS/RAF/MAPK Pathway

Existing studies have shown that ANXA1 can regulate MAPK signaling pathway, thereby modulating cell sensitivity to the cancer inhibitor sunitinib. ANXA1 has also been shown to be a key endogenous negative modulator of IL-6 and TNF expression in macrophages by regulating MAPK phosphorylation. The enrichment analysis of GO and KEGG pathways in MIRI showed that MAPK-related signaling pathways were the most enriched. We measured the expression of molecules that participate in the MAPK pathway. The results showed that knocking down ANXA1 activated JNK phosphorylation and p38 phosphorylation in H/R-treated H9c2 cells without affecting their total protein content (Figure 3A and B). In addition, knockdown of ANXA1 activated Raf phosphorylation in H/R-treated H9c2 cells but did not affect its total protein level, and Erastin mainly affected the phosphorylation level of Raf (Figure 3C). The above results imply that ANXA1 silencing activates the MAPK pathway to regulate MIRI.

Figure 3.

Knockdown of ANXA1 activated the RAS/Raf/MAPK pathway. H9c2 cells were transfected with sh-ANXA1, and then exposed to H/R and erastin. (A). The effects of ANXA1 knockdown on JNK were detected by Western Blot. (B). The effects of ANXA1 knockdown on p38 were detected by Western Blot. (C). The effects of ANXA1 knockdown on Raf were detected by Western Blot.

Depletion of ANXA1 Alleviated Ferroptosis and Mitochondrial Damage Through Activating RAS/Raf/MAPK in H/R-Induced H9c2 Cells

To explored the precise mechanism by which ANXA1 regulates ferroptosis and mitochondrial damage in MIRI, H9c2 cells were treated with RAF inhibitor (sorafenib) and transfected with sh-ANXA1. As shown in Figure 4A, cell viability was reduced by sorafenib, but increased by silencing ANXA1in H/R-treated H9c2 cells, while this effect was reversed by the cotreatment with sorafenib (Figure 4A). Compared with H/R group, the expression of ferroptosis-related markers GPX4 and SLC7A11 was decreased, and ACSL4 expression was increased in H/R-induced cells with silencing ANXA1, while the inhibition of ANXA1 showed contrary regulating effects on ferroptosis-related markers, reversing by sorafenib treatment (Figure 4B-C). To further confirm the regulatory role of ANXA1 in RAS/Raf/MAPK pathway, SB 202190 was used to inhibit MAPK activity. As expected, MAPK inhibitor reduced the viability of H/R-stimulated H9c2 cells and the depletion of ANXA1 enhanced its viability, which was rescued by SB 202190 (Supplemental Figure S1A). Moreover, SB 202190 treatment decreased p-p38, GPX4 and SLC7A11 levels, but promoted ACSL4 expression in H/R-injured H9c2 cells. ANXA1 knockdown exhibited promotional effect on p-p38, GPX4 and SLC7A11 and suppressive effect on ACSL4 in H/R-injured H9c2 cells, which was counteracted by SB 202190 (Supplemental Figure S1B-C). The above results indicated that the silence of ANXA1 attenuated ferroptosis and mitochondrial damage by enhancing RAS/Raf/MAPK pathway in H/R-induced H9c2 cells.

Figure 4.

The decreased expression of ferroptosis markers promoted by silencing ANXA1 was reversed by RAS/Raf/MAPK pathway inhibitor. (A). CCK-8 assay was used to detect cell viability in H/R-treated H9c2 cells with or without Sorafenib (23 nM) and ANXA1 knockdown. (B, C). Western Blot analysis of ferroptosis markers in H/R-treated H9c2 cells with or without Sorafenib (23 nM) and ANXA1 knockdown.

