Abstract
Growth hormone–secreting pituitary adenoma accounts for about 20% of the third most common intracranial neoplasm—pituitary adenomas—which makes up 15% of all intracranial tumors. The growth hormone–secreting pituitary adenoma invasion is a key risk factor associated with the operation results and highly correlated with the clinical prognosis. The epidermal growth factor–like domain multiple 7 protein, a unique 29 kDa secreted angiogenic factor, can result in pathologic angiogenesis and enhance the tumor migration and invasion. In this study, for the first time we found that epidermal growth factor–like domain multiple 7 protein expression was markedly higher in invasive growth hormone–secreting pituitary adenoma than non-invasive growth hormone–secreting pituitary adenoma. The tumor volume, histologic subtypes, invasiveness and recurrence of growth hormone–secreting pituitary adenoma were significantly associated with epidermal growth factor–like domain multiple 7 protein expression. Furthermore, we discovered that the histological classification methods of growth hormone–secreting pituitary adenoma according to electron microscopic examination and biological marker classification methods according to epidermal growth factor–like domain multiple 7 protein expression are more valuable in clinical application than the traditional classification methods based on Knosp and Hardy-Wilson grades. In summary, our results indicated epidermal growth factor–like domain multiple 7 protein participates in growth hormone–secreting pituitary adenoma proliferation and invasion regulation via Notch2/DLL3 signaling pathway. These findings raised the possibility that epidermal growth factor–like domain multiple 7 protein might serve as a useful biomarker to assess growth hormone–secreting pituitary adenoma invasion and prognosis or a potential therapeutic target for growth hormone–secreting pituitary adenoma treatment.
Keywords
Introduction
Pituitary adenoma (PA) are the third most common intracranial neoplasm representing 15% of all intracranial tumors, 1 while growth hormone–secreting pituitary adenoma (GHPA) accounts for about 20% of all PA. 2 Although GHPAs are generally benign histotypes, grow at slow rate, and lack local invasion, approximately 33% of GHPAs exhibit invasive and aggressive clinical courses that restrict safe and complete adenoma removal during transsphenoidal surgery and often lead to high recurrence. 3 The GHPA invasion is a key risk factor associated with the operation results and highly correlated with the clinical prognosis. However, the mechanisms underlying the GHPA invasion are poorly understood. Also, the current standard methods to assess tumor invasion based on Knosp and Hardy–Wilson grades4,5 have been questioned.6–8 Therefore, specific molecular biomarker for GHPA invasion will be helpful to guide the clinical diagnosis and treatment.
Epidermal growth factor–like domain multiple 7 (EGFL7) is a unique 29-kDa secreted angiogenic-signaling molecule, which is highly conserved among species and plays an important role during physiologic and pathologic angiogenesis.9–11 High-level ectopic EGFL7 expression was detected in human tumor tissues including kidney tumors, malignant gliomas, hepatocellular carcinomas (HCCs), colon cancers, breast cancer, oral squamous cell carcinoma, osteosarcoma, pancreatic carcinoma, and ovarian cancer.10,12–20 The levels of EGFL7 expression are significantly correlated with pathologic characteristics associated with clinical progression, poor prognosis, and tumor grade in a variety of tumors, such as malignant gliomas, HCC, and colon tumors.12–18,20 The overexpression of EGFL7 does not only result in abnormal vessel patterning and remodeling 21 but also enhances tumor migration and invasion by promoting cell motility via epidermal growth factor (EGF) receptor–dependent phosphorylation of focal adhesion kinase or Notch signaling pathway.16,19 Therefore, the elevated expression levels of EGFL7 in tumors and its roles in promoting tumor angiogenesis, migration, and invasion make EGFL7 a potential target for tumor therapy. As such, we believe EGFL7 can serve as a biomarker to assess tumor invasion and prognosis.
