Sage Journals: Discover world-class research

Abstract

Mithramycin exhibits certain anticancer effects in glioma, metastatic cerebral carcinoma, malignant lymphoma, chorionic carcinoma and breast cancer. However, its effects on salivary adenoid cystic carcinoma remain unclear. Here, we report that mithramycin significantly inhibited epithelial-to-mesenchymal transition and invasion in human salivary adenoid cystic carcinoma cell lines. The underlying mechanism for this activity was further demonstrated to involve decreasing the expression of the transcription factors specificity protein 1 and SNAI1. Specificity protein 1 is a pro-tumourigenic transcription factor that is overexpressed in SACC-LM and SACC-83 cells, and its expression is inhibited by mithramycin. Moreover, chromatin immunoprecipitation assays showed that specificity protein 1 induced SNAI1 transcription through direct binding to the SNAI1 promoter. In summary, this study uncovered the mechanism through which mithramycin inhibits epithelial-to-mesenchymal transition and invasion in salivary adenoid cystic carcinoma cell lines, namely, via downregulating specificity protein 1 and SNAI1 expression, which suggests mithramycin may be a promising therapeutic option for salivary adenoid cystic carcinoma.

Keywords

Salivary adenoid cystic carcinoma mithramycin specificity protein 1 SNAI1 epithelial-to-mesenchymal invasion

Introduction

Salivary adenoid cystic carcinoma (SACC) is a rare malignant neoplasm, representing approximately 30% of human salivary gland malignancies, that arises from secretory epithelial cells of salivary glands.^1,2 The biological properties of SACC include slow local growth, high incidences of nerve and blood vessel invasion, infrequent regional metastases and frequent local recurrence, poor long-term prognosis and relatively indolent distant metastases.^3–6 Surgical resection is still the primary method for treating SACC, and postoperative radiotherapy is necessary to kill remaining cancer cells and prevent distant metastases.^5,6 Despite recent advances in surgery and adjuvant therapy, the overall 10-year survival and incidence of tumour recurrence in SACC patients have not significantly improved. Therefore, there is a pressing need to identify anti-metastatic drugs for SACC.

Epithelial-to-mesenchymal transition (EMT) plays a critical role in cancer progression, migration, invasion and metastasis. EMT can curtail progression-free survival (PFS) and overall survival (OS) of cancer patients.^7,8 A number of molecular markers associated with EMT have been defined; for example, the epithelial marker CDH1 is decreased during EMT, leading to decreased connectivity between epithelial cells and reduced epithelial cell polarity.^9,10 Conversely, CDH2 and VIM expression are increased, which induces mesenchymal cell phenotypes, including increased potential for migration and invasion. EMT is regulated by a host of transcription factors, including SNAI1, SNAI2, TWIST1, ZEB1 and ZEB2, which transform the epithelial state into the mesenchymal state by inhibiting epithelial marker expression and inducing mesenchymal-related markers.^10–12 Previous studies have shown that inducing EMT can promote metastasis,¹³ as well as increase resistance to radiation and chemotherapy.¹⁴ Together this suggests that EMT-inhibiting drugs may be effective agents to target SACC.

Mithramycin is a polyauroleic acid that was isolated from Streptomyces plicatus. During the 1960s and 1970s, mithramycin was evaluated as a chemotherapeutic agent in patients with a variety of malignancies. However, it was discontinued owing to excessive systemic toxicities, which were poorly characterized.^15,16 Later studies showed that mithramycin specifically inhibits the binding of specificity protein 1 (SP1) to GC-rich DNA, which results in the repression of numerous genes that mediate proliferation, invasion and metastasis. Furthermore, in an ongoing phase II trial at the National Cancer Institute (NCI) using drugs of higher purity than previously available, mithramycin has been surprisingly well tolerated in patients with cancer when administered at the previously recommended dose and schedule (25–30 mg/kg intravenously (i.v.) over 6 h, 7 days, every 4 weeks). Specifically, no nausea, vomiting, bleeding or myelosuppression has been observed in 12 adult patients with various malignancies; however, nine of these individuals developed dose-limiting transaminitis, which resolved spontaneously following cessation of drug. Affymetrix Drug Metabolizing Elimination and Transport (DMET) microarray experiments demonstrated that mithramycin-induced hepatotoxicity correlated with single-nucleotide polymorphism (SNP) in several genes encoding transporter proteins regulating bile flow (Schrump and colleagues, manuscript in preparation). Thus, interest in the clinical development of mithramycin and its analogues has been renewed.^17–21 On the basis of these findings as well as review of pharmacokinetic data from this trial, we hope to make contribution in understanding the effects of mithramycin in the oral tumour SACC.

