EGFL7 participates in regulating biological behavior of growth hormone–secreting pituitary adenomas via Notch2/DLL3 signaling pathway

Abstract

Growth hormone–secreting pituitary adenoma accounts for about 20% of the third most common intracranial neoplasm—pituitary adenomas—which makes up 15% of all intracranial tumors. The growth hormone–secreting pituitary adenoma invasion is a key risk factor associated with the operation results and highly correlated with the clinical prognosis. The epidermal growth factor–like domain multiple 7 protein, a unique 29 kDa secreted angiogenic factor, can result in pathologic angiogenesis and enhance the tumor migration and invasion. In this study, for the first time we found that epidermal growth factor–like domain multiple 7 protein expression was markedly higher in invasive growth hormone–secreting pituitary adenoma than non-invasive growth hormone–secreting pituitary adenoma. The tumor volume, histologic subtypes, invasiveness and recurrence of growth hormone–secreting pituitary adenoma were significantly associated with epidermal growth factor–like domain multiple 7 protein expression. Furthermore, we discovered that the histological classification methods of growth hormone–secreting pituitary adenoma according to electron microscopic examination and biological marker classification methods according to epidermal growth factor–like domain multiple 7 protein expression are more valuable in clinical application than the traditional classification methods based on Knosp and Hardy-Wilson grades. In summary, our results indicated epidermal growth factor–like domain multiple 7 protein participates in growth hormone–secreting pituitary adenoma proliferation and invasion regulation via Notch2/DLL3 signaling pathway. These findings raised the possibility that epidermal growth factor–like domain multiple 7 protein might serve as a useful biomarker to assess growth hormone–secreting pituitary adenoma invasion and prognosis or a potential therapeutic target for growth hormone–secreting pituitary adenoma treatment.

Keywords

Epidermal growth factor–like domain multiple 7 protein growth hormone-secreting pituitary adenomas invasion proliferation notch signaling pathway

Introduction

Pituitary adenoma (PA) are the third most common intracranial neoplasm representing 15% of all intracranial tumors,¹ while growth hormone–secreting pituitary adenoma (GHPA) accounts for about 20% of all PA.² Although GHPAs are generally benign histotypes, grow at slow rate, and lack local invasion, approximately 33% of GHPAs exhibit invasive and aggressive clinical courses that restrict safe and complete adenoma removal during transsphenoidal surgery and often lead to high recurrence.³ The GHPA invasion is a key risk factor associated with the operation results and highly correlated with the clinical prognosis. However, the mechanisms underlying the GHPA invasion are poorly understood. Also, the current standard methods to assess tumor invasion based on Knosp and Hardy–Wilson grades^4,5 have been questioned.^6–8 Therefore, specific molecular biomarker for GHPA invasion will be helpful to guide the clinical diagnosis and treatment.

Epidermal growth factor–like domain multiple 7 (EGFL7) is a unique 29-kDa secreted angiogenic-signaling molecule, which is highly conserved among species and plays an important role during physiologic and pathologic angiogenesis.^9–11 High-level ectopic EGFL7 expression was detected in human tumor tissues including kidney tumors, malignant gliomas, hepatocellular carcinomas (HCCs), colon cancers, breast cancer, oral squamous cell carcinoma, osteosarcoma, pancreatic carcinoma, and ovarian cancer.^10,12–20 The levels of EGFL7 expression are significantly correlated with pathologic characteristics associated with clinical progression, poor prognosis, and tumor grade in a variety of tumors, such as malignant gliomas, HCC, and colon tumors.^12–18,20 The overexpression of EGFL7 does not only result in abnormal vessel patterning and remodeling²¹ but also enhances tumor migration and invasion by promoting cell motility via epidermal growth factor (EGF) receptor–dependent phosphorylation of focal adhesion kinase or Notch signaling pathway.^16,19 Therefore, the elevated expression levels of EGFL7 in tumors and its roles in promoting tumor angiogenesis, migration, and invasion make EGFL7 a potential target for tumor therapy. As such, we believe EGFL7 can serve as a biomarker to assess tumor invasion and prognosis.

In this study, we first evaluated the clinical application value of traditional classification methods based on Knosp and Hardy–Wilson grades, histological classification methods according to electron microscopic examination, and biological marker classification methods according to EGFL7 expression. The different expression levels of EGFL7 in invasive GHPA and non-invasive GHPA were measured by western blots and immunohistochemistry (IHC) staining using tissue microarrays (TMAs). The relationships between EGFL7 expression and the clinicopathological variables were investigated to pave the way for the potential application of EGFL7 as a prognostic biomarker for GHPA. The correlation between EGFL7 expression and Notch2 expression was also assessed. Moreover, the endogenous EGFL7 in a rat pituitary–derived cell line GH3 cells was downregulated by RNA interference (RNAi) techniques to investigate its biological role and identify EGFL7-dependent downstream pathways.

Materials and methods

Patients and specimens

All 48 cases of GHPA operative specimens were obtained by either endoscopic transsphenoidal surgery or craniotomy from April 2011 to December 2014 (Department of Neurosurgery, Tiantan Hospital, Beijing, China). GHPA was diagnosed based on clinical symptoms, radiologic features, immunohistochemical hormone expression, expression of transcriptional factors Pit-1, and electron microscopic examination. Patients with previous radiation therapy, drug therapy, or plurihormonal GH tumors were excluded from this study. Invasive PAs (IPAs) were defined as Hardy–Wilson grade IV and/or Knosp grades III and IV^32,33. According to electron microscopic examination, GHPA was divided into sparsely granulated GHPA, densely granulated GHPA, and mixed granulated GHPA, and detailed classification method is shown in Table 1.²² Since mixed granulated GHPA clinical behavior is similar to densely granulated GHPA, in this study, we take these two kinds of GHPA as one group named non-sparsely granulated GHPA. Recurrence was diagnosed by comparing the follow-up magnetic resonance imaging (MRI) scan to the postoperative MRI scan within 72 h and confirmed histologically. The Ethics Committee of Beijing Tiantan Hospital study approved the protocol, and informed consent was obtained from all patients.

Table 1.

Criteria for pathological classification of GHPA according to electron microscopic examination.

	GH-immunopositive secretory granules (Cam5.2)
	Diffuse perinuclear pattern (%)	Paranuclear dot pattern (%)
Densely granulated GHPA	≥70	<30
Sparsely granulated GHPA	<30	≥70
Mixed granulated GHPA	≥30 and <70	≥30 and <70

GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.

Preparation of tissue sections and transmission electron micrographs

The specimen was first fixed with 2.5% glutaraldehyde in phosphate buffer (PB, pH = 7.4) for 6 h with shaking. After sufficient washing with 0.1M PB, the specimen was then cut into 1-cm³ tissue blocks. Blocks were post-fixed in 1% osmium tetroxide for 2 h at 4°C. Afterward, they were washed three times in distilled water, dehydrated in a graded series of ethanol (50%–100%) and propylene oxide, infiltrated with Epon 812, and finally polymerized in pure Epon 812 for 48 h at 65°C. Ultrathin sections were cut on an ultramicrotome using a diamond knife, collected on copper grids, and stained with 4% uranyl acetate and Reynold’s lead citrate before observed with JEM-1230 transmission electron microscope (TEM).

TMA construction

All tissues were fixed in 10% formaldehyde for 24 h and then embedded in paraffin. The tissue blocks were sliced and stained with hematoxylin and eosin (H&E). Three 2.0-mm diameter core biopsies were selected from each paraffin-embedded tissue blocks and then transferred to TMAs using Minicore tissue-arraying instrument (Mitogen, Alphelys, France). TMAs were built according to an online protocol (http://genome-www.stanford.edu/TMA/). That is, TMAs were cut into 4-µm sections, randomly ordered, and anonymized on the TMA slides. To minimize loss of antigenicity, the microarray slides were processed within 1 week after cutting.

IHC

In advance of IHC, H&E stains of all specimens were used to evaluate tumor content and quality. Immunohistochemical analysis with mouse monoclonal anti-EGFL7 antibody (1:200, 2H2 sc-101349; Santa Cruz Biotechnology, California, USA) and mouse monoclonal anti-Pit-1 antibody (1:200, 2C11; Santa Cruz Biotechnology, California, USA) were performed on the sections from all TMAs using Leica BOND-III (Leica Biosystems, Wetzlar, Germany) automated, random, and continuous-access slide staining system and heat-induced epitope retrieval at a high pH (3 min). The primary antibodies were detected by Bond Polymer Refine Detection system (Leica Biosystems). The expression of immunostained slides was examined by Aperio AT2 digital scanner (Leica Biosystems). Negative control was performed omitting the primary antibody. In addition, endothelial cells were used as the positive control, and all controls provided satisfactory results. An H-score was used to evaluate the percentage of immunostaining and the staining intensity (0, negative; 1+, weak; 2+, moderate; and 3+, strong), and H-score formula for calculating is as follows: H-score = (% cells 1+) + 2(% cells 2+) + 3(% cells 3+). Based on the H-score, EGFL7 staining in the tissue sections was categorized as weak (H-score of ≤80.5) and strong (H-score: >80.5).

Cell culture and transfection

Rat GHPA cells (GH3) were originally obtained from American Type Culture Collection (ATCC) and cultured in F-12K culture medium supplemented with 15% (v/v) horse serum and 2.5% (v/v) fetal bovine serum in a humidified incubator at 37°C in 5% (v/v) CO₂. The culture medium was replaced every other day. Four vials of EGFL7 gene–specific short hairpin RNA (shRNA) expression vectors and non-effective shRNA cassette in pGFP-C-shLenti plasmid were purchased from OriGene Technologies (Beijing, China). The sequences of plasmid were as follows: (a) TTGACTCACTGAGCGAGCAGGTCTCCTTC, (b) AGCGAGCAGGTCTCCTTCCTGGAGGAACA, (c) TGTTGATGAATGCAGTACAGGAGAGGCCA, and (d) CTGTGGGAAGTTACTGGTGCCAGTGTTGG. The processes of cell transfection were performed with Lipofectamine™ 3000 (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocol. About 48 h after the transfection, GH3 cells were collected for measurement of messenger RNA (mRNA) by quantitative reverse transcription polymerase chain reaction (qRT-PCR) and 72 h after the transfection for EGFL7 active protein by western blotting, respectively.