Discussion

MIRI has always been a hot topic in medical research.²⁷ It is currently believed that the pathological mechanism of MIRI may be related to many factors, such as excessive production of oxygen free radicals, calcium overload, cytokine involvement, accumulation of neutrophils in Kupffer cell activator, stem cell energy expenditure, imbalance in endothelin and nitric oxide concentration, and excessive release of inflammatory mediators.^28,29 Based on the literature, we constructed a MIRI model through reoxygenation after hypoxia and further explored the potential mechanism of MIRI therapy using network pharmacology. By integrating the information from the GEPIA database and the FerrDb database, 148 ferroptosis genes related to MIRI were identified. A recent study showed that inhibition of spermidine/spermine N1-acetyltransferase 1 (Sat1) improves MIRI through suppressing ferroptosis via MAPK/ERK pathway.³⁰ The SGLT2 inhibitor dapagliflozin protects against MIRI by reducing ferroptosis through MAPK signaling pathway.³¹ Through functional enrichment analysis, we also found that the MAPK pathway may be related to the mechanism of ferroptosis in MIRI. Through the PPI network, we screened 10 key genes (ANXA1, S100a11, CD53, CYBB, NOX4, NOX1, TP53, SLC1A5, SLC38A1, KRAS) for follow-up verification. qPCR and western blot confirmed for the first time that that ANXA1 and S100A11 were highly expressed in MIRI, with more significant differences in ANXA1 expression.

Annexins are a calcium-dependent superfamily of membrane-binding proteins that are ubiquitous in animals, plants, and fungi other than bacteria and are expressed in almost all organs.^32,33 ANXA1 gets its name from being the first in its family to be discovered. The report points out that ANXA1 is involved in many cellular life activities.³⁴ ANXA1 was initially found to bind to epidermal growth factor receptors, and its role in regulating cell proliferation was found.^35,36 ANXA1 is not expressed in normal hepatocytes and hepatitis cells, but is upregulated in hepatocellular carcinoma and paracancerous tissues, and the expression in hepatocellular carcinoma is stronger than that in paracancerous tissues, indicating that ANXA1 is positively correlated with the incidence of hepatocellular carcinoma.³⁷ ANXA1 acts on human platelets, inhibiting classical thrombotic-induced inside-out signaling events (such as Akt activation). ANXA1 selectively mediates phosphatidylserine on the cell surface and stimulates neutrophils to promote platelet phagocytosis and thus forms thrombosis. Consistent with the above, our study found for the first time that ANXA1 was highly expressed in MIRI, providing a new target for basic research and clinical treatment of MIRI. In the context of MIRI, ANXA1 is particularly involved in inflammation and oxidative stress. The high expression of ANXA1 in MIRI suggests that it may act as a protective factor to resist the harmful effects of oxidative stress and inflammation during the reperfusion phase. This finding highlights the potential of ANXA1 as a therapeutic target for mitigating MIRI injury, linking its roles in inflammation and oxidative stress to its protective mechanism in the heart.

Ferroptosis is a type of nonapoptotic cell death. There are three main mechanisms causing ferroptosis, a large accumulation of lipid peroxides, Fe²⁺ overload, and glutathione reductase depletion. It has been reported that ferroptosis is a novel way to cause cardiomyocyte death in MIRI. Gao et al found that inhibiting ferroptosis by inhibiting glutamine breakdown protects heart tissue from MIRI.³⁸ Therefore, targeted inhibition of cardiomyocyte ferroptosis is a promising strategy to improve MIRI. Glutathione peroxidase 4 (GPX4) and system-xc are considered to be the main signaling pathways associated with ferroptosis. GPX-4 is an important antioxidant enzyme in the upstream of mitochondria that catalyzes the conversion of reduced GSH to oxidative GSSG. When GSH is depleted, GPX-4 inactivation accumulates a large amount of ROS, resulting in membrane lipid peroxidation and ferroptosis.³⁹ Wu et al found that riposting-1 mitigated MIRI by increasing GPX-4 levels and inhibiting ferroptosis.⁴⁰ System-xc exists on the surface of cell membrane and is a heterodimeric amino acid reverse transporter, consisting of a light-chain subunit SLC7A11 and a heavy-chain subunit SLC3A2-system-xc swaps cystine inside and outside the cells with glutamate in a 1:1 ratio to synthesize GSH from cystine. If SLC7A11 is overexpressed in damaged cardiomyocytes, normal glutamate and cystine levels can be restored to the heart, reducing ferroptosis.⁴¹ Studies have shown that drugs regulate neutrophil infiltration and fibrosis levels by regulating ANXA1 levels. Based on this, our study found for the first time that ANXA1 regulates MIRI by affecting ferroptosis. After ANXA1 silencing in H9c2 cells treated with hypoxia, introcellular Fe²⁺ concentration decreased, the SCL7A11 associated with iron metabolism increased, GPX4 decreased, reduced GSH increased, intracellular ROS and lipid ROS levels decreased, therefore ferroptosis was inhibited.

The MAPK family is known as a classic death pathway including ERK, p38, and JNK. There have been many studies on MAPK-mediated physiological and pathological activities, on the one hand, regulating cell growth, development, differentiation and death. On the other hand, it is involved in myocardial inflammation, regulating myocardial hypertrophy and myocardial fibrosis. REDOX capacity can also be adjusted. Numerous studies have confirmed that endothelial atherosclerosis is relieved when MAPK signaling is inhibited,⁴² myocardial fibrosis,⁴³ myocardial hypertrophy,⁴⁴ and MIRI.⁴⁵ Existing studies have shown that inhibition of MAPK signaling can mitigate ferroptosis. It has been reported that in lipopolysaccharide-induced ARDS models, knockdown of lipotransportin-2 inhibits ERK/MAPK to improve ferroptosis.⁴⁶ Cetuximab activates p38-MAPK by inhibiting the Nrf2/HO-1 pathway, ultimately enhancing RSL-3-induced iron death.⁴⁷ It has previously been reported that ANXA1 has a bidirectional effect on the activation of the MAPK pathway.⁴⁸ Therefore, we explored the role of related protein expression and phosphorylation in the MAPK pathway in ferroptosis in MIRI. We provide the first evidence that the phosphorylation levels of MAPK pathway-associated proteins in hypoxic H9c2 cells increased significantly, and this activation was associated with a decrease in ferroptosis. In the context of our study, activation of the RAS/Raf/MAPK pathway is beneficial for the cells. A recent study also indicated that MAPK signaling induces ERK to phosphorylate RFNG Ser255 residue, leading to the inhibition of apoptosis and ferroptosis in colorectal cancer cells.⁴⁹ On the contrary, some studies have shown that MAPK is harmful to cells. For example, p38 MAPK inhibitor SB202190 inhibits ferroptosis in the glutamate-induced retinal excitotoxicity glaucoma model.⁵⁰ Doxorubicin treatment can increase the phosphorylation levels of MAPKs, including p38 and c-JNK, to induce ferroptosis and cardiotoxicity in H9c2 cardiomyoblasts.⁵¹ Therefore, we believe that the activation of MAPK has a protective effect on cells under certain conditions, rather than being harmful. These conditions mainly involve the type of stress faced by cells, the activated MAPK subtypes, and the physiological or pathological state of cells.

There are still limitations in this study. Firstly, the current findings are based on bioinformatics screening and in vitro cell experiments. These findings require further study in gene knockout mice. Secondly, we should continue to strengthen the exploration of translational medicine. The development of nano pharmaceuticals or other targeted approaches to inhibit ANXA1 expression will be an effective therapeutic strategy for MIRI.

In summary, by combining network pharmacology analysis and bioinformatics analysis, we found for the first time that ANXA1 is highly expressed in MIRI, and explored its function and mechanism. After silencing ANXA1 in hypoxic cardiomyocytes in vitro experiments, ferroptosis is reduced by activating the MAPK signaling pathway, thereby mitigating MIRI. Our findings suggest that targeted inhibition of ANXA1 expression in cardiomyocytes may be a viable treatment for MIRI. In addition, the data support the protective role of ANXA1 in MIRI, in part by activating the MAPK pathway to reduce ferroptosis. From a basic research perspective, these findings provide a direction for the functional study of ANXA1. From a clinical point of view, it provides a new strategy for future clinical treatment of MIRI.