The SP1 zinc-finger transcription factor binds to GC-rich motifs and regulates various physiologic processes.²² SP1 is overexpressed and contributes to the tumourigenic phenotype in various human cancers by upregulating genes that induce proliferation, invasion and metastasis.^23–25

In this study, we examined the effects of mithramycin on SACC and explored the potential mechanism. For the first time, we show that mithramycin effectively inhibited EMT by inducing SP1 in human SACC in vitro and in vivo. Therefore, our results provide a novel insight, suggesting that mithramycin can be a new choice for treating SACC.

Materials and methods

Clinical samples and cell culture

SACC tissues were obtained from 11 patients undergoing surgery for SACC in the Department of Dental Medicine, The First Affiliated Hospital of Nanjing Medical University. Five adjacent non-cancerous salivary gland tissues, located at least 1 cm away from the tumour, were collected from the surgically treated SACC patients. Tissues were immediately snap-frozen in liquid nitrogen after surgery. This study was approved by the medical review board of Nanjing Medical University. Written informed consent was obtained from all participating patients.

Human SACC cell lines SACC-83 and SACC-LM were obtained from the State Key Laboratory of Oral Diseases, Sichuan University of West China. SACC-83 and SACC-LM cells were maintained in RPMI 1640 (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, USA) in an incubator at 37°C with 5% CO₂.

Cell proliferation assay

SACC-83 and SACC-LM cells were seeded at 5000 cells per well in 96-well plates (six replicate wells per condition) and cultured overnight. The cells were treated with mithramycin (0, 0.02, 0.04, 0.08 µM). Cell proliferation was measured at 0, 24, 48 and 72 h using a Cell Counting Kit-8 (CCK-8; Dojindo, Japan) according to the manufacturer’s instructions. Cell viability was determined at 450 nm absorbance using an enzyme-linked immunosorbent assay plate reader.

Colony formation assay

A total of 500 SACC-83 and SACC-LM cells were plated in 100 mm dishes and then treated with mithramycin (0, 0.02, 0.04 or 0.08 µM). After incubation for 2 weeks, visible colonies were fixed with 4% paraformaldehyde (PFA) for 30 min and then stained with 0.1% crystal violet for 20 min. Colonies with more than 50 cells were counted.

Wound-healing assay

Cells were cultured in six-well plates until 90% confluence. Cell layers were scratched using a 200 µL pipette tip to form wounded gaps, washed with phosphate-buffered saline (PBS) twice and cultured. The wounded gaps were photographed at 0 and 24 h, and scratch closure was evaluated relative to the total area of wounding.

Invasion assay

Invasion assays were performed using 24-well BD Matrigel invasion chambers (BD Biosciences, UK) in accordance with the manufacturer’s instructions. Cells (5 × 10⁴ per well) were seeded in the upper well of the invasion chamber in RPMI 1640 without serum. The lower chamber well contained RPMI 1640 supplemented with 10% FBS to stimulate cell invasion. After incubation for 24 h, non-invading cells were removed from the top well with a cotton swab; the bottom cells were fixed with 4% PFA and stained with 0.1% crystal violet. Three independent fields were photographed for each well and invasion was quantified by counting the number of cells in three independent 10× magnification fields. Experiments were performed in triplicate. Three independent experiments were conducted in triplicate.

Apoptosis assay

SACC-83 and SACC-LM cells (2 × 10⁵) were plated into six-well plates. After cells were treated with mithramycin (0, 0.02, 0.04 and 0.08 µM) for 48 h, Annexin V–fluorescein isothiocyanate (FITC) and propidium iodide (PI) double staining was used to detect and quantify cellular apoptosis by flow cytometry. Cells without Annexin V and PI staining (Annexin V− and PI− cells) were used as controls. Annexin V+ and PI− cells were designated as apoptotic cells, whereas Annexin V+ and PI+ cells were necrotic cells. Tests were repeated in triplicate.

SP1 plasmid and plasmid transfection

The pN3-Sp1FL vector for overexpression of SP1 was a gift from Guntram Suske (Addgene plasmid # 24543). Plasmid transfection in SACC-LM and SACC-83 cells was carried out using Lipofectamine™ 2000 (Invitrogen) according to the manufacturer’s instructions. Briefly, when cells were 80% confluent, 2 µg of pN3-Sp1FL and 3 µL Lipofectamine™ 2000 (for a six-well plate) were diluted with 250 µL Opti-MEM, mixed gently and incubated at room temperature. After 20 min, the solution was added to cells.

