Sage Journals: Discover world-class research

Abstract

Background

The prevalence of obesity is rising worldwide. Due to the side effects associated with modern drugs, there is a need for an alternative treatment for obesity management. Triphala (TP), a polyherbal formulation from Ayurveda, is used by Ayurvedic physicians for weight loss.

Purpose

This study was designed to evaluate the effects of TP on obesity at the biochemical, histological, and molecular levels.

Materials and Methods

Male Wistar rats (125–150 g, 6–7 weeks old) were fed with a high-fat diet (HFD) for total of 48 days. From day 24 to day 48, along with HFD, rats were given an aqueous extract of TP (50, 100, and 200 mg/kg/day) or atorvastatin (1.2 mg/kg/day). Biochemical parameters were estimated in serum. Histopathology was done for the liver and adipose tissue. Levels of the genes involved in lipid metabolism were determined by quantitative real-time polymerase chain reaction (qRT-PCR). Monoamine levels were estimated from the brain tissue.

Results

At the end of the study (day 48), compared to only HFD receiving group (DC), all TP-treated groups showed a significant decrease in body weight, serum glucose, total cholesterol, triglycerides, leptin, interleukin-6, C-reactive protein, malondialdehyde, and noradrenaline levels. High-density lipoprotein, adiponectin, superoxide dismutase, serotonin, and dopamine levels were found to be increased compared to DC rats. Expression of various genes involved in lipid metabolism was found to be down regulated only in TP 100 group compared with DC. Additionally, all TP groups showed a reduction in adipocyte size and restored monoamine levels.

Conclusion

The aqueous extract of TP had shown an anti-obesity effect as demonstrated by lowering inflammation and oxidative stress, adipocyte size, and modulation of expression of genes involved in lipid metabolism.

Keywords

Adipocyte brain monoamines inflammation lipogenesis oxidative stress

Introduction

Triphala (TP; Tri = three and phala = fruits) is a polyherbal formulation from Ayurveda, an Indian traditional medicinal system. It contains fruits of three plants, namely Terminalia chebula, Phyllanthus emblica, and Terminalia bellirica in equal proportion (Jantrapirom et al., 2021). It is commonly prescribed for disorders of the gastrointestinal system (Peterson et al., 2017). Its safety is proven not only through a long history of safe use but also in well-planned toxicity studies. Lately, various pharmacological activities of TP have been reported, such as anti-hyperlipidemic (Saravanan et al., 2007), anti-diabetic (Prativadibhayankaram et al., 2008), antioxidant (Peterson et al., 2017), anti-inflammatory (Jantrapirom et al., 2021), and immunomodulation (Belapurkar et al., 2014).

TP is extensively used by Ayurvedic physicians for weight reduction (Banjare & Bhalerao, 2016). Its anti-adipogenic activity through the modulation of expression of lipogenic genes in 3T3-L1 pre-adipocytes and differentiated mature adipocytes has been reported (Banjare et al., 2017). TP has exhibited a reduction in body weight, energy intake, and percentage of body fat in a model of high-fat diet (HFD)-induced obesity in mice (Gurjar et al., 2012; Phimarn et al., 2021). In a clinical study, TP has shown a promising effect on the reduction of weight, circumferential measurements, and body fat (Salunke et al., 2019). In another clinical study from Iran, the effect of TP on reducing body weight along with waist and hip circumference as compared to the placebo was shown (Kamali et al., 2012). However, in-depth studies on the mechanism of anti-obesity action of TP are missing.

Obesity is an outcome of complex interactions between biological, psychosocial, and environmental factors, though its exact pathophysiology is not completely understood. Its prevalence is increasing rapidly worldwide due to changed lifestyle (Forhan & Gill, 2013). On the other hand, several pharmacological drugs developed for obesity management have been withdrawn from the market due to their adverse effects (Onakpoya et al., 2016). Currently “Orlistat” is the only available anti-obesity drug (Bansal et al., 2020). However, it is associated with undesirable effects such as abdominal pain and diarrhea (Bansal et al., 2020; Ioannides-Demos et al., 2011). Hence, there is a need for an evidence-based alternative to the management of obesity. With this background, we aimed to study the anti-obesity effect of TP at biochemical and molecular levels.

Materials and Methods

Procurement of Study Drugs

Standardized and powdered aqueous extract of TP was procured from Pharmanza Herbal Pvt. Ltd. (Gujarat, India). TP had a 9% gallic acid content (by high performance liquