Sage Journals: Discover world-class research

Abstract

Pseudogenes were once considered to be genomic fossils without biological function. Interestingly, recent evidence showed that a lot of pseudogenes are transcribed in human cancers, and their alterations contribute to multiple cancer development and progression. It is apparent that many pseudogenes transcribe noncoding RNAs and contribute to the role noncoding genome plays in human cancers. On this basis, some pseudogene transcripts are currently ranked among the classes of long noncoding RNAs. In this study, we identified a new pseudogene-derived long noncoding RNA termed SFTA1P by analyzing the microarray data of non–small cell lung cancer from Gene Expression Omnibus datasets. We found that SFTA1P expression was significantly decreased in non–small cell lung cancer tissues compared with normal tissues in non–small cell lung cancer microarray data. Moreover, decreased SFTA1P expression is only correlated with lung adenocarcinoma patients’ poor survival time but not with lung squamous cell carcinoma patients’ survival. In addition, gain-of-function studies including growth curves, migration, invasion assays, and in vivo studies were performed to verify the tumor suppressor role of SFTA1P in non–small cell lung cancer. Finally, the potential underlying pathways involved in SFTA1P were investigated by analyzing the SFTA1P-correlated genes in The Cancer Genome Atlas lung adenocarcinoma and normal tissues RNA sequencing data. Taken together, these findings demonstrate that pseudogene-derived long noncoding RNA SFTA1P exerts the tumor suppressor functions in human lung adenocarcinoma. Our investigation reveals the novel roles of pseudogene in lung adenocarcinoma, which may serve as a new target for lung adenocarcinoma diagnosis and therapy.

Keywords

Pseudogene long noncoding RNA SFTA1P lung adenocarcinoma tumor suppressor

Introduction

Lung cancer is one of the leading causes of cancer-related death worldwide with a 5-year overall survival rate as low as 15%.¹ In spite of current advances in clinical and experimental oncology and molecular targeting therapy for lung cancer, the prognosis of lung cancer remains dissatisfying.^2,3 For lung cancer, non–small cell lung cancer (NSCLC) accounts for 80% of all lung cancer, and the major two types are lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC).⁴ Interestingly, LUAD and LUSC differ greatly in many aspects;⁵ hence, it is critical to explore the different molecular basis between LUAD and LUSC.

In the past decade, fast advance in bioinformatics and deep sequencing technique has led to the discovery that only less than 3% human genomes are protein coding genes, while the others are noncoding genes including microRNA (miRNA) genes, long noncoding RNA genes, and pseudogenes.^6,7 More importantly, ENCODE project and GENCODE annotation have revealed that these noncoding genome elements play essential roles in normal physiology as well as, when disorder, in human diseases.^8,9 As a major subject class of the noncoding family, pseudogenes have been considered as nonfunctional “junk genes” or “genomic fossil” for long time due to their harbor mutations that abrogate their transcription or translation.^10,11 Fortunately, the recent improvement of genome-wide platforms has revealed that many pseudogenes are transcriptionally active, and their disorder-transcribed RNAs contribute to several human diseases including cancer.^12–16 For example, Kalyana-Sundaram et al.¹⁷ developed a bioinformatics pipeline and identified 2082 pseudogene transcripts, among them, 218 expressed only in cancer samples and a breast cancer–specific pseudogene-ATP8A2-ψ was further validated. In addition, Han et al.¹⁸ detected 9925 pseudogene transcriptions in seven cancer types from The Cancer Genome Atlas (TCGA) RNA-seq data, and many pseudogene transcripts are tissue and/or cancer specific. Despite the abundance of pseudogenes identification in the human cancers, the pathophysiological roles of pseudogenes in LUAD remain poorly understood.

Recently, multilayered functions of pseudogene-derived lncRNAs have been reported in several cancers. The PTEN pseudogene, PTENP1, possesses a regulatory function of PTEN through acting as a decoy for PTEN-related miRNAs and competing for these miRNAs, while loss of PTENP1 released these miRNAs, which instead targeted PTEN and reduced its protein levels.^19,20 In this study, we identified a new pseudogene-derived lncRNA, termed SFTA1P, which is located in 10p14 and 693 nt in length. The expression pattern and biological function of SFTA1P in cancers are not reported until now, and we found that SFTA1P was significantly down-regulated in LUAD tissues and cells through analyzing the microarray data and RNA sequencing data from Gene Expression Omnibus (GEO) and TCGA. Furthermore, the relationship between SFTA1P and LUAD patients’ clinical features and survival was analyzed and gain-of-function assays were performed to investigate the roles of SFTA1P in LUAD tumorigenesis.