Supplemental Material

sj-doc-1-cpt-10.1177_10742484251369610 - Supplemental material for Inhibition of ANXA1 Ameliorates Myocardial Ischemia/Reperfusion Injury by Targeting RAS/Raf/MAPK Axis-Mediated Ferroptosis

Supplemental material, sj-doc-1-cpt-10.1177_10742484251369610 for Inhibition of ANXA1 Ameliorates Myocardial Ischemia/Reperfusion Injury by Targeting RAS/Raf/MAPK Axis-Mediated Ferroptosis by Yin Guo, MD, Tian-xiao Lou, BD, Yang Liu, BD, Xin-yu Li, MD, Xiao-yu Liu, BD, and Yi Huang, MD in Journal of Cardiovascular Pharmacology and Therapeutics

Footnotes

Abbreviations

ORCID iDs

Yin Guo

Tian-xiao Lou

Yang Liu

Xin-yu Li

Xiao-yu Liu

Yi Huang

Authors’ Contributions

Conceptualization: Yin Guo; data curation: Xin-yu Li; formal analysis: Yang Liu and Xin-yu Li; investigation: Tian-xiao Lou; methodology: Xiao-yu Liu; project administration: Yin Guo; resources: Yi Huang; software: Xiao-yu Liu; supervision: Yin Guo; validation: Yang Liu and Yi Huang; visualization: Tian-xiao Lou; writing—original draft: Tian-xiao Lou; and writing—review and editing: Yin Guo and Yi Huang; all authors read and approved the final manuscript.

Funding

The authors received no financial support for the research, authorship, and/or publication of this article.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability Statement

All data generated or analysed during this study are included in this article. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Supplemental Material

Supplemental material for this article is available online.

References

Gao

Yang

, et al. Number of standard modifiable risk factors and mortality in patients with first-presentation ST-segment elevation myocardial infarction: insights from China acute myocardial infarction registry. BMC Med. 2022;20(1):217.

Yellon

Hausenloy

. Myocardial reperfusion injury. N Engl J Med. 2007;357(11):1121–1135.

Hausenloy

Yellon

. Targeting myocardial reperfusion injury–the search continues. N Engl J Med. 2015;373(11):1073–1075.

Liu

Zhao

, et al. Myocardial ischemia/reperfusion injury: mechanisms of injury and implications for management (review). Exp Ther Med. 2022;23(6):430.

Perretti

Flower

. Modulation of IL-1-induced neutrophil migration by dexamethasone and lipocortin 1. J Immunol. 1993;150(3):992–999.

Hsiang

Tunoda

Whang

, et al. The impact of altered annexin I protein levels on apoptosis and signal transduction pathways in prostate cancer cells. Prostate. 2006;66(13):1413–1424.

Almawi

Lipman

Stevens

, et al. Abrogation of glucocorticoid-mediated inhibition of T cell proliferation by the synergistic action of IL-1, IL-6, and IFN-gamma. J Immunol. 1991;146(10):3523–3527.

Skouteris

Schröder

. The hepatocyte growth factor receptor kinase-mediated phosphorylation of lipocortin-1 transduces the proliferating signal of the hepatocyte growth factor. J Biol Chem. 1996;271(44):27266–27273.

Dixon

Lemberg

Lamprecht

, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5):1060–1072.

10.

Song

Wang

. Mechanism of ferroptosis: a potential target for cardiovascular diseases treatment. Aging Dis. 2021;12(1):261–276.

11.

Zhang

Ren

Wang

, et al. Targeting ferroptosis by polydopamine nanoparticles protects heart against ischemia/reperfusion injury. ACS Appl Mater Interfaces. 2021;13(45):53671–53682.

12.

Lin

Yang

K-T

Lee

W-S

, et al. Xanthohumol protects the rat myocardium against ischemia/reperfusion injury-induced ferroptosis. Oxid Med Cell Longev. 2022;2022(Special Issue):9523491.

13.

Javadov

Jang

Agostini

. Crosstalk between mitogen-activated protein kinases and mitochondria in cardiac diseases: therapeutic perspectives. Pharmacol Ther. 2014;144(2):202–225.

14.