Quantitative real-time polymerase chain reaction analysis

Total RNA was extracted from clinical tissues and SACC-LM and SACC-83 cells with TRIzol reagent (Invitrogen) and then reverse-transcribed into complementary DNA (cDNA) with the PrimeScript RT reagent kit (Takara, Japan). The quantitative real-time polymerase chain reaction (qRT-PCR) was performed with cDNA as template using SYBR Premix Exc according to the 2^−ΔΔCt method. The primer pairs are listed (5′-3′) as follows: glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-F: AATCCCATCACCATCTTCCA; GAPDH-R: CCTGCTTCACCACCTTCTTG; SP1-F: CACCAGAATAAGAAGGGAGG; SP1-R: GGTGGTAATAAGGGCTGAA; SNAI1-F: CAGACCCACTCAGATGTCAAGAA; SNAI1-R: GGGCAGGTATGGAGAGGAAGA; CDH1-F: CAACGACCCAACCCAAGAA; CDH1-R: CCGAAGAAACAGCAAGAGCA; CDH2-F: AAAGAACGCCAGGCCAAAC; CDH2-R: GGCATCAGGCTCCACAGTGT; VIM-F, CGTCTCTGGCACGTCTTGAC and VIM-R: GCTTGGAAACATCCACATCGA.

Western blot analysis

Treated cells were lysed with radioimmunoprecipitation assay (RIPA) lysis buffer (KenGen, China), and protein concentrations were quantified using a BCA Protein Assay Kit (Beyotime, China). Total protein lysates were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, USA). The membranes were blocked in 5% non-fat milk and incubated with primary antibodies against SP1 (1:1000; Bioworld Technology, USA), SNAI1, CDH1, CDH2, VIM and matrix metalloproteinase-2 (MMP-2; 1:1000 each; all from Abcam, USA), followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibody (1:2000; Santa Cruz Biotechnology, USA). GAPDH served as a loading control (1:5000; Bioworld Technology, USA).

Chromatin immunoprecipitation assays

Chromatin in cellular lysates was immunoprecipitated using rabbit anti-SP1 antibodies (Abcam). Negative control samples were prepared using control rabbit IgG antibody. Immunoprecipitated chromatin was analysed by RT-PCR using primers targeting individual GC boxes in the human SNAI1 promoter. The primer pairs were as follows: SNAI1 promoter region-F 5′-GAAATTTCCGCCCCCTCCC-3′ and SNAI1 promoter region-R 5′-GGTGGTCTGAGCGCTTCT-3′. Results were analysed as previously described.²⁶

Dual-luciferase reporter assay

Two reporter plasmids including the 5′-flanking regions of the human SNAI1 promoter 1000 bp upstream from transcription start site (GenBank: AY005796.1) were chemically constructed, containing either the wild-type (WT) or mutated (Mut) sequence of SP1-binding sites. SACC-LM and SACC-83 cells were seeded in a 24-well plate and transfected with either the WT or Mut reporter plasmid together with vector or the SP1-overexpression plasmid. The Renilla luciferase (pRL) plasmid was transfected for normalization; 24 h after transfection, luciferase activities were analysed with the Promega Dual-Luciferase Reporter Assay System (USA) according to the manufacturer’s instructions.

Xenograft mouse model

Animal experiments were approved by the Animal Management Rule of the Chinese Ministry of Health (documentation 55, 2001) and were in accordance with the approved guidelines and the experimental protocol of Nanjing Medical University. SACC-LM cells (3 × 10⁶) in a 200 µL cell suspension were subcutaneously injected into the right flank of mice, and the mice were observed carefully every 3 days. One week after the injection, tumour-bearing mice were randomly divided into mithramycin-treated (Mith) and control groups (n = 6 per group). Mithramycin (10 mg/kg body weight) was administered to mice at once every 3 days for 4 weeks via intraperitoneal injection, whereas the control group received PBS only. Tumour volume and the whole body weight were measured every 3 days after tumour inoculation. The tumour volume was computed according to the following formula: tumour volume (mm³) = 1/2 × a (tumour length) × b2 (tumour width). At the end of the experimental period, all mice were sacrificed by cervical decapitation, the tumour tissues were excised aseptically and the weight was recorded. According to the method of injection above, 20 mice were divided into Mith and Control groups (n = 10 per group) to record the date of death and draw the survival curve.

Immunohistochemistry

Fresh specimens were under cryopreservation and routinely processed into frozen sections; 5-µm-thick sections were prepared, and immunohistochemical staining with streptavidin–biotin immunoperoxidase assay was performed using antibodies against SP1 and SNAI1 (1:100; Abcam). Slides were examined under a light microscope (Leica, Germany) at 40× magnification. The expression level of each examined protein was scored on a scale of 0–3 (0, negative; 1, slight positive; 2, moderate positive; 3, intense positive).