RNA isolation and qRT-PCR

RNA from cell cultures was prepared using the RNeasy 96 QIAcube HT Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Possible DNA contamination was removed by deoxyribonuclease (DNAse) treatment. The quality of total RNA was examined through ultraviolet spectrophotometer. mRNA was reversely transcribed using RevertAid First Strand cDNA Synthesis Kit (Thermo, USA) following the manufacturer’s specifications. Gene expression was measured using Platinum^® SYBR^® Green qPCR SuperMix-UDG w/ROX (Thermo Scientific, Wilmington, DE, USA). qRT-PCR was performed using an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems). Differences among gene expression were quantified using the 2^−ΔΔCt method with normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Specific primer sequences are as follows: EGFL7 (forward: TCGTGCAGCGTGTGTACCAG; reverse: GCGGTAGGCGGTCCTATAGATG) and GAPDH (forward: ACCACAGTCCATGCCATCACT; reverse: GTCCACCACCCTGTTGCTGTA).

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blot analyses

Proteins were extracted from cells and GHPA specimens within ice-cold radio immunoprecipitation assay (RIPA) lysis buffer (50 mM Tris, pH 7.5; 250 mM NaCl; 10 mM ethylenediaminetetraacetic acid (EDTA); 0.5% NP-40; 1 µg/mL leupeptin; 1 mM phenylmethylsulfonyl fluoride (PMSF); and 4 mM NaF; Sigma-Aldrich, St. Louis, MO, USA) containing protease and phosphatase inhibitor cocktails (Roche, Mannheim, Germany). Total extract lysates was centrifuged at 13,000g for 10 min at 4°C, and the protein concentration of the supernatant was determined with a bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology, Rockford, IL, USA). After denaturation, 40 µg protein samples per lane were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 10% running gels and transferred to polyvinylidene fluoride (PVDF) membranes. Membranes were then blocked in Tris-buffered saline (TBS) buffer containing 5% degreased milk for 1 h at room temperature and incubated with primary antibody overnight at 4°C, rabbit polyclonal anti-EGFL7 antibody (1:500, H-90 sc-66874; Santa Cruz Biotechnology; 1:500, 19291-1-AP; Proteintech, Chicago, IL, USA), mouse monoclonal anti-EGFL7 antibody (1:2000, 2H2 sc-101349; Santa Cruz Biotechnology, California, USA), rabbit polyclonal anti-Notch1 (1:2000, ab27526; Abcam, Cambridge, USA), rabbit monoclonal anti-Notch1 (1:5000, ab194123; Abcam, Cambridge, USA), rabbit polyclonal anti-Notch2 (1:2000, ab8926; Abcam, Cambridge, USA), rabbit monoclonal anti-Notch4 (1:2000, ab184742; Abcam, Cambridge, USA), rabbit polyclonal anti-DLL3 (1:2000, ab10554; Abcam, Cambridge, USA), rabbit polyclonal anti-DLL3 (1:2000, ab63707; Abcam, Cambridge, USA), rabbit polyclonal anti-DLL4 (1:2000, ab7280; Abcam, Cambridge, USA), and GAPDH (1:8000; Sigma, St Louis, MO, USA) followed by secondary antibodies tagged with horseradish peroxidase (Abcam, Cambridge, USA). The membranes were visualized by enhanced chemiluminescence, and densitometry was performed with an Amersham Imager 6000 (GE Healthcare, Piscataway, NJ, USA). Analysis of GAPDH levels was used as a loading control.

Cell proliferation and invasion assay

Proliferation of GH3 cells transfected with sh-B/C or non-silence shRNA was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The dye and solubilization solutions (Promega Proliferation Assay; Promega, Madison, WI, USA) were added every day for 5 days to separate 96-well plates, and absorbance was measured at 490 nm with a Spectra Rainbow (Tecan, Crailsheim, Germany) plate reader. Tumor cell invasion was carried out using Transwell chambers (8-µm pore size; Corning Costar Corp; Cambridge, MA, USA) with Matrigel (50 µg/mL; BD Biosciences; Bedford, MA, USA) in 24-well culture plates (BD Biosciences) according to the manufacturer’s protocol. EGFL7 shRNA or non-silence shRNA–transfected GH3 cells (10⁵cells/well) in serum-free F-12K medium were seeded onto Matrigel-coated membranes in the upper chambers with incubation at 37°C. After 18 h invasion, cells adhering to the lower membrane were fixed in 4% paraformaldehyde (PFA) and stained using Harris. The average number of migrated cells was quantified by counting five random high-power fields (200×) under a phase-contrast microscope. All experiments were performed three times.