Materials and methods

Tissue specimens’ collection

We obtained 60 paired LUAD and adjacent non-tumor lung tissues from patients who underwent surgery at The Second Affiliated Hospital of Nanjing Medical University from 2011 to 2012. These patients were diagnosed with LUAD (stages I, II, and III) based on histopathological evaluation. The patients did not receive any local or systemic treatment before operation. The ethics committee of The Second Affiliated Hospital of Nanjing Medical University approved the study protocol.

Cell lines

Seven NSCLC cell lines (A549, H1975, SPC-A1, PC9, H1299, H1650, and SK-MES-1) and the normal bronchial epithelial cell line, HBE, were obtained from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). A549, H1650, H1975, and H1299 cells were cultured in Roswell Park Memorial Institute (RPMI)-1640, and HBE, SK-MES-1, PC9, and SPC-A1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco-BRL, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA), 100 U/mL penicillin sodium, and 100 mg/mL streptomycin sulfate at 37°C in a humidified air atmosphere containing 5% CO₂.

RNA extraction and quantitative polymerase chain reaction assays

Total RNA was extracted with TRIzol reagent from tissue samples or cells according to the manufacturer’s instructions. A total RNA of 1 µg was reverse transcribed in a final volume of 20 µL using random primers under standard conditions with the PrimeScript RT Reagent Kit (TaKaRa, Dalian, China). To analyze SFTA1P expression levels, we used SYBR Premix Ex Taq (TaKaRa), following the manufacturer’s instructions. Primer sequences for SFTA1P and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are as follows: SFTA1P F, 5′ CAGCATTCCAGGTGGGCTTT 3′, R, 5′ CCTTGTTTGGCTTACTCGTGC 3′; GAPDH F, 5′ GGGAGCCAAAAGGGTCAT 3′, R, 5′ GAGTCCTTCCACGATACCAA 3′. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was performed in triplicate on an ABI 7500, and data were calculated using the comparative cycle threshold (CT) (2^−ΔΔCT) method.

Cell transfection

The human SFTA1P complementary DNA (cDNA) sequence was, respectively, synthesized and subcloned into the pCDNA3.1 vector (GeneChem, Shanghai, China) to generate the pCDNA-SFTA1P vector and for ectopic expression in LUAD cells. Empty vector was used as a control. A549 and PC9 cells were transfected with pCDNA-SFTA1P vector or empty vector using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), and the cells were incubated for 48 h before use in assays.

Cell migration and invasion assays

Transwells (Corning, Tewksbury, MA, USA, 8.0-µm pores) were used to measure LUAD migration and invasion ability. For migration assays, 3 × 10⁴ cells were suspended in 300 µL of DMEM or RPMI-1640 containing 1% fetal bovine serum and transferred to the upper chamber. For the invasion assays, 1 × 10⁵ cells in 1% fetal bovine serum medium were placed into the upper chamber of an insert coated with Matrigel (Sigma–Aldrich, St Louis, MO, USA). Medium containing 10% fetal bovine serum (FBS) was added to the lower chamber. After incubation for 24 h, the cells that had migrated or invaded through the membrane were stained with methanol and 0.1% crystal violet, imaged, and counted using an IX71 inverted microscope (Olympus Corporation, Tokyo, Japan).

Protein analysis

After 48 h of transfection, cells were lysed using a lysis buffer which contained the mammalian protein extraction reagent RIPA (Beyotime, Beijing, China), a protease inhibitor cocktail (Roche, Basel, Switzerland), and phenylmethylsulfonyl fluoride (PMSF) (Roche). Cell protein lysates that contained 50-µg protein were electrophoresed on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto 0.22-mm nitrocellulose (NC) membranes (Sigma–Aldrich), and incubated with specific antibodies. Specific bands were detected by enhanced chemiluminescence (ECL) chromogenic substrate and quantified by densitometry (Quantity One software; Bio-Rad Laboratories, Hercules, CA, USA). GAPDH antibody was used as control; anti-EZH2, MMP2, and MMP9 (1:1000) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA).