Kaiser

Lyons

Duffy

, et al. Inhibition of p38 reduces myocardial infarction injury in the mouse but not pig after ischemia-reperfusion. Am J Physiol Heart Circ Physiol. 2005;289(6):H2747–H2751.

15.

Tenhunen

Soini

Ilves

, et al. P38 kinase rescues failing myocardium after myocardial infarction: evidence for angiogenic and anti-apoptotic mechanisms. Faseb j. 2006;20(11):1907–1909.

16.

Dhanasekaran

Reddy

. JNK-signaling: a multiplexing hub in programmed cell death. Genes Cancer. 2017;8(9–10):682–694.

17.

Cui

Choi

S-E

Kim

, et al. Iron overload by transferrin receptor protein 1 regulation plays an important role in palmitate-induced insulin resistance in human skeletal muscle cells. Faseb j. 2019;33(2):1771–1786.

18.

Barrett

Wilhite

Ledoux

, et al. NCBI GEO: Archive for functional genomics data sets–update. Nucleic Acids Res. 2013;41(Database issue):D991–D995.

19.

Zhang

Lei

Y-s

Meng

X-w

, et al. Iguratimod alleviates myocardial ischemia/reperfusion injury through inhibiting inflammatory response induced by cardiac fibroblast pyroptosis via COX2/NLRP3 signaling pathway. Front Cell Dev Biol. 2021;9(Research Topic):746317.

20.

Wang

Xuan

, et al. Analysis of the potential ferroptosis mechanism and multitemporal expression change of central ferroptosis-related genes in cardiac ischemia-reperfusion injury. Front Physiol. 2022;13(2022):934901.

21.

Zhou

Yuan

, et al. Ferrdb V2: Update of the manually curated database of ferroptosis regulators and ferroptosis-disease associations. Nucleic Acids Res. 2023;51(D1):D571–d582.

22.

Ito

Murphy

. Application of ggplot2 to pharmacometric graphics. CPT Pharmacometrics Syst Pharmacol. 2013;2(10):e79. doi:10.1038/psp.2013.56

23.

Szklarczyk

Gable

Nastou

, et al. The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021;49(D1):D605–d612.

24.

Dong

Zhao

Wang

. Network pharmacology-based investigation of potential targets of Astragalus membranaceous-Angelica sinensis compound acting on diabetic nephropathy. Sci Rep. 2021;11(1):19496.

25.

Zhong

, et al. Naringenin alleviates myocardial ischemia/reperfusion injury by regulating the nuclear factor-erythroid factor 2-related factor 2 (Nrf2)/system xc-/glutathione peroxidase 4 (GPX4) axis to inhibit ferroptosis. Bioengineered. 2021;12(2):10924–10934.

26.

Bustin

Mueller

. Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clin Sci (Lond). 2005;109(4):365–379.

27.

Russo

Penna

Musso

, et al. Platelets, diabetes and myocardial ischemia/reperfusion injury. Cardiovasc Diabetol. 2017;16(1):71.

28.

Yiang

G-T

Liao

W-T

, et al. Current mechanistic concepts in ischemia and reperfusion injury. Cell Physiol Biochem. 2018;46(4):1650–1667.

29.

Minutoli

Puzzolo

Rinaldi

, et al. ROS-mediated NLRP3 inflammasome activation in brain, heart, kidney, and testis ischemia/reperfusion injury. Oxid Med Cell Longev. 2016;2016(Special Issue):2183026.

30.

Liu

Chen

Song

, et al. Inhibition of Sat1 alleviates myocardial ischemia-reperfusion injury through regulation of ferroptosis via MAPK/ERK pathway. Front Pharmacol. 2024;15(2024):1476718.

31.

Chen

Zhang

Wang

, et al. Dapagliflozin alleviates myocardial ischemia/reperfusion injury by reducing ferroptosis via MAPK signaling inhibition. Front Pharmacol. 2023;14(2023):1078205.

32.

Patel

Ahmad

Weiss

, et al. Annexin A1 is a new functional linker between actin filaments and phagosomes during phagocytosis. J Cell Sci. 2011;124(Pt 4):578–588.

33.