Results

Clinical and pathological features

We retrospectively identified 48 cases of GHPAs that met the inclusion criteria; details of the GH PA specimens included in the study are shown in Table 2. All patients present with acromegaly or gigantism and positive immunostaining for GH and Pit-1. According to Hardy–Wilson grade and Knosp classification grades, all the patients were classified into invasive GHPA group (n = 25) and non-invasive GHPA group (n = 23). Representative invasive GHPA and non-invasive GHPA are shown in Figures 1 and 2, respectively. In all the 48 patients or GHPA, there are 27 females and 21 males. Patients mean age was 38.19 ± 12.32 (ranged from 13 to 64) years, mean tumor volume was 5.24 ± 7.98 (range from 0.09 to 48.67) cm³, and mean preoperative serum GH was 23.75 ± 13.77 (ranged from 5.47 to 40) ng/mL.

Table 2.

Clinical and pathological features of 48 cases of GHPA.

Variables	N	Percentage
Gender
Male	21	43.75
Female	27	56.25
Age
Mean	38.19 ± 12.32
Median	38
Invasiveness
Invasive	25	52.08
Non-invasive	23	47.92
Tumor volume
Mean	5.24 ± 7.98
Median	3.09
Preoperative serum GH level (ng/mL)
Mean	23.75 ± 13.77
Median	21.7
Electron microscopic examination
Sparsely granulated GHPA	17	35.42
Non-sparsely granulated GHPA	31	64.58
Recurrence
Yes	13	27.08
No	35	72.92
Gross total resection
Yes	35	72.92
No	13	27.08

GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.

Figure 1.

Representative non-invasive GHPA according to Knosp grades and Hardy–Wilson grades. (a, b, and c) Magnetic resonance demonstrated an area of hypointensity after gadolinium injection. No abnormalities were found in the cavernous sinus and optic chiasm, (d) transmission electron micrographs showed the ultrastructure of dense secretory granules (×4000, scale bar: 5 µm), and (e) the morphological features of non-invasive GHPA were observed using HE staining (×400), (f) immunohistochemistry with GH showed intense cytoplasmic positivity (×400), and (g) Pit-1 nucleonic positivity (scale bar: 60 µm).

Figure 2.

Representative invasive GHPA according to Knosp grades and Hardy-Wilson grades. (a, b, and c) Magnetic resonance revealed an about 25 mm × 30 mm × 20 mm pace occupying lesion in the sphenoid sinus, sella turcica, and left cavernous sinus with heterogeneous enhancement. The left cavernous sinus and optic chiasm were involved, (d) transmission electron micrographs showing the ultrastructure of sparse secretory granules (×4000, scale bar: 5 µm), (e) the morphological features of invasive GHPA were observed using HE staining (×400), (f) immunohistochemistry with GH showed cytoplasmic positivity (×400), and (g) Pit-1 nucleonic positivity (scale bar: 60 µm).

The recurrence of invasive GHPA was 10/25, while 3/23 in non-invasive GHPA (χ² = 5.148, p = 0.070). According to the results of electron microscopic examination, patients were grouped into sparsely granulated GHPA group (N = 17) and non-sparsely granulated GHPA group (N = 31). The recurrence of sparsely granulated GHPA was 10/17, while 3/31 in non-sparsely granulated GHPA (χ² = 12.402, p < 0.001). According to the median of H-score (H-score = 80.5) in IHC, patients were divided into weak EGFL7 expression group (N = 24) and strong EGFL7 expression group (N = 24). The recurrence of strong EGFL7 expression group was 11/24 and 2/24 in weak EGFL7 expression group (χ² = 6.752, p = 0.009). These results suggest histological classification methods according to the electron microscopic examination and biological marker classification methods according to EGFL7 expression are more valuable in clinical application than Knosp and Hardy–Wilson grades. Patient age, tumor volume, and histologic subtypes, but not gender and preoperative serum GH level, had significant impacts on invasiveness of GHPA according to univariate analysis (Table 3). The gross total resection was found in 35 (72.92%) out of the 44 patients.

Table 3.

Univariate analysis for relationship between invasiveness and clinicopathological characteristics.

Variables	Invasiveness (N (%))		Univariate analysis
Variables	Invasive (N = 25)	Non-invasive (N = 23)	χ²	p
Gender
Male	10 (40.00)	11 (47.83)	0.298	0.585
Female	15 (60.00)	12 (52.17)	0.298	0.585
Age
≤38	16 (64.00)	8 (34.78)	4.090	0.043
>38	9 (36.00)	13 (65.22)	4.090	0.043
Tumor volume (cm³)
≤3.09	4 (16.00)	20 (86.96)	21.370	<0.001
>3.09	21 (84.00)	3 (13.04)	21.370	<0.001
Preoperative serum GH level (ng/mL)
≤21.7	10 (40.00)	14 (60.87)	2.087	0.149
>21.7	15 (60.00)	9 (39.13)	2.087	0.149
Electron microscopic examination
Sparsely granulated GHPA	14 (56.00)	3 (13.04)	7.877	0.005
Non-sparsely granulated GHPA	11 (44.00)	20 (86.96)	7.877	0.005

GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.

Expression of EGFL7 in GHPA

We first found that EGFL7 expression was markedly higher in invasive GHPA than in non-invasive ones by western blotting (Figure 3(a) and (b)). To verify the level of EGFL7 in GHPA, we constructed TMAs and IHC staining and confirmed the upregulation of EGFL7 in invasive GHPA compared to normal pituitary and non-invasive GHPA (Figure 3(c) and (d)). EGFL7-positive staining was predominant in the cytoplasm. EGFL7-positive endothelial cells can be observed in immunostained slides (Figure 3(d)). Cytoplasmic EGFL7 staining was significantly higher in invasive GHPA (mean H-score: 106.4) than in non-invasive GHPA (mean H-score: 54.5) and normal pituitary tissue (mean H-score: 12.7, Figure 3(c) and (d)). Using univariate analysis, tumor volume, histologic subtypes, invasiveness, and recurrence of GHPA was four important factors correlated with the level of EGFL7 expression. There was also a trend toward higher GFL7 expression of patient age ≤38 years (χ² = 3.000, p = 0.083) and preoperative serum GH level >21.7 ng/mL (χ² = 3.000, p = 0.083) (Table 4). Meanwhile, we validated the level of Notch2 expression by western blotting and found that Notch2 expression was significantly higher in invasive GHPA than in non-invasive GHPA-positive correlation with EGFL7 (Figure 3(a)).

Table 4.

Univariate analysis for relationship between EGFL7 and clinicopathological characteristics.

Variables	EGFL7 expression (N (%))		Univariate analysis
Variables	Weak (N = 24)	Strong (N = 24)	χ²	p
Gender
Male	12 (50.00)	9 (37.50)	0.762	0.383
Female	12 (50.00)	15 (62.50)	0.762	0.383
Age
≤38	9 (37.50)	15 (62.50)	3.000	0.083
>38	15 (62.50)	9 (37.50)	3.000	0.083
Tumor volume (cm3)
≤3.09	18 (75.00)	6 (25.00)	12.000	<0.001
>3.09	6 (25.00)	18 (75.00)	12.000	<0.001
Preoperative serum GH level (ng/mL)
≤21.7	15 (62.50)	9 (37.50)	3.000	0.083
>21.7	9 (37.50)	15 (62.50)	3.000	0.083
Electron microscopic examination
Sparsely granulated GHPA	2 (8.33)	15 (62.50)	13.116	<0.001
Non-sparsely granulated GHPA	22 (91.67)	9 (37.50)	13.116	<0.001
Invasiveness
Invasive	5 (20.83)	20 (83.33)	16.362	<0.001
Non-invasive	19 (79.17)	4 (16.67)	16.362	<0.001
Recurrence
Yes	2 (8.33)	11 (45.83)	6.752	0.009
No	22 (91.67)	13 (54.17	6.752	0.009

GH: growth hormone; GHPA: growth hormone–secreting pituitary adenoma.

Figure 3.

EGFL7 protein is highly expressed in invasive GHPA tissue. (a) Representative western blots of EGFL7 and Notch2 in invasive and non-invasive GHPA. Blots were reprobed with anti-GAPGH antibody to ensure equal loading. (b) Quantitative analysis of western blots showed that EGFL7 and Notch2 expression was markedly higher in invasive GHPA than in non-invasive GHPA. (c) Mean H-scores°±°SD of EGFL7 staining of tissue microarrays. *p < 0.05 versus normal pituitary; **p < 0.001 versus normal pituitary; ^#p < 0.05 versus non-invasive pituitary adenoma. (d) Representative images of EGFL7 staining of a tissue microarray showing that cytoplasmic EGFL7 staining was significantly higher in invasive GHPA than in non-invasive GHPA and normal pituitary tissue. EGFL7-positive endothelial cells can be observed in immunostained slides (red arrows) (scale bar: 60 µm).

Downregulating EGFL7 expression suppresses invasion and proliferation of GHPA

To investigate the role of EGFL7 in GHPA, we used lentivirus-mediated knockdown of endogenous EGFL7 expression in rat GH3 cell line. qRT-PCR analysis demonstrated a 83.3% reduction in EGFL7 mRNA level after transfected with sh-C and a 72.6% reduction with sh-B compared with the non-silence shRNA (Figure 4(d)). Western blots showed that the EGFL7 protein level was reduced to 36% (sh-C) and 45% (sh-B) at 72 h (Figure 4(a) and (b)). Thus, sh-C and sh-D were adopted in the following experiments. To clarify whether EGFL7 is involved in the invasion of GH3, we used transwell assays, chambers of which were coated with a thick Matrigel layer. Invasion efficiency of GH3 cells transfected with sh-C decreased threefold after 18 h of culture compared with non-silence shRNA, while twofold with sh-B (Figure 5(a) and (b)). To examine whether knockdown of EGFL7 induces the change of GH3 cell proliferation rate, MTT assay was performed. MTT assay revealed that the proliferation rate of GH3 cell transfected with sh-B/C significantly decreased compared with non-silence shRNA, suggesting that EGFL7 participates in regulating GH3 cell invasion and proliferation.

Figure 4.