In vivo metastasis assay

The 4-week female BALB/c nude mice were maintained under specific pathogen-free conditions and manipulated according to protocols approved by the Shanghai Medical Experimental Animal Care Commission. SPTA1P or empty vector stably transfected A549 cells were harvested. For metastasis assay, suspended cells were injected into the tail veins of mice, which were sacrificed 7–8 weeks after injection. The lungs were removed and photographed, and visible tumors on the lung surface were counted. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Committee on the Ethics of Animal Experiments of the Nanjing Medical University.

Statistical analysis

All statistical analyses were performed using SPSS 20.0 software (IBM). The significance of differences between groups was estimated by the Student’s t-test, Wilcoxon test, or chi-square test. Kendall’s Tau-b and Pearson correlation analysis were conducted to investigate the correlation between SFTA1P and other gene expressions. Two-sided p values were calculated, and a probability level of 0.05 was chosen for statistical significance.

Results

SFTA1P is down-regulated in LUAD tissues

To investigate the pseudogene-derived lncRNA alterations in NSCLC, we first analyzed the profiles of NSCLC patient (GSE18842) from GEO and found that SFTA1P was most down-regulated in NSCLC tissues compared with normal tissues (Figure 1(a)). Meanwhile, another two datasets (GSE30219 and GSE19188) were used to confirm the result in GSE18842, and the results showed that SFTA1P was also significantly down-regulated in both the datasets (Figure 1(b)). In addition, we analyzed the SFTA1P expression level in LUAD, LUSC, and normal tissues RNA sequencing data from TCGA, and also, we found that SFTA1P was also significantly down-regulated in both LUAD and LUSC tissues compared with normal tissues (Figure 1(c)). Interestingly, the survival analysis using TCGA data showed that decreased SFTA1P was only associated with LUAD patients’ shorter survival time but not with LUSC patients’ survival (Figure 2(a)). These findings indicate that decreased SFTA1P may involve in LUAD development and progression.

Figure 1.

SFTA1P expression is down-regulated in NSCLC tissues: (a) hierarchical clustering analysis of the lncRNAs and pseudogene-derived lncRNAs that were expressed differentially (GSE18842, fold change > 2; p < 0.05) between NSCLC samples and paired non-tumor samples, (b) SFTA1P expression was analyzed in GSE30219 and GSE19188 datasets from GEO, and (c) SFTA1P expression levels were analyzed in LUAD, LUSC, and normal tissues from TCGA RNA sequencing data.

Figure 2.

Decreased SFTA1P expression is associated with LUAD patients’ shorter survival: (a) the relationship between SFTA1P expression and LUAD or LUSC patients’ survival was analyzed using TCGA data, (b) SFTA1P expression was analyzed by qPCR in LUAD and normal tissues (n = 60), and (c) Kaplan–Meier survival analysis of OS and DFS in LUAD patients (p < 0.001 for both OS and DFS) based on SFTA1P expression.

Decreased SFTA1P is correlated with LUAD patients’ poor prognosis

To further determine whether SFTA1P was decreased in LUAD tissues, a total of 60 paired LUAD tissues were evaluated for SFTA1P expression using qRT-PCR. The results showed that SFTA1P was significantly down-regulated in 50/60 LUAD tissue samples (fold change > 2) (Figure 2(b)). To investigate the relationship between SFTA1P levels and LUAD patients’ clinicopathologic feature, the patients were divided into two groups: the high-SFTA1P group (n = 30, fold change ⩾ median) and the low-SFTA1P group (n = 30, fold change ⩽ median). Statistical analysis revealed that decreased SFTA1P expression is correlated with advanced pathological stage (p = 0.004) and lymph node metastasis (p = 0.035). However, SFTA1P expression was not associated with other factors including gender (p = 0.598) and age (p = 0.436) in LUAD (Table 1).

Table 1.

Correlation between SFTA1P expression and clinicopathological characteristics of LUAD patients (n = 60).

Characteristics	SFTA1P low no. case (%)	SFTA1P high no. case (%)	p value
Age (years)
>65	15 (25.0)	12 (20.0)	0.436
⩽65	15 (25.0)	18 (30.0)	0.436
Gender
Male	17 (28.3)	19 (31.7)	0.598
Female	13(21.7)	11(18.3)	0.598
TNM stage
I or II	17 (28.3)	27 (45.0)	0.004*
III	13 (21.7)	3 (5.0)	0.004*
Tumor size
⩽5 cm	15 (25.0)	19 (31.7)	0.297
>5 cm	15 (25.0)	11 (18.3)	0.297
Lymph node metastasis
Negative	8 (13.3)	16 (26.7)	0.035*
Positive	22 (36.7)	14 (23.3)	0.035*
Smoking history
Smokers	15 (25.0)	13 (21.7)	0.605
Never smokers	15 (25.0)	17 (28.3)	0.605

LUAD: lung adenocarcinoma; TNM: tumor node metastasis.

Overall p < 0.05.

Next, Kaplan–Meier survival analysis was performed to explore the relationship between SFTA1P expression and LUAD patient survival. The results showed that the overall and progression-free survival (PFS) rate over 3 years for the low-SFTA1P group is shorter than that in high-SFTA1P group (Figure 2(c)). Furthermore, univariate survival analysis showed that tumor size, lymph node metastasis, tumor nodes metastasis (TNM) stage, and SFTA1P expression level could be viewed as prognostic factors (Table 2). Other clinicopathological features including sex and age were not statistically significant prognostic factors. Moreover, multivariate Cox regression analyses showed that expression of SFTA1P (p = 0.019), along with lymph node metastasis (p = 0.001), was independent prognostic factor for LUAD patients (Table 2).

Table 2.

Univariate and multivariate analysis of over-survival in LUAD patients (n = 60).

Variables	Univariate analysis			Multivariate analysis
Variables	HR	95% CI	p value	HR	95% CI	p value
Age	1.776	0.842–3.749	0.132
Gender	0.892	0.415–1.915	0.769
Smoker	1.856	0.881–3.910	0.104
Chemotherapy	0.618	0.341–1.119	0.112
Tumor size	1.008	0.440–2.313	0.984
TNM stage (IIIa vs I or II)	2.745	1.242–6.064	0.013*	1.396	0.569–3.427	0.467
Lymph node metastasis (no vs yes)	5.278	1.935–14.397	0.001*	5.566	1.932–16.034	0.001*
SFTA1P expression (high vs low)	0.283	0.126–0.637	0.002*	0.316	0.120–0.830	0.019*

LUAD: lung adenocarcinoma; HR: hazard ratio; 95% CI: 95% confidence interval; TNM: tumor node metastasis.

Overall p < 0.05.

Effect of SFTA1P on LUAD cell proliferation

To investigate the biological function of SFTA1P in LUAD cells, we first evaluated the expression of SFTA1P in various LUAD cell lines using qRT-PCR. As shown in Figure 3(a), SFTA1P expression was down-regulated in all LUAD cell lines compared with HBE. Then, SFTA1P expression was up-regulated in A549 and PC9 cells by transfection with pCDNA-SFTA1P vector, and the results showed that SFTA1P expression was significantly increased in A549 and PC9 cells compared with control (Figure 3(b)). To assess the effect of SFTA1P on LUAD cells phenotype, we performed gain-of-function assays. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays showed that SFTA1P overexpression had no effect on the growth of A549 and PC9 cells compared with control cells (Figure 3(c)).

Figure 3.

The effect of SFTA1P on LUAD cells proliferation: (a) SFTA1P expression was analyzed by qPCR in LUAD, LUSC, and normal cell lines, (b) SFTA1P expression was analyzed by qPCR in A549 and PC9 cells transfected with pCDNA-SFTA1P or empty vector, and (c) MTT assays were performed to determine the cell viability for pCDNA-SFTA1P or empty vector–transfected A549 and PC9 cells.

SFTA1P inhibits LUAD cells’ migration and invasion in vitro

Cancer cells’ migration, invasion, and metastasis are significant aspects of LUAD progression, which may further result in poor prognosis and short survival for LUAD patients. Therefore, we investigated the effect of SFTA1P on LUAD cells’ migration and invasion by performing transwell assays. The results showed that SFTA1P overexpression impeded LUAD cells’ migration and invasion compared with controls (Figure 4). These results suggest that SFTA1P had tumor-suppressive function that could inhibit LUAD cells’ migration and invasion.