Horlacher

Noti

de Paz

, et al. Characterization of annexin A1 glycan binding reveals binding to highly sulfated glycans with preference for highly sulfated heparan sulfate and heparin. Biochemistry. 2011;50(13):2650–2659.

34.

Spurr

Nadkarni

Pederzoli-Ribeil

, et al. Comparative analysis of annexin A1-formyl peptide receptor 2/ALX expression in human leukocyte subsets. Int Immunopharmacol. 2011;11(1):55–66.

35.

Sawyer

Cohen

. Epidermal growth factor stimulates the phosphorylation of the calcium-dependent 35,000-dalton substrate in intact A-431 cells. J Biol Chem. 1985;260(14):8233–8236.

36.

Shen

Nooraie

Elshimali

, et al. Decreased expression of annexin A1 is correlated with breast cancer development and progression as determined by a tissue microarray analysis. Hum Pathol. 2006;37(12):1583–1591.

37.

Masaki

Tokuda

Ohnishi

, et al. Enhanced expression of the protein kinase substrate annexin in human hepatocellular carcinoma. Hepatology. 1996;24(1):72–81.

38.

Gao

Monian

Quadri

, et al. Glutaminolysis and transferrin regulate ferroptosis. Mol Cell. 2015;59(2):298–308.

39.

Viswanathan

Ryan

Dhruv

, et al. Dependency of a therapy-resistant state of cancer cells on a lipid peroxidase pathway. Nature. 2017;547(7664):453–457.

40.

Zhang

, et al. Ferroptosis as a novel therapeutic target for cardiovascular disease. Theranostics. 2021;11(7):3052–3059.

41.

Fang

Cai

Wang

, et al. Loss of cardiac ferritin H facilitates cardiomyopathy via Slc7a11-mediated ferroptosis. Circ Res. 2020;127(4):486–501.

42.

Gencer

Döring

Jansen

, et al. Endothelial ACKR3 drives atherosclerosis by promoting immune cell adhesion to vascular endothelium. Basic Res Cardiol. 2022;117(1):30.

43.

Xing

Duan

, et al. Suppression of NADPH oxidase 4 inhibits PM(2.5)-induced cardiac fibrosis through ROS-P38 MAPK pathway. Sci Total Environ. 2022;837(1):155558.

44.

Luo

Jiang

May

, et al. Cooperative binding of ETS2 and NFAT links Erk1/2 and calcineurin signaling in the pathogenesis of cardiac hypertrophy. Circulation. 2021;144(1):34–51.

45.

Peng

, et al. 25-Hydroxycholesterol Protects against myocardial ischemia-reperfusion injury via inhibiting PARP activity. Int J Biol Sci. 2020;16(2):298–308.

46.

Wang

Zhang

Zou

, et al. Lipocalin-2 silencing suppresses inflammation and oxidative stress of acute respiratory distress syndrome by ferroptosis via inhibition of MAPK/ERK pathway in neonatal mice. Bioengineered. 2022;13(1):508–520.

47.

Yang

Dai

, et al. Cetuximab promotes RSL3-induced ferroptosis by suppressing the Nrf2/HO-1 signalling pathway in KRAS mutant colorectal cancer. Cell Death Dis. 2021;12(11):1079.

48.

Alldridge

Harris

Plevin

, et al. The annexin protein lipocortin 1 regulates the MAPK/ERK pathway. J Biol Chem. 1999;274(53):37620–8.

49.

Zhang

Wen

, et al. MAPK signaling-mediated RFNG phosphorylation and nuclear translocation restrain oxaliplatin-induced apoptosis and ferroptosis. Adv Sci (Weinh). 2024;11(38):e2402795.

50.

Feng

Wang

Zhang

, et al. P38 MAPK inhibitor SB202190 suppresses ferroptosis in the glutamate-induced retinal excitotoxicity glaucoma model. Neural Regen Res. 2024;19(10):2299–2309.

51.

Chen

Sun

Wang

, et al. Resveratrol protects against doxorubicin-induced cardiotoxicity by attenuating ferroptosis through modulating the MAPK signaling pathway. Toxicol Appl Pharmacol. 2024;482(1):116794.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.29 MB