Lentivirus-mediated knockdown of endogenous EGFL7 expression and differential expression of Notch pathway. (a) Representative western blots of downregulated EGFL7 expression by RNAi and differential expression of Notch pathway. (b) and (c) Quantitative analysis of western blots showed GH3 cells transfected with sh-C or sh-B downregulated EGFL7 expression more efficiently. Knockdown of EGFL7 induced low expression of Notch2/DLL3. However, there are no significant alteration in Notch1, 4 and DLL1, 4. *p < 0.05 versus control and non-silence shRNA. (d) qRT–PCR analysis demonstrated a significantly reduction in EGFL7 mRNA expression after transfected with sh-C and sh-B. *p < 0.05 versus control and non-silence shRNA.

Figure 5.

EGFL7 downregulation suppressed invasion and proliferation of GH3 cells. (a) Representative transwell invasion assays of GH3 cells were performed after knockdown of EGFL7. (b) Quantitative analysis indicated the invasion of GH3 cells decreased by about threefold with sh-C transfection and decreased twofold with sh-B transfectioncompared to transfected with non-silence shRNA. (c) MTT assay revealed that knockdown of EGFL7 suppresses GH3 cell proliferation rate.

EGFL7 participates in regulation of GH3 cell invasion and proliferation by Notch2/DLL3 signaling pathways

Notch signaling pathway plays a major role in tumor invasiveness. Previous studies showed that EGFL7 is able to interact with all four Notch receptors and to function, at least in part, by modulating Notch signaling.^21,23 We therefore investigated whether the downregulation of EGFL7 affects Notch pathways. Protein extracts from GH3 cell transfected with sh-B/C and with non-silence shRNA were analyzed by western blot for measurement of Notch 1, 2, 4 and DLL 1, 3, 4. Approximately one-third levels of Notch2 were observed in extracts from GH3 cell transfected with sh-C compared with non-silence shRNA (p < 0.05), and about 1/2 in GH3 cell transfected with sh-B (Figure 4(a) and (b)). The level of DLL3 reduced to 62% (sh-C) and 65% (sh-B) compared to non-silence transfection (Figure 4(a) and (b)) (p < 0.05). However, there are no significant alteration in Notch 1, 4 and DLL 1, 4 (Figure 4(a) and (c)).

Discussion

GHPA accounts for about 20% of all PAs which are the third most common intracranial neoplasm representing 15% of all intracranial tumors.^1,2 GHPA present with autonomous growth hormone and insulin-like growth factor-1 secretion, which may present with acromegaly in adults and gigantism in adolescence. Transsphenoidal surgery (TSS) is the first-line treatment for GHPA. Most GHPA is benign tumor, with slow growth rate and poor local invasion. Nevertheless, approximately 33% of invasive GHPA exhibit an aggressive clinical course that restricts safe and complete adenoma removal during TSS and results in higher recurrence.³ IPAs are defined as a subset of infiltrative and destructive adenomas invading structures adjacent to the sella, such as cavernous sinus, dura mater, bone, and even the central nervous system.²⁴ However, identification of invasion is difficult on preoperative MRI and even during surgery in some cases because of the thin medial wall of the cavernous sinus and the variability in the shape, size, and distribution of the venous plexus.^4,25–27 Nishioka et al²⁸ have claimed cavernous sinus invasion was even found in 14.4% of Knosp grade 0 or 1 tumors, which were previously considered to be rarely associated with invasion. Therefore, the current standards to determine tumor invasion based on Knosp and Hardy–Wilson grades^4,5 have been questioned by numerous scholars.^6–8 In our study, the recurrence of invasive GHPA was 10/25 and 3/23 in non-invasive GHPA (χ² = 5.148, p = 0.070). The recurrence of sparsely granulated GHPA was 10/17, while 3/31 in non-sparsely granulated GHPA (χ² = 12.402, p < 0.001). The recurrence of strong EGFL7 expression group was 11/24 and 2/24 in weak EGFL7 expression group (χ² = 6.752, p = 0.009). Based on the result, we conclude that histological classification methods according to electron microscopic examination and biological marker classification methods according to EGFL7 expression are more valuable in clinical application than Knosp and Hardy–Wilson grades. We also found that the patient age, tumor volume, and histologic subtypes had significant impacts on invasiveness of GHPA.

The authors of several clinicopathological studies used biological markers such as Smad3, sFRP4, MIB-1, and p53 to assess tumor invasiveness.^29–31 However, the usefulness of the MIB-1 index for differentiating between adenomas with or without invasion appears controversial.²⁸ EGFL7 is a unique 29-kDa secreted angiogenic-signaling molecule, which is highly conserved among species and plays a role during physiologic and pathologic angiogenesis.^9–11 The EGFL7 protein sequence consists of an amino-terminal signal peptide domain, an EMI (a novel cysteine-rich domain of EMILINs and other extracellular proteins, interacts with the gC1q domains and participates in multimerization), and two centrally located EGF-like domains.^9–11 One of the EGF-like domains comprises a region similar to the Delta–Serrate–LAG-2 domain, of which one binds Notch pathway,^16,19,21,32 while the other interacts with Ca²⁺.³² Previous studies have shown that EGFL7 binds to Jagged1 when the glycosylated Notch receptor prevents an interaction between the receptor and Jagged1 and in turn promotes DLL4/Notch binding, thus activating Notch signaling.^21,33 EGFL7 expression is highly elevated in human tumors, including kidney tumors, malignant gliomas, HCCs, colon cancers, breast cancer, oral squamous cell carcinoma, osteosarcoma, pancreatic carcinoma, and ovarian cancer.^10,12–20 The levels of EGFL7 expression are significantly correlated with pathologic characteristics associated with clinical progression, poor prognosis, and tumor grade in a variety of tumors, including malignant gliomas, HCC, and colon tumors.^12–18,20 The overexpression of EGFL7 not only results in abnormal vessel patterning and remodeling²¹ but also enhances migration and invasion by promoting cell motility via EGF receptor–dependent phosphorylation of focal adhesion kinase or Notch signaling pathway.^16,19