Figure 4.

SFTA1P overexpression inhibits LUAD cells migration and invasion: (a and b) transwell assays were used to investigate the changes in migratory abilities of SFTA1P overexpression cells and (c and d) transwell assays were used to investigate the changes in invasive abilities of SFTA1P overexpression cells.

SFTA1P suppresses LUAD cell metastasis in vivo

To investigate the effects of SFTA1P on the metastasis of LUAD cells in vivo, A549 cells stably transfected with pCDNA-SFTA1P were injected into nude mice. Metastatic nodules on the surface of lungs were counted after 8 weeks. The results showed that overexpression of SFTA1P led to a reduction in the number of metastatic nodules compared with those in the control group (Figure 5(a) and (b)). This difference was further confirmed following examination through hematoxylin and eosin (HE) staining of lung sections (Figure 5(c)). The in vivo findings complemented the results of functional in vitro studies involving SFTA1P.

Figure 5.

SFTA1P overexpression inhibits LUAD cells metastasis in vivo: (a) analysis of an experimental metastasis animal model was performed by injecting A549 cells stably transfected with pCDNA-SFTA1P into nude mice, (b) the numbers of tumor nodules on lung surfaces are shown, and (c) visualization of the entire lung and HE-stained lung sections.

Potential target genes of SFTA1P in LUAD

To explore the potential targets that are involved in SFTA1P tumor suppressor function in LUAD, we performed correlation analysis in TCGA LUAD tissues sequencing data. As shown in Figure 6(a) and (b), SFTA1P expression is positively related to tumor suppressor DLC, HOPX, and RHOBTB2 expression, while negatively related to oncogene EZH2, FOXM1, and PKL1 expression. These findings indicated that SFTA1P could function as tumor suppressor in LUAD cells might through regulating these important oncogenes or tumor suppressors expression. What is more, Western blot analysis was performed to confirm the expression level of potential target genes of SFTA1P. Compared with control cells, SFTA1P up-regulation significantly reduced EZH2 protein (Figure 6(c)). Besides, SFTA1P overexpression could also decrease the expression level of MMP2 and MMP9 (Figure 6(d)).

Figure 6.

Potential targets involved in SFTA1P tumor suppressor function: (a and b) the relationship between SFTA1P and DLC, HOPX, RHOBTB2, EZH2, FOXM1, or PKL1 was analyzed in LUAD tissues using TCGA data and (c and d) the expression level of EZH2, MMP2, and MMP9 protein using Western blot analysis.

Discussion

In the past decade, the function of noncoding elements in human genome has been highlighted due to the implementation of GENCODE project, coming along with lots of studies that have revealed the key roles of microRNAs and lncRNAs in almost all aspects of biology.^21–23 In addition, their alterations have been found to contribute to human disease, especially cancers.^24,25 Conversely, although some studies documented the pseudogenes’ participation in competing endogenous RNA (ceRNA) interactions and contribution of tumorigenesis, it is difficult to study pseudogenes on a large scale due to their high homology to parental genes that could not be distinguished easily. Recently, benefits from the development of bioinformatics pipeline and a handful of investigations have evidence indicating that thousands of pseudogenes are transcribed and highlighting the involvement of pseudogenes and their derived RNAs during pathogenesis of human diseases, such as cancer.^12,16,17 To date, a few intriguing reports have revealed the involvement of pseudogenes in human cancer development and regulation of target genes, by functioning as endogenous competitors for miRNA, RNA-binding protein (RBP), or translational machinery and generating endogenous small-interference RNA.^20,26,27