In this study, we first evaluated the clinical application value of traditional classification methods based on Knosp and Hardy–Wilson grades, histological classification methods according to electron microscopic examination, and biological marker classification methods according to EGFL7 expression. The different expression levels of EGFL7 in invasive GHPA and non-invasive GHPA were measured by western blots and immunohistochemistry (IHC) staining using tissue microarrays (TMAs). The relationships between EGFL7 expression and the clinicopathological variables were investigated to pave the way for the potential application of EGFL7 as a prognostic biomarker for GHPA. The correlation between EGFL7 expression and Notch2 expression was also assessed. Moreover, the endogenous EGFL7 in a rat pituitary–derived cell line GH3 cells was downregulated by RNA interference (RNAi) techniques to investigate its biological role and identify EGFL7-dependent downstream pathways.
Materials and methods
Patients and specimens
All 48 cases of GHPA operative specimens were obtained by either endoscopic transsphenoidal surgery or craniotomy from April 2011 to December 2014 (Department of Neurosurgery, Tiantan Hospital, Beijing, China). GHPA was diagnosed based on clinical symptoms, radiologic features, immunohistochemical hormone expression, expression of transcriptional factors Pit-1, and electron microscopic examination. Patients with previous radiation therapy, drug therapy, or plurihormonal GH tumors were excluded from this study. Invasive PAs (IPAs) were defined as Hardy–Wilson grade IV and/or Knosp grades III and IV 32,33 . According to electron microscopic examination, GHPA was divided into sparsely granulated GHPA, densely granulated GHPA, and mixed granulated GHPA, and detailed classification method is shown in Table 1. 22 Since mixed granulated GHPA clinical behavior is similar to densely granulated GHPA, in this study, we take these two kinds of GHPA as one group named non-sparsely granulated GHPA. Recurrence was diagnosed by comparing the follow-up magnetic resonance imaging (MRI) scan to the postoperative MRI scan within 72 h and confirmed histologically. The Ethics Committee of Beijing Tiantan Hospital study approved the protocol, and informed consent was obtained from all patients.
Criteria for pathological classification of GHPA according to electron microscopic examination.
GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.
Preparation of tissue sections and transmission electron micrographs
The specimen was first fixed with 2.5% glutaraldehyde in phosphate buffer (PB, pH = 7.4) for 6 h with shaking. After sufficient washing with 0.1M PB, the specimen was then cut into 1-cm3 tissue blocks. Blocks were post-fixed in 1% osmium tetroxide for 2 h at 4°C. Afterward, they were washed three times in distilled water, dehydrated in a graded series of ethanol (50%–100%) and propylene oxide, infiltrated with Epon 812, and finally polymerized in pure Epon 812 for 48 h at 65°C. Ultrathin sections were cut on an ultramicrotome using a diamond knife, collected on copper grids, and stained with 4% uranyl acetate and Reynold’s lead citrate before observed with JEM-1230 transmission electron microscope (TEM).
TMA construction
All tissues were fixed in 10% formaldehyde for 24 h and then embedded in paraffin. The tissue blocks were sliced and stained with hematoxylin and eosin (H&E). Three 2.0-mm diameter core biopsies were selected from each paraffin-embedded tissue blocks and then transferred to TMAs using Minicore tissue-arraying instrument (Mitogen, Alphelys, France). TMAs were built according to an online protocol (http://genome-www.stanford.edu/TMA/). That is, TMAs were cut into 4-µm sections, randomly ordered, and anonymized on the TMA slides. To minimize loss of antigenicity, the microarray slides were processed within 1 week after cutting.
IHC
In advance of IHC, H&E stains of all specimens were used to evaluate tumor content and quality. Immunohistochemical analysis with mouse monoclonal anti-EGFL7 antibody (1:200, 2H2 sc-101349; Santa Cruz Biotechnology, California, USA) and mouse monoclonal anti-Pit-1 antibody (1:200, 2C11; Santa Cruz Biotechnology, California, USA) were performed on the sections from all TMAs using Leica BOND-III (Leica Biosystems, Wetzlar, Germany) automated, random, and continuous-access slide staining system and heat-induced epitope retrieval at a high pH (3 min). The primary antibodies were detected by Bond Polymer Refine Detection system (Leica Biosystems). The expression of immunostained slides was examined by Aperio AT2 digital scanner (Leica Biosystems). Negative control was performed omitting the primary antibody. In addition, endothelial cells were used as the positive control, and all controls provided satisfactory results. An H-score was used to evaluate the percentage of immunostaining and the staining intensity (0, negative; 1+, weak; 2+, moderate; and 3+, strong), and H-score formula for calculating is as follows: H-score = (% cells 1+) + 2(% cells 2+) + 3(% cells 3+). Based on the H-score, EGFL7 staining in the tissue sections was categorized as weak (H-score of ≤80.5) and strong (H-score: >80.5).
Cell culture and transfection
Rat GHPA cells (GH3) were originally obtained from American Type Culture Collection (ATCC) and cultured in F-12K culture medium supplemented with 15% (v/v) horse serum and 2.5% (v/v) fetal bovine serum in a humidified incubator at 37°C in 5% (v/v) CO2. The culture medium was replaced every other day. Four vials of EGFL7 gene–specific short hairpin RNA (shRNA) expression vectors and non-effective shRNA cassette in pGFP-C-shLenti plasmid were purchased from OriGene Technologies (Beijing, China). The sequences of plasmid were as follows: (a) TTGACTCACTGAGCGAGCAGGTCTCCTTC, (b) AGCGAGCAGGTCTCCTTCCTGGAGGAACA, (c) TGTTGATGAATGCAGTACAGGAGAGGCCA, and (d) CTGTGGGAAGTTACTGGTGCCAGTGTTGG. The processes of cell transfection were performed with Lipofectamine™ 3000 (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocol. About 48 h after the transfection, GH3 cells were collected for measurement of messenger RNA (mRNA) by quantitative reverse transcription polymerase chain reaction (qRT-PCR) and 72 h after the transfection for EGFL7 active protein by western blotting, respectively.
RNA isolation and qRT-PCR
RNA from cell cultures was prepared using the RNeasy 96 QIAcube HT Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Possible DNA contamination was removed by deoxyribonuclease (DNAse) treatment. The quality of total RNA was examined through ultraviolet spectrophotometer. mRNA was reversely transcribed using RevertAid First Strand cDNA Synthesis Kit (Thermo, USA) following the manufacturer’s specifications. Gene expression was measured using Platinum® SYBR® Green qPCR SuperMix-UDG w/ROX (Thermo Scientific, Wilmington, DE, USA). qRT-PCR was performed using an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems). Differences among gene expression were quantified using the 2−ΔΔCt method with normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Specific primer sequences are as follows: EGFL7 (forward: TCGTGCAGCGTGTGTACCAG; reverse: GCGGTAGGCGGTCCTATAGATG) and GAPDH (forward: ACCACAGTCCATGCCATCACT; reverse: GTCCACCACCCTGTTGCTGTA).
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blot analyses
Proteins were extracted from cells and GHPA specimens within ice-cold radio immunoprecipitation assay (RIPA) lysis buffer (50 mM Tris, pH 7.5; 250 mM NaCl; 10 mM ethylenediaminetetraacetic acid (EDTA); 0.5% NP-40; 1 µg/mL leupeptin; 1 mM phenylmethylsulfonyl fluoride (PMSF); and 4 mM NaF; Sigma-Aldrich, St. Louis, MO, USA) containing protease and phosphatase inhibitor cocktails (Roche, Mannheim, Germany). Total extract lysates was centrifuged at 13,000
Cell proliferation and invasion assay
Proliferation of GH3 cells transfected with sh-B/C or non-silence shRNA was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The dye and solubilization solutions (Promega Proliferation Assay; Promega, Madison, WI, USA) were added every day for 5 days to separate 96-well plates, and absorbance was measured at 490 nm with a Spectra Rainbow (Tecan, Crailsheim, Germany) plate reader. Tumor cell invasion was carried out using Transwell chambers (8-µm pore size; Corning Costar Corp; Cambridge, MA, USA) with Matrigel (50 µg/mL; BD Biosciences; Bedford, MA, USA) in 24-well culture plates (BD Biosciences) according to the manufacturer’s protocol. EGFL7 shRNA or non-silence shRNA–transfected GH3 cells (105cells/well) in serum-free F-12K medium were seeded onto Matrigel-coated membranes in the upper chambers with incubation at 37°C. After 18 h invasion, cells adhering to the lower membrane were fixed in 4% paraformaldehyde (PFA) and stained using Harris. The average number of migrated cells was quantified by counting five random high-power fields (200×) under a phase-contrast microscope. All experiments were performed three times.
Results
Clinical and pathological features
We retrospectively identified 48 cases of GHPAs that met the inclusion criteria; details of the GH PA specimens included in the study are shown in Table 2. All patients present with acromegaly or gigantism and positive immunostaining for GH and Pit-1. According to Hardy–Wilson grade and Knosp classification grades, all the patients were classified into invasive GHPA group (n = 25) and non-invasive GHPA group (n = 23). Representative invasive GHPA and non-invasive GHPA are shown in Figures 1 and 2, respectively. In all the 48 patients or GHPA, there are 27 females and 21 males. Patients mean age was 38.19 ± 12.32 (ranged from 13 to 64) years, mean tumor volume was 5.24 ± 7.98 (range from 0.09 to 48.67) cm3, and mean preoperative serum GH was 23.75 ± 13.77 (ranged from 5.47 to 40) ng/mL.
Clinical and pathological features of 48 cases of GHPA.
GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.

Representative non-invasive GHPA according to Knosp grades and Hardy–Wilson grades. (a, b, and c) Magnetic resonance demonstrated an area of hypointensity after gadolinium injection. No abnormalities were found in the cavernous sinus and optic chiasm, (d) transmission electron micrographs showed the ultrastructure of dense secretory granules (×4000, scale bar: 5 µm), and (e) the morphological features of non-invasive GHPA were observed using HE staining (×400), (f) immunohistochemistry with GH showed intense cytoplasmic positivity (×400), and (g) Pit-1 nucleonic positivity (scale bar: 60 µm).

Representative invasive GHPA according to Knosp grades and Hardy-Wilson grades. (a, b, and c) Magnetic resonance revealed an about 25 mm × 30 mm × 20 mm pace occupying lesion in the sphenoid sinus, sella turcica, and left cavernous sinus with heterogeneous enhancement. The left cavernous sinus and optic chiasm were involved, (d) transmission electron micrographs showing the ultrastructure of sparse secretory granules (×4000, scale bar: 5 µm), (e) the morphological features of invasive GHPA were observed using HE staining (×400), (f) immunohistochemistry with GH showed cytoplasmic positivity (×400), and (g) Pit-1 nucleonic positivity (scale bar: 60 µm).
The recurrence of invasive GHPA was 10/25, while 3/23 in non-invasive GHPA (χ2 = 5.148, p = 0.070). According to the results of electron microscopic examination, patients were grouped into sparsely granulated GHPA group (N = 17) and non-sparsely granulated GHPA group (N = 31). The recurrence of sparsely granulated GHPA was 10/17, while 3/31 in non-sparsely granulated GHPA (χ2 = 12.402, p < 0.001). According to the median of H-score (H-score = 80.5) in IHC, patients were divided into weak EGFL7 expression group (N = 24) and strong EGFL7 expression group (N = 24). The recurrence of strong EGFL7 expression group was 11/24 and 2/24 in weak EGFL7 expression group (χ2 = 6.752, p = 0.009). These results suggest histological classification methods according to the electron microscopic examination and biological marker classification methods according to EGFL7 expression are more valuable in clinical application than Knosp and Hardy–Wilson grades. Patient age, tumor volume, and histologic subtypes, but not gender and preoperative serum GH level, had significant impacts on invasiveness of GHPA according to univariate analysis (Table 3). The gross total resection was found in 35 (72.92%) out of the 44 patients.
Univariate analysis for relationship between invasiveness and clinicopathological characteristics.
GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.
Expression of EGFL7 in GHPA
We first found that EGFL7 expression was markedly higher in invasive GHPA than in non-invasive ones by western blotting (Figure 3(a) and (b)). To verify the level of EGFL7 in GHPA, we constructed TMAs and IHC staining and confirmed the upregulation of EGFL7 in invasive GHPA compared to normal pituitary and non-invasive GHPA (Figure 3(c) and (d)). EGFL7-positive staining was predominant in the cytoplasm. EGFL7-positive endothelial cells can be observed in immunostained slides (Figure 3(d)). Cytoplasmic EGFL7 staining was significantly higher in invasive GHPA (mean H-score: 106.4) than in non-invasive GHPA (mean H-score: 54.5) and normal pituitary tissue (mean H-score: 12.7, Figure 3(c) and (d)). Using univariate analysis, tumor volume, histologic subtypes, invasiveness, and recurrence of GHPA was four important factors correlated with the level of EGFL7 expression. There was also a trend toward higher GFL7 expression of patient age ≤38 years (χ2 = 3.000, p = 0.083) and preoperative serum GH level >21.7 ng/mL (χ2 = 3.000, p = 0.083) (Table 4). Meanwhile, we validated the level of Notch2 expression by western blotting and found that Notch2 expression was significantly higher in invasive GHPA than in non-invasive GHPA-positive correlation with EGFL7 (Figure 3(a)).
Univariate analysis for relationship between EGFL7 and clinicopathological characteristics.
GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.

EGFL7 protein is highly expressed in invasive GHPA tissue. (a) Representative western blots of EGFL7 and Notch2 in invasive and non-invasive GHPA. Blots were reprobed with anti-GAPGH antibody to ensure equal loading. (b) Quantitative analysis of western blots showed that EGFL7 and Notch2 expression was markedly higher in invasive GHPA than in non-invasive GHPA. (c) Mean H-scores°±°SD of EGFL7 staining of tissue microarrays. *p < 0.05 versus normal pituitary; **p < 0.001 versus normal pituitary; #p < 0.05 versus non-invasive pituitary adenoma. (d) Representative images of EGFL7 staining of a tissue microarray showing that cytoplasmic EGFL7 staining was significantly higher in invasive GHPA than in non-invasive GHPA and normal pituitary tissue. EGFL7-positive endothelial cells can be observed in immunostained slides (red arrows) (scale bar: 60 µm).
Downregulating EGFL7 expression suppresses invasion and proliferation of GHPA
To investigate the role of EGFL7 in GHPA, we used lentivirus-mediated knockdown of endogenous EGFL7 expression in rat GH3 cell line. qRT-PCR analysis demonstrated a 83.3% reduction in EGFL7 mRNA level after transfected with sh-C and a 72.6% reduction with sh-B compared with the non-silence shRNA (Figure 4(d)). Western blots showed that the EGFL7 protein level was reduced to 36% (sh-C) and 45% (sh-B) at 72 h (Figure 4(a) and (b)). Thus, sh-C and sh-D were adopted in the following experiments. To clarify whether EGFL7 is involved in the invasion of GH3, we used transwell assays, chambers of which were coated with a thick Matrigel layer. Invasion efficiency of GH3 cells transfected with sh-C decreased threefold after 18 h of culture compared with non-silence shRNA, while twofold with sh-B (Figure 5(a) and (b)). To examine whether knockdown of EGFL7 induces the change of GH3 cell proliferation rate, MTT assay was performed. MTT assay revealed that the proliferation rate of GH3 cell transfected with sh-B/C significantly decreased compared with non-silence shRNA, suggesting that EGFL7 participates in regulating GH3 cell invasion and proliferation.