Statistical analysis

All experiments were performed in triplicate, and means and standard error of the mean or standard deviation were subjected to Student’s t-test for pairwise comparison or analysis of variance (ANOVA) for multivariate analysis. Kaplan–Meier survival analysis was performed using GraphPad Prism 5 software. A value of p < 0.05 was considered significant for all tests.

Results

Mithramycin affects different tumourigenic properties, including proliferation and apoptosis, of human SACC cells

To evaluate the effects of mithramycin on different tumourigenic properties of SACC cells, we treated SACC-LM and SACC-83 cells with mithramycin (0, 0.02, 0.04 and 0.08 µM). CCK-8 and colony formation assays both showed that cell proliferation was decreased after treatment with mithramycin in both cell lines (Figure 1(a) and (b)). In addition, our flow cytometry assay results showed that mithramycin significantly promoted cell apoptosis in both cell lines (Figure 1(c)). Furthermore, the effects of mithramycin on the tumourigenic properties of SACC cells were in a dose-dependent manner. Together these data indicate that mithramycin can significantly inhibit proliferation and promote the apoptosis of human SACC cells.

Figure 1.

Mithramycin affects tumourigenic properties including proliferation and apoptosis of human SACC cells. (a) SACC cells were treated with mithramycin (0, 0.02, 0.04 and 0.08 µM) and cell proliferation was determined by CCK-8 assays after 0, 24, 48 and 72 h. (b) SACC cells were treated with mithramycin (0, 0.02, 0.04 and 0.08 µM) and colony formation assays were conducted after 14 days. (c) SACC cells were treated with mithramycin (0, 0.02, 0.04 and 0.08 µM) and cell apoptosis was examined by flow cytometry assays after 48 h (*p < 0.5, **p < 0.01 and ***p < 0.001).

Mithramycin inhibits migration, invasion and EMT of human SACC cells

We next examined the effects of mithramycin on the migration, invasion and EMT activities of SACC-LM and SACC-83 cells treated with various concentrations of mithramycin for 48 h. Both cell migration and invasion were efficiently inhibited in both cell lines after treatment with mithramycin, as shown by wound-healing assays and invasion assays (Figure 2(a) and (b)).

Figure 2.

Mithramycin inhibited migration, invasion and EMT of human SACC cells. (a) SACC cells were treated with mithramycin (0.08 µM) and cell migration was detected by wound-healing assays after 48 h. Representative images of wound-healing assays are shown. Graphs show quantification of assay results. (b) SACC cells were treated with mithramycin (0, 0.02, 0.04 and 0.08 µM) and cell invasion was evaluated by invasion assays after 48 h. Representative images of migrated cells are shown. Graphs show quantification of assay results. (c) qPCR evaluation of E-cadherin, N-cadherin, vimentin and MMP-2 mRNA levels in SACC cells treated with mithramycin as indicated and normalized to GADPH mRNA levels. (d) Western blot analysis of E-cadherin, N-cadherin, vimentin and MMP-2 protein levels in SACC cells treated with mithramycin (0, 0.02, 0.04 and 0.08 µM). GAPDH was used as a loading control (*p < 0.5, **p < 0.01 and ***p < 0.001).

We also evaluated the capacity of mithramycin to affect EMT by examining the levels of EMT-specific markers by quantitative polymerase chain reaction (qPCR). We observed a significant upregulation of messenger RNA (mRNA) levels of the epithelial marker CDH1 and downregulation of mesenchymal markers CDH2, VIM and MMP-2 mRNA levels in response to mithramycin (Figure 2(c)). We also examined the protein expression levels of the EMT markers and confirmed decreased expression of CDH2, VIM and MMP-2 and increase of CDH1 after treatment in both SACC-LM and SACC-83 cell lines (Figure 2(d)).

SP1 regulates SNAI1 by directly binding to the SP1-binding sites in the SNAI1 promoter region in SACC-LM and SACC-83 cells

We next explored the potential mechanism underlying the effects of mithramycin on EMT in SACC cells. Previous studies demonstrated that mithramycin is a specific inhibitor of SP1 and that SNAI1 is one of the vital transcription factors that regulate EMT. Thus, we next examined SP1 and SNAI1 mRNA and protein expression levels in cells treated with mithramycin. After treatment of both SACC cell lines with mithramycin, both SP1 and SNAI1 mRNA and proteins levels were significantly decreased (Figure 3(a) and (b)).

Figure 3.

SP1 binds to the Snail gene promoter. (a) qPCR evaluation of SP1 and Snail mRNA levels normalized to GADPH mRNA levels in SACC cells treated with mithramycin (0, 0.02, 0.04 and 0.08 µM). (b) Western blot analysis of SP1 and Snail protein levels in SACC cells treated with mithramycin (0, 0.02, 0.04 and 0.08 µM). GAPDH was used as a loading control (*p < 0.5, **p < 0.01 and ***p < 0.001). (c) (Top) Schematic representation of the Snail promoter region with GC boxes shown in boxes. (Bottom) Chromatin immunoprecipitation (ChIP) assays in SACC cells using SP1 antibody. IgG was used as an immunoprecipitation control. (d) (Top) Sequences of the wild-type (WT) GC boxes in the Snail promoter region and the mutated (Mut) sequences in the luciferase reporter constructs. (Bottom) Dual-luciferase reporter assay. SACC cells were cotransfected with SP1-overexpression vector and the indicated reporter construct, along with Renilla control (*p < 0.5, **p < 0.01 and ***p < 0.001).

The SP1 transcription factor binds to GC-rich motifs, also known as GC-box elements, of many promoters to enhance gene transcription. We found a length of GC-rich sequence upstream of the transcription start site in the SNAI1 promoter using Bioinformatics Analysis (Figure 3(c)), in which the proportions of G and C are 41.8% and 35.2%, respectively, while A and T are only 14.8% and 8.2%. We thus next performed ChIP assays to examine the potential ability of SP1 to bind to the SNAI1 promoter. ChIP assay results revealed SP1 binding to the SNAI1 promoter, as shown in Figure 3(c). We also performed luciferase assays using a reporter vector driven by either the wild-type SNAI promoter (WT) or the SNAI promoter with mutated GC boxes (Mut) (Figure 3(d)). Luciferase results revealed that SP1 successfully drove luciferase expression in the WT construct, but had no effect on the Mut reporter. These data confirm that SP1 binds to the SNA1 promoter to positively regulate its expression.

Together these results suggest that the mechanism of mithramycin reduction of EMT in SACC cells may occur by mithramycin inhibition of SP1 and subsequent decrease in SNAI1 transcription.

Mithramycin decreases EMT by downregulating SP1 in human SACC cells

To further demonstrate the role of SP1 in the process of mithramycin diminishing EMT, we examined the effects of mithramycin in SACC cells in the absence and presence of overexpressed SP1 by plasmid transfection. We found that while the Mith treatment group showed decreased migration and invasion capabilities compared with controls, the migration and invasion capability was enhanced in the SP1 + Mith treatment group compared with the Mith treatment group (Figure 4(a) and (b)). Furthermore, both qPCR and western blot experiments showed that SP1, SNAI1, CDH2, VIM and MMP-2 were higher in the SP1 + Mith group compared with the Mith treatment group, while CDH1 was lower than the Mith treatment group (Figure 4(c)). Together these findings confirmed that mithramycin diminished EMT in human SACC cells via downregulating SP1 and suggest that SP1 affected the process of EMT via reducing SNAI1 transcription through directly binding to the SNAI1 promoter to inhibit the EMT relative marker protein expression.

Figure 4.

Mithramycin decreased EMT by downregulating SP1 in human SACC cells. SACC-LM and SACC-83 cells were separated into three groups and treated as follows: Control, untreated cells; Mith, mithramycin (0.08 µM)-treated cells and SP1 + Mith, in which SP1 was overexpressed by plasmid transfection and simultaneously treated with mithramycin (0.08 µM). (a) Cell migration activities of all three groups were examined by wound-healing assays after cells were treated for 48 h. (b) Cell invasion activities of all three groups was evaluated by invasion assays after treatment for 48 h. (c) Western blot analysis of SP1, Snail, E-cadherin, N-cadherin, Vimentin and MMP-2 in all three groups after treatment for 48 h. GAPDH was used as a loading control (*p < 0.5, **p < 0.01 and ***p < 0.001).

SP1 and SNAI1 were upregulated in human SACC tissues and mithramycin inhibited EMT of SACC in xenograft mouse model

We next explored the expressions of SP1 and SNAI1 in human SACC tissues by qPCR in 11 human SACC cases. The results showed that 8 of 11 human SACC cases exhibited overexpression of SP1 and 6 of 11 human SACC cases showed overexpression of SNAI1 mRNA relative to the adjacent non-cancerous tissues (Figure 5(a) and (b)). Furthermore, the expressions of SP1 and SNAI1 in the same tissues were positively correlated when both SACC tissues and normal salivary were considered (n = 16, p < 0.05; Figure 5(c)). Western blot assay also showed that SP1 protein level was upregulated in the human SACC tumour tissues compared with non-tumour tissues (Figure 5(d)).

Figure 5.

Expression of SP1 in human salivary adenoid cystic carcinoma tissues and adjacent non-cancerous tissues. Expression levels of (a) SP1 and (b) Snail were detected by qPCR in salivary adenoid cystic carcinoma tissues or adjacent non-cancerous tissues (N: adjacent non-cancerous tissues; T: salivary adenoid cystic carcinoma tissues). (c) The correlation of the expression of SP1 and Snail in both SACC and normal tissues. (d) Survival curve of SACC cell-derived subcutaneous xenograft tumours in the presence or absence of mithramycin (n = 10, each group). (e) SACC cell-derived subcutaneous xenograft tumours on week 4 after mithramycin treatment. Tumours are indicated by the arrows. (f) Expression of SP1 and Snail detected in the xenograft tumours using immunohistochemistry (DAB, 40×). The chart shows SP1 and Snail positivity. (g) Expression of SP1 as detected by Western blot in salivary adenoid cystic carcinoma tissues or adjacent non-cancerous tissues. (h) Tumour volume, (i) tumour weight and (j) body weight of both control and mithramycin-treated mice were recorded (*p < 0.5, **p < 0.01 and ***p < 0.001).

We next examined the effects of mithramycin in vivo using a xenograft mouse model. The survival curve showed that nude mice injected with mithramycin lived longer than those injected with PBS (Figure 5(e)). Tumour formation and changes in nodule volume of the tumours were greater in the mithramycin-treated group than in the control group (Figure 5(f)). We also found that expression of SP1 and SNAI1 was reduced in tumours treated with mithramycin, similar to our in vitro results (Figure 5(g)). Mithramycin treatment significantly reduced tumour volume and weight in xenografts (Figure 5(h) and (i)), but did not result in any changes in the body weight of the xenograft mice (Figure 5(j)), which indicated low toxicity of mithramycin.

Discussion

SACC is a rare malignant neoplasm that arises from secretory epithelial cells of salivary glands. Currently, surgical resection is the primary method for treating SACC, and postoperative radiotherapy is necessary to kill remaining cancer cells and prevent distant metastasis. Chemotherapy is also a choice for adenoid cystic carcinoma therapy. Currently, the primary therapeutic agents for SACC include epirubicin, cisplatin and 5-Fu.²⁷ However, the precise effects of chemotherapy for SACC were unconfirmed until now, and there is an urgent need for innovative treatment regimens that target specific genetic drivers in SACC. We explored a classical anti-tumour (mithramycin) drug for use in SACC.

Previous studies have suggested that mithramycin inhibits the growth of various human cancers including oesophageal, prostate, pancreatic, cervical, lung and breast cancer by decreasing SP1 protein,^28–33 yet the effects on SACC remained unclear. Increased proliferation, migration and invasion are widely considered to be cancer hallmarks and are pivotal processes for SACC progression. In our study, we found that SP1 expression was higher in SACC tissues than adjacent non-cancerous tissues. Based on these findings, we investigated the ability of mithramycin to modulate different SACC properties, including proliferation, apoptosis, migration and invasion both in vitro and in vivo. As expected, in vitro, we found that mithramycin significantly inhibited proliferation, migration, invasion and EMT and promoted apoptosis in human SACC cell lines in a dose-dependent manner. We also investigated EMT- and invasion-associated markers, and the results showed that expression of CDH2, VIM and MMP-2 was decreased, while CDH1 was increased after treating SACC-LM and SACC-83 cell lines with mithramycin. Moreover, our in vivo studies indicated that mithramycin could decrease the volume and weight of xenograft tumours and significantly decrease the expression of EMT markers in SACC tissues. Thus, mithramycin is a potential anti-metastasis agent for SACC. We detected SP1 expression in SACC tissues and found that SP1 was highly overexpressed in SACC tissues compared with adjacent normal tissues, and mithramycin significantly downregulated SP1 expression in a dose- and time-dependent manner. This study also indicated that SP1 was downregulated by mithramycin by comparing the migration and invasion ability and expression of EMT-associated proteins in the SP1 + Mith treatment group with the Mith-only group.

SP1 is required for transforming growth factor (TGF)-β-induced EMT and migration in pancreatic cancer cells, and acetylated SP1 inhibits phosphatase and tensin homologue (PTEN) expression through binding to the PTEN core promoter, which has been shown to promote cancer cell migration and invasion.³⁴ CYP1B1 enhances proliferation and metastasis through EMT induction via upregulating SP1 in MCF-7 and MCF-10 cells.³⁵ In this study, we also found that SP1 promoted migration, invasion and EMT in SACC cells. These findings suggest that mithramycin is an important EMT-inhibitory agent that targets SP1 in SACC. SP1 is a zinc-finger transcription factor that binds to GC-rich motifs and regulates various physiologic processes. Mithramycin is a dominant-negative Sp1 mutant or disruption of the CACCC boxes by mutagenesis inhibits promoter activity. Our chromatin immunoprecipitation (ChIP) assay and dual-luciferase reporter assay showed that SP1 induced SNAI1 transcription through directly binding to the SNAI1 promoter (−415 to −410 bp and −375 to −370 bp). SNAI1 is one of the master regulators of EMT and mediates invasiveness as well as metastasis in many different tumour types. Loss of CDH1 and gain of VIM are hallmarks of the invasive phase of cancer. We speculate that mithramycin inhibited EMT in SACC via downregulating SP1, which in turn downregulated SNAI1 expression, which translated to an upregulation of CDH1 and downregulation of CDH2, VIM and MMP-2.