Karreth et al. found the in vivo proto-oncogenic function of murine B-Raf pseudogene through regulation of B-Raf by decoying miR-134, miR-543, and miR-653. Similarly, its human ortholog-BRAFP1 also elicits oncogenic activity as ceRNAs that elevate BRAF expression and mitogen-activated protein kinase (MAPK) activation.²⁸ Moreover, Wang et al. identified a novel tumor-suppressive pseudogene, termed AOC4P, whose expression was significantly down-regulated in hepatocellular carcinoma (HCC) samples. Decreased AOC4P expression is correlated with poor prognostic outcomes, and AOC4P overexpression significantly reduced cell proliferation, migration, and invasion through binding to vimentin protein and promote its degradation.²⁹ In this study, we also identified a new novel tumor-suppressive pseudogene named SFTA1P in LUAD, which was consistent with Zhao et al.’s³⁰ data. We found that SFTA1P expression is significantly down-regulated in NSCLC tissues, but its decreased expression only correlated with LUAD patients’ survival time. Furthermore, the level of SFTA1P is confirmed in a cohort of 60 paired LUAD and normal tissues, and relationship analysis showed that decreased SFTA1P expression is associated with LUAD patients’ poor prognosis and shorter survival time. Gain-of-function assays showed that SFTA1P overexpression could impair LUAD cells’ migration, invasion, and metastasis but had no effect on LUAD cells proliferation. Our findings indicate that SFTA1P may be an important regulator of LUAD metastasis and progression, which serves as a prognostic marker for LUAD patients.

Generally, pseudogenes involve in regulation of cancer cells phenotype mostly via affecting their parental genes expression. In this study, we explored SFTA1P potential underlying targets through analyzing its related genes in LUAD tissues. SFTA1P expression is negatively related to EZH2 and FOXM1 and positively related to HOPX in LUAD tissues. EZH2 and FOXM1 are important oncogenes that promote cancer cell migration and metastasis,^31,32 while HOPX exerts tumor-suppressive function through Ras-induced senescence in human lung cancer.³³ These findings suggested that SFTA1P might involve in LUAD cells invasion and metastasis via influencing those genes expression. In summary, we first identified a new tumor-suppressive pseudogene-derived lncRNA SFTA1P in LUAD which may be potential therapeutic targets. Although no pseudogenes have been well characterized in LUAD, the research of pseudogenes is expanding quickly. Therefore, integration of pseudogenes and their derived lncRNA into LUAD biology will deepen our understanding of the mechanisms of this deadly disease, and some specific pseudogenes may be translated into clinical applications for diagnosis, prognosis, or treatment of LUAD patients.

Footnotes

Acknowledgements

The authors apologize to all researchers whose relevant contributions were not cited due to space limitations. H.Z., Y.X., and R.X. contributed equally to this work and should be regarded as joint first authors.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This work was supported by National Natural Scientific Foundation of China grants 81602013 (to Fengqi Nie) and 81602003 (to Xuefei Shi).

References

Jemal

Bray

Center

. Global cancer statistics. CA Cancer J Clin 2011; 61(2): 69–90.

Siegel

Ward

Brawley

. Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin 2011; 61(4): 212–236.

Siegel

Naishadham

Jemal

Cancer statistics, 2013. CA Cancer J Clin 2013; 63(1): 11–30.

Ettinger

Akerley

Bepler

. Non-small cell lung cancer. J Natl Compr Canc Netw 2010; 8(7): 740–801.

Cooper

Lam

O’Toole

. Molecular biology of lung cancer. J Thorac Dis 2013; 5(Suppl. 5): S479–S490.

Pei

Sisu

Frankish

. The GENCODE pseudogene resource. Genome Biol 2012; 13(9): R51.

Harrow

Frankish

Gonzalez

. GENCODE: the reference human genome annotation for The ENCODE Project. Genome Res 2012; 22(9): 1760–1774.

Derrien

Johnson

Bussotti

. The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression. Genome Res 2012; 22(9): 1775–1789.

ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature 2012; 489(7414): 57–74.

10.

Proudfoot

Pseudogenes. Nature 1980; 286(5776): 840–841.

11.

Yang

Wang

XJ.

Pseudogenes: pseudo or real functional elements?

J Genet Genomics 2013; 40(4): 171–177.

12.

Pink

Wicks

Caley

. Pseudogenes: pseudo-functional or key regulators in health and disease? RNA 2011; 17(5): 792–798.

13.

Tay

Kats

Salmena

. Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Cell 2011; 147(2): 344–357.

14.

Goodhead

Darby

AC.

Taking the pseudo out of pseudogenes. Curr Opin Microbiol 2015; 23: 102–109.

15.