Lentivirus-mediated knockdown of endogenous EGFL7 expression and differential expression of Notch pathway. (a) Representative western blots of downregulated EGFL7 expression by RNAi and differential expression of Notch pathway. (b) and (c) Quantitative analysis of western blots showed GH3 cells transfected with sh-C or sh-B downregulated EGFL7 expression more efficiently. Knockdown of EGFL7 induced low expression of Notch2/DLL3. However, there are no significant alteration in Notch1, 4 and DLL1, 4. *p < 0.05 versus control and non-silence shRNA. (d) qRT–PCR analysis demonstrated a significantly reduction in EGFL7 mRNA expression after transfected with sh-C and sh-B. *p < 0.05 versus control and non-silence shRNA.

EGFL7 downregulation suppressed invasion and proliferation of GH3 cells. (a) Representative transwell invasion assays of GH3 cells were performed after knockdown of EGFL7. (b) Quantitative analysis indicated the invasion of GH3 cells decreased by about threefold with sh-C transfection and decreased twofold with sh-B transfectioncompared to transfected with non-silence shRNA. (c) MTT assay revealed that knockdown of EGFL7 suppresses GH3 cell proliferation rate.
EGFL7 participates in regulation of GH3 cell invasion and proliferation by Notch2/DLL3 signaling pathways
Notch signaling pathway plays a major role in tumor invasiveness. Previous studies showed that EGFL7 is able to interact with all four Notch receptors and to function, at least in part, by modulating Notch signaling.21,23 We therefore investigated whether the downregulation of EGFL7 affects Notch pathways. Protein extracts from GH3 cell transfected with sh-B/C and with non-silence shRNA were analyzed by western blot for measurement of Notch 1, 2, 4 and DLL 1, 3, 4. Approximately one-third levels of Notch2 were observed in extracts from GH3 cell transfected with sh-C compared with non-silence shRNA (p < 0.05), and about 1/2 in GH3 cell transfected with sh-B (Figure 4(a) and (b)). The level of DLL3 reduced to 62% (sh-C) and 65% (sh-B) compared to non-silence transfection (Figure 4(a) and (b)) (p < 0.05). However, there are no significant alteration in Notch 1, 4 and DLL 1, 4 (Figure 4(a) and (c)).
Discussion
GHPA accounts for about 20% of all PAs which are the third most common intracranial neoplasm representing 15% of all intracranial tumors.1,2 GHPA present with autonomous growth hormone and insulin-like growth factor-1 secretion, which may present with acromegaly in adults and gigantism in adolescence. Transsphenoidal surgery (TSS) is the first-line treatment for GHPA. Most GHPA is benign tumor, with slow growth rate and poor local invasion. Nevertheless, approximately 33% of invasive GHPA exhibit an aggressive clinical course that restricts safe and complete adenoma removal during TSS and results in higher recurrence. 3 IPAs are defined as a subset of infiltrative and destructive adenomas invading structures adjacent to the sella, such as cavernous sinus, dura mater, bone, and even the central nervous system. 24 However, identification of invasion is difficult on preoperative MRI and even during surgery in some cases because of the thin medial wall of the cavernous sinus and the variability in the shape, size, and distribution of the venous plexus.4,25–27 Nishioka et al 28 have claimed cavernous sinus invasion was even found in 14.4% of Knosp grade 0 or 1 tumors, which were previously considered to be rarely associated with invasion. Therefore, the current standards to determine tumor invasion based on Knosp and Hardy–Wilson grades4,5 have been questioned by numerous scholars.6–8 In our study, the recurrence of invasive GHPA was 10/25 and 3/23 in non-invasive GHPA (χ2 = 5.148, p = 0.070). The recurrence of sparsely granulated GHPA was 10/17, while 3/31 in non-sparsely granulated GHPA (χ2 = 12.402, p < 0.001). The recurrence of strong EGFL7 expression group was 11/24 and 2/24 in weak EGFL7 expression group (χ2 = 6.752, p = 0.009). Based on the result, we conclude that histological classification methods according to electron microscopic examination and biological marker classification methods according to EGFL7 expression are more valuable in clinical application than Knosp and Hardy–Wilson grades. We also found that the patient age, tumor volume, and histologic subtypes had significant impacts on invasiveness of GHPA.