In summary, to the best of our knowledge, our study is the first to report the effects of mithramycin on the tumourigenic properties of SACC cells and the molecular mechanism underlying SP1/SNAI1-mediated cancer progression. Mithramycin is an SP1 inhibitor and using this has been reported to be an efficient treatment for several cancers. Moreover, mithramycin shows low toxicity owing to inconspicuous changes about the body weight of the xenograft mice. Our results demonstrate that mithramycin inhibits SACC EMT via reducing the expression of SP1. Mithramycin is expected to become an important agent in the comprehensive treatment of SACC and may improve the current strategy of SACC therapy.

Footnotes

Acknowledgements

The authors thank Jiangsu Province Hospital and Nanjing Medical University First Affiliated Hospital for general assistance. J.L. and H.G. contributed equally to this work.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

Moskaluk

CA.

Adenoid cystic carcinoma: clinical and molecular features. Head Neck Pathol 2013; 7: 17–22.

Liu

Shao

Tan

. Molecular biology of adenoid cystic carcinoma. Head Neck 2012; 34: 1665–1677.

Spiro

RH.

Distant metastasis in adenoid cystic carcinoma of salivary origin. Am J Surg 1997; 174: 495–498.

Bradley

PJ.

Adenoid cystic carcinoma of the head and neck: a review. Curr Opin Otolaryngol Head Neck Surg 2004; 12: 127–132.

Shi

Wang

Dong

. The effect of proteoglycans inhibited by RNA interference on metastatic characters of human salivary adenoid cystic carcinoma. BMC Cancer 2009; 9: 456.

Lagha

Chraiet

Ayadi

. Systemic therapy in the management of metastatic or advanced salivary gland cancers. Oral Oncol 2012; 48: 948–957.

Cheng

Kandel

Yamashiro

. A multi-cancer mesenchymal transition gene expression signature is associated with prolonged time to recurrence in glioblastoma. PLoS ONE 2012; 7: e34705.

Tian

Shen

. Ginsenoside Rg3 inhibits epithelial-mesenchymal transition (EMT) and invasion of lung cancer by down-regulating FUT4. Oncotarget 2016; 7: 1619–1632.

Kalluri

Weinberg

RA.

The basics of epithelial-mesenchymal transition. J Clin Invest 2009; 119: 1420–1428.

10.

Taube

Herschkowitz

Komurov

. Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes. Proc Natl Acad Sci U S A 2010; 107: 15449–15454.

11.

Wijnhoven

Dinjens

Pignatelli

CDH1-catenin cell-cell adhesion complex and human cancer. Br J Surg 2000; 87: 992–1005.

12.

Comijn

Berx

Vermassen

. The two-handed E box binding zinc finger protein SIP1 downregulates CDH1 and induces invasion. Mol Cell 2001; 7: 1267–1278.

13.

Scheel

Weinberg

RA.

Cancer stem cells and epithelial-mesenchymal transition: concepts and molecular links. Semin Cancer Biol 2012; 22: 396–403.

14.

Singh

Settleman

EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene 2010; 29: 4741–4751.

15.

Curreri

Ansfield

FJ.

Mithramycin-human toxicology and preliminary therapeutic investigation. Cancer Chemother Rep 1960; 8: 18–22.

16.

Sewell

Ellis

A trial of mithramycin in the treatment of advanced malignant disease. Br J Cancer 1966; 20: 256–263.

17.

Zhang

Mathur

Zhang

. Mithramycin represses basal and cigarette smoke-induced expression of ABCG2 and inhibits stem cell signaling in lung and esophageal cancer cells. Cancer Res 2012; 72: 4178–4192.

18.

Yang

Song

Park

. Transcription factors Sp1 and Sp3 regulate expression of human ABCG2 gene and chemoresistance phenotype. Mol Cells 2013; 36: 368–375.

19.

Ohgami

Kato

Kobayashi

. Low-dose mithramycin exerts its anticancer effect via the p53 signaling pathway and synergizes with nutlin-3 in gynecologic cancers. Cancer Sci 2010; 101: 1387–1395.