Kazazian

Jr.

Processed pseudogene insertions in somatic cells. Mob DNA 2014; 5: 20.

16.

Grander

Johnsson

Pseudogene-expressed RNAs: emerging roles in gene regulation and disease. Curr Top Microbiol Immunol 2016; 394: 111–126.

17.

Kalyana-Sundaram

Kumar-Sinha

Shankar

. Expressed pseudogenes in the transcriptional landscape of human cancers. Cell 2012; 149(7): 1622–1634.

18.

Han

Yuan

Zheng

. The Pan-Cancer analysis of pseudogene expression reveals biologically and clinically relevant tumour subtypes. Nat Commun 2014; 5: 3963.

19.

Johnsson

Ackley

Vidarsdottir

. A pseudogene long-noncoding-RNA network regulates PTEN transcription and translation in human cells. Nat Struct Mol Biol 2013; 20(4): 440–446.

20.

Yao

Gumireddy

. Pseudogene PTENP1 functions as a competing endogenous RNA to suppress clear-cell renal cell carcinoma progression. Mol Cancer Ther 2014; 13(12): 3086–3097.

21.

Bartel

DP.

MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116(2): 281–297.

22.

Mercer

Dinger

Mattick

JS.

Long non-coding RNAs: insights into functions. Nat Rev Genet 2009; 10(3): 155–159.

23.

Kosik

KS.

MicroRNAs and cellular phenotypy. Cell 2010; 143(1): 21–26.

24.

Ruan

Fang

Ouyang

MicroRNAs: novel regulators in the hallmarks of human cancer. Cancer Lett 2009; 285(2): 116–126.

25.

Nagano

Fraser

No-nonsense functions for long noncoding RNAs. Cell 2011; 145(2): 178–181.

26.

Guo

Deng

. Pseudogene PTENP1 suppresses gastric cancer progression by modulating PTEN. Anticancer Agents Med Chem 2016; 16: 456–464.

27.

Shi

Nie

Wang

. Pseudogene-expressed RNAs: a new frontier in cancers. Tumour Biol 2016; 37: 1471–1478.

28.

Karreth

Reschke

Ruocco

. The BRAF pseudogene functions as a competitive endogenous RNA and induces lymphoma in vivo. Cell 2015; 161(2): 319–332.

29.

Wang

Lin

Chen

. Long non-coding RNA AOC4P suppresses hepatocellular carcinoma metastasis by enhancing vimentin degradation and inhibiting epithelial-mesenchymal transition. Oncotarget 2015; 6(27): 23342–23357.

30.

Zhao

Luo

Jiao

Comprehensive characterization of cancer subtype associated long non-coding RNAs and their clinical implications. Sci Rep 2014; 4: 6591.

31.

Serresi

Gargiulo

Proost

. Polycomb repressive complex 2 is a barrier to KRAS-driven inflammation and epithelial-mesenchymal transition in non-small-cell lung cancer. Cancer Cell 2016; 29(1): 17–31.

32.

Wei

Zhang

Wang

. FOXM1 promotes lung adenocarcinoma invasion and metastasis by upregulating SNAIL. Int J Biol Sci 2015; 11(2): 186–198.

33.

Chen

Yang

Cui

. HOPX is methylated and exerts tumour-suppressive function through Ras-induced senescence in human lung cancer. J Pathol 2015; 235(3): 397–407.

The pseudogene-derived long noncoding RNA SFTA1P is down-regulated and suppresses cell migration and invasion in lung adenocarcinoma

Abstract

Keywords

Introduction

Materials and methods

Tissue specimens’ collection

Cell lines

RNA extraction and quantitative polymerase chain reaction assays

Cell transfection

Cell migration and invasion assays

Protein analysis

In vivo metastasis assay

Statistical analysis

Results

SFTA1P is down-regulated in LUAD tissues

Decreased SFTA1P is correlated with LUAD patients’ poor prognosis

Effect of SFTA1P on LUAD cell proliferation

SFTA1P inhibits LUAD cells’ migration and invasion in vitro

SFTA1P suppresses LUAD cell metastasis in vivo

Potential target genes of SFTA1P in LUAD

Discussion

Footnotes

Acknowledgements

Declaration of conflicting interests

Funding

References