The authors of several clinicopathological studies used biological markers such as Smad3, sFRP4, MIB-1, and p53 to assess tumor invasiveness.29–31 However, the usefulness of the MIB-1 index for differentiating between adenomas with or without invasion appears controversial. 28 EGFL7 is a unique 29-kDa secreted angiogenic-signaling molecule, which is highly conserved among species and plays a role during physiologic and pathologic angiogenesis.9–11 The EGFL7 protein sequence consists of an amino-terminal signal peptide domain, an EMI (a novel cysteine-rich domain of EMILINs and other extracellular proteins, interacts with the gC1q domains and participates in multimerization), and two centrally located EGF-like domains.9–11 One of the EGF-like domains comprises a region similar to the Delta–Serrate–LAG-2 domain, of which one binds Notch pathway,16,19,21,32 while the other interacts with Ca2+. 32 Previous studies have shown that EGFL7 binds to Jagged1 when the glycosylated Notch receptor prevents an interaction between the receptor and Jagged1 and in turn promotes DLL4/Notch binding, thus activating Notch signaling.21,33 EGFL7 expression is highly elevated in human tumors, including kidney tumors, malignant gliomas, HCCs, colon cancers, breast cancer, oral squamous cell carcinoma, osteosarcoma, pancreatic carcinoma, and ovarian cancer.10,12–20 The levels of EGFL7 expression are significantly correlated with pathologic characteristics associated with clinical progression, poor prognosis, and tumor grade in a variety of tumors, including malignant gliomas, HCC, and colon tumors.12–18,20 The overexpression of EGFL7 not only results in abnormal vessel patterning and remodeling 21 but also enhances migration and invasion by promoting cell motility via EGF receptor–dependent phosphorylation of focal adhesion kinase or Notch signaling pathway.16,19
Several studies have shown the benefits of blocking Notch signaling in tumor models.34–37 However, the suppression of Notch may result in adverse side effects, including disorders in multiple organs and the development of vascular tumors.38,39 In this study, for the first time, we found that EGFL7 expression was markedly higher in invasive GHPA than the non-invasive ones. Using univariate analysis, tumor volume, histologic subtypes, invasiveness, and recurrence of GHPA were four important factors correlated with the level of EGFL7 expression. There was also a trend toward higher GFL7 expression of patient age and preoperative serum GH level. Meanwhile, we also found Notch2 expression was significantly higher in invasive than in non-invasive GHPA-positive correlation with EGFL7. Knockdown of endogenous EGFL7 expression can inhibit GH3 cell proliferation and invasion and induce downregulate Notch2/DLL3 expression.
Conclusively, EGFL7 protein, a unique 29-kDa secreted angiogenic-signaling molecule, was markedly higher in invasive GHPA than in non-invasive GHPA. Tumor volume, histologic subtypes, invasiveness, and recurrence of GHPA were four important factors correlated with the level of EGFL7 expression. It is found that the classification methods of GHPA according to electron microscopic examination and biological marker classification methods according to EGFL7 expression are more valuable in clinical application than traditional classification methods based on Knosp and Hardy–Wilson grades. EGFL7 participates in regulation of proliferation and invasion of GHPA via Notch2/DLL3 signaling pathway. Therefore, the elevated levels of EGFL7 expression in GHPA and its roles in regulating biological behavior make EGFL7 a potential target for tumor therapy. It is anticipated that EGFL7 can be used as a biological marker to assess tumor invasion and prognosis.
Footnotes
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Ethical approval
The Ethics Committee of Beijing Tiantan Hospital study approved the protocol (Protocol ID of Beijing Tiantan Hospital study: KY2013-015-02) and informed consent was obtained from all patients.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by grants from the National Natural Science Foundation of China (81602182, 81502154), Natural Science Foundation of Shandong Province (ZR2016HP42), Natural Science Foundation of Beijing (7162035), Research Special Fund for Public Welfare Industry of Health of China (201402008), and National High Technology Research and Development Program of China (863 Program, 2015AA020504).