Several studies have shown the benefits of blocking Notch signaling in tumor models.^34–37 However, the suppression of Notch may result in adverse side effects, including disorders in multiple organs and the development of vascular tumors.^38,39 In this study, for the first time, we found that EGFL7 expression was markedly higher in invasive GHPA than the non-invasive ones. Using univariate analysis, tumor volume, histologic subtypes, invasiveness, and recurrence of GHPA were four important factors correlated with the level of EGFL7 expression. There was also a trend toward higher GFL7 expression of patient age and preoperative serum GH level. Meanwhile, we also found Notch2 expression was significantly higher in invasive than in non-invasive GHPA-positive correlation with EGFL7. Knockdown of endogenous EGFL7 expression can inhibit GH3 cell proliferation and invasion and induce downregulate Notch2/DLL3 expression.

Conclusively, EGFL7 protein, a unique 29-kDa secreted angiogenic-signaling molecule, was markedly higher in invasive GHPA than in non-invasive GHPA. Tumor volume, histologic subtypes, invasiveness, and recurrence of GHPA were four important factors correlated with the level of EGFL7 expression. It is found that the classification methods of GHPA according to electron microscopic examination and biological marker classification methods according to EGFL7 expression are more valuable in clinical application than traditional classification methods based on Knosp and Hardy–Wilson grades. EGFL7 participates in regulation of proliferation and invasion of GHPA via Notch2/DLL3 signaling pathway. Therefore, the elevated levels of EGFL7 expression in GHPA and its roles in regulating biological behavior make EGFL7 a potential target for tumor therapy. It is anticipated that EGFL7 can be used as a biological marker to assess tumor invasion and prognosis.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethical approval

The Ethics Committee of Beijing Tiantan Hospital study approved the protocol (Protocol ID of Beijing Tiantan Hospital study: KY2013-015-02) and informed consent was obtained from all patients.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by grants from the National Natural Science Foundation of China (81602182, 81502154), Natural Science Foundation of Shandong Province (ZR2016HP42), Natural Science Foundation of Beijing (7162035), Research Special Fund for Public Welfare Industry of Health of China (201402008), and National High Technology Research and Development Program of China (863 Program, 2015AA020504).

References

Scheithauer

Gaffey

Lloyd

. Pathobiology of pituitary adenomas and carcinomas. Neurosurgery 2006; 59: 341–353.

Iuchi

Saeki

Tanaka

. MRI prediction of fibrous pituitary adenomas. Acta Neurochir 1998; 140: 779–786.

Dhandapani

Singh

Negm

. Cavernous sinus invasion in pituitary adenomas: systematic review and pooled data meta-analysis of radiologic criteria and comparison of endoscopic and microscopic surgery. World Neurosurg 2016; 96: 36–46.

Knosp

Steiner

Kitz

. Pituitary adenomas with invasion of the cavernous sinus space: a magnetic resonance imaging classification compared with surgical findings. Neurosurgery 1993; 33: 610–617.

Wilson

CB.

A decade of pituitary microsurgery. The Herbert Olivecrona lecture. J Neurosurg 1984; 61: 814–833.

Al-Shraim

Asa

SL.

The 2004 World Health Organization classification of pituitary tumors: what is new?

Acta Neuropathol 2006; 111: 1–7.

Grossman

AB.

The 2004 World Health Organization classification of pituitary tumors: is it clinically helpful?

Acta Neuropathol 2006; 111: 76–77.

Gurlek

Karavitaki

Ansorge

. What are the markers of aggressiveness in prolactinomas? Changes in cell biology, extracellular matrix components, angiogenesis and genetics. Eur J Endocrinol 2007; 156: 143–153.

Campagnolo

Leahy

Chitnis

. EGFL7 is a chemoattractant for endothelial cells and is up-regulated in angiogenesis and arterial injury. Am J Pathol 2005; 167: 275–284.

10.

Parker

Schmidt

Jin

. The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation. Nature 2004; 428: 754–758.

11.

Soncin

Mattot

Lionneton

. VE-statin, an endothelial repressor of smooth muscle cell migration. EMBO J 2003; 22: 5700–5711.

12.

Diaz

Silva

Garcia

. Deregulated expression of miR-106a predicts survival in human colon cancer patients. Genes Chromosomes Cancer 2008; 47: 794–802.

13.

Huang

Zhou

. Expression and clinical significance of EGFL7 in malignant glioma. J Cancer Res Clin Oncol 2010; 136: 1737–1743.