20.

Zhao

Zhang

Guo

. Inhibition of the transcription factor Sp1 suppresses colon cancer stem cell growth and induces apoptosis in vitro and in nude mouse xenografts. Oncol Rep 2013; 30: 1782–1792.

21.

Choi

Chung

Kim

. Mithramycin A induces apoptosis by regulating the mTOR/Mcl-1/tBid pathway in androgen-independent prostate cancer cells. J Clin Biochem Nutr 2013; 53: 89–93.

22.

Blume

Snyder

Ray

. Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in vivo. J Clin Invest 1991; 88: 1613–1621.

23.

Rao

Atay

Shukla

. Mithramycin depletes specificity protein 1 and Activates p53 to mediate senescence and apoptosis of malignant pleural mesothelioma cells. Clin Cancer Res 2016; 22: 1197–1210.

24.

Davie

. The role of Sp1 and Sp3 in normal and cancer cell biology. Ann Anat 2010; 192: 275–283.

25.

Safe

Imanirad

Sreevalsan

. Transcription factor Sp1, also known as specificity protein 1 as a therapeutic target. Expert Opin Ther Targets 2014; 18: 759–769.

26.

Federico

Pallante

Bianco

. Chromobox protein homologue 7 protein, with decreased expression in human carcinomas, positively regulates CDH1 expression by interacting with the histone deacetylase 2 protein. Cancer Res 2009; 69: 7079–7087.

27.

Ross

Teoh

A’Hern

. Epirubicin, cisplatin and protracted venous infusion 5-Fluorouracil chemotherapy for advanced salivary adenoid cystic carcinoma. Clin Oncol 2009; 21: 311–314.

28.

Sun

Wang

Eckloff

. Conserved recurrent gene mutations correlate with pathway deregulation and clinical outcomes of lung adenocarcinoma in never-smokers. BMC Med Genomics 2014; 7: 32.

29.

Cao

Zheng

Wang

. A molecular prognostic model predicts esophageal squamous cell carcinoma prognosis. PLoS ONE 2014; 9: e106007.

30.

Choi

Jung

Lee

. Myeloid cell leukemia-1 is a key molecular target for mithramycin A-induced apoptosis in androgen-independent prostate cancer cells and a tumor xenograft animal model. Cancer Lett 2013; 328: 65–72.

31.

Gao

Jia

Kong

. Combining betulinic acid and mithramycin A effectively suppresses pancreatic cancer by inhibiting proliferation, invasion, and angiogenesis. Cancer Res 2011; 71: 5182–5193.

32.

Choi

Nam

Jung

. Modulation of specificity protein 1 by mithramycin A as a novel therapeutic strategy for cervical cancer. Sci Rep 2014; 4: 7162.

33.

Saha

Mukherjee

Mazumdar

. Mithramycin A sensitizes therapy-resistant breast cancer stem cells toward genotoxic drug doxorubicin. Transl Res 2015; 165: 558–577.

34.

Kou

Hao

Meng

. Acetylated Sp1 inhibits PTEN expression through binding to PTEN core promoter and recruitment of HDAC1 and promotes cancer cell migration and invasion. Carcinogenesis 2013; 34: 58–67.

35.

Kwon

Baek

. CYP1B1 enhances cell proliferation and metastasis through induction of EMT and activation of Wnt/beta-catenin signaling via Sp1 upregulation. PLoS ONE 2016; 11: e0151598.

Mithramycin inhibits epithelial-to-mesenchymal transition and invasion by downregulating SP1 and SNAI1 in salivary adenoid cystic carcinoma

Abstract

Keywords

Introduction

Materials and methods

Clinical samples and cell culture

Cell proliferation assay

Colony formation assay

Wound-healing assay

Invasion assay

Apoptosis assay

SP1 plasmid and plasmid transfection

Quantitative real-time polymerase chain reaction analysis

Western blot analysis

Chromatin immunoprecipitation assays

Dual-luciferase reporter assay

Xenograft mouse model

Immunohistochemistry

Statistical analysis

Results

Mithramycin affects different tumourigenic properties, including proliferation and apoptosis, of human SACC cells

Mithramycin inhibits migration, invasion and EMT of human SACC cells

SP1 regulates SNAI1 by directly binding to the SP1-binding sites in the SNAI1 promoter region in SACC-LM and SACC-83 cells

Mithramycin decreases EMT by downregulating SP1 in human SACC cells

SP1 and SNAI1 were upregulated in human SACC tissues and mithramycin inhibited EMT of SACC in xenograft mouse model

Discussion

Footnotes

Acknowledgements

Declaration of conflicting interests

Funding

References