14.

Park

Lee

. High expression of epidermal growth factor-like domain 7 is correlated with poor differentiation and poor prognosis in patients with epithelial ovarian cancer. J Gynecol Oncol 2014; 25: 334–341.

15.

Philippin-Lauridant

Baranzelli

Samson

. Expression of Egfl7 correlates with low-grade invasive lesions in human breast cancer. Int J Oncol 2013; 42: 1367–1375.

16.

Yang

. Novel role for epidermal growth factor-like domain 7 in metastasis of human hepatocellular carcinoma. Hepatology 2009; 50: 1839–1850.

17.

Yang

Ling

Suppressive effect of microRNA-126 on oral squamous cell carcinoma in vitro. Mol Med Rep 2014; 10: 125–130.

18.

Luo

Shao

. Expression of epidermal growth factor-like domain 7 correlates with clinicopathological features of osteosarcoma. Am J Transl Res 2015; 7: 1236–1245.

19.

Massimiani

Vecchione

Piccirilli

. Epidermal growth factor-like domain 7 promotes migration and invasion of human trophoblast cells through activation of MAPK, PI3K and NOTCH signaling pathways. Mol Hum Reprod 2015; 21: 435–451.

20.

Shen

Han

Xue

. Epidermal growth factor-like domain 7 promotes cell invasion and angiogenesis in pancreatic carcinoma. Biomed Pharmacother 2016; 77: 167–175.

21.

Nichol

Shawber

Fitch

. Impaired angiogenesis and altered Notch signaling in mice overexpressing endothelial Egfl7. Blood 2010; 116: 6133–6143.

22.

Syro

Rotondo

Serna

. Pathology of GH-producing pituitary adenomas and GH cell hyperplasia of the pituitary. Pituitary 2017; 20: 84–92.

23.

Schmidt

Bicker

Nikolic

. Epidermal growth factor-like domain 7 (EGFL7) modulates Notch signalling and affects neural stem cell renewal. Nat Cell Biol 2009; 11: 873–880.

24.

Martins

Hayes

Kempe

LG.

Invasive pituitary adenomas. J Neurosurg 1965; 22: 268–276.

25.

Cottier

Destrieux

Brunereau

. Cavernous sinus invasion by pituitary adenoma: MR imaging. Radiology 2000; 215: 463–469.

26.

Dickerman

Oldfield

EH.

Basis of persistent and recurrent Cushing disease: an analysis of findings at repeated pituitary surgery. J Neurosurg 2002; 97: 1343–1349.

27.

Vieira

Jr Cukiert

Liberman

Evaluation of magnetic resonance imaging criteria for cavernous sinus invasion in patients with pituitary adenomas: logistic regression analysis and correlation with surgical findings. Surg Neurol 2006; 65: 130–135.

28.

Nishioka

Fukuhara

Horiguchi

. Aggressive transsphenoidal resection of tumors invading the cavernous sinus in patients with acromegaly: predictive factors, strategies, and outcomes. J Neurosurg 2014; 121: 505–510.

29.

Liu

. Smad3 and phospho-Smad3 are potential markers of invasive nonfunctioning pituitary adenomas. Onco Targets Ther 2016; 9: 2265–2271.

30.

Madsen

Borges

Knox

. Giant pituitary adenomas: pathologic-radiographic correlations and lack of role for p53 and MIB-1 labeling. Am J Surg Pathol 2011; 35: 1204–1213.

31.

Liu

. Assessment of sFRP4 as a bio-marker for predicting aggressiveness and recurrence of growth hormone-secreting pituitary adenomas. Oncol Rep 2016; 35: 2991–2999.

32.

Fitch

Campagnolo

Kuhnert

. Egfl7, a novel epidermal growth factor-domain gene expressed in endothelial cells. Dev Dyn 2004; 230: 316–324.

33.

Nichol

Stuhlmann

EGFL7: a unique angiogenic signaling factor in vascular development and disease. Blood 2012; 119: 1345–1352.

34.

Funahashi

Hernandez

Das

. A notch1 ectodomain construct inhibits endothelial notch signaling, tumor growth, and angiogenesis. Cancer Res 2008; 68: 4727–4735.

35.

Noguera-Troise

Daly

Papadopoulos

. Blockade of Dll4 inhibits tumour growth by promoting non-productive angiogenesis. Nature 2006; 444: 1032–1037.

36.

Ridgway

Zhang

. Inhibition of Dll4 signalling inhibits tumour growth by deregulating angiogenesis. Nature 2006; 444: 1083–1087.

37.

Scehnet

Jiang

Kumar

. Inhibition of Dll4-mediated signaling induces proliferation of immature vessels and results in poor tissue perfusion. Blood 2007; 109: 4753–4760.

38.

Liu

Turkoz

Jackson

. Notch1 loss of heterozygosity causes vascular tumors and lethal hemorrhage in mice. J Clin Invest 2011; 121: 800–808.

39.

Yan

Callahan

Beyer

. Chronic DLL4 blockade induces vascular neoplasms. Nature 2010; 463: E6–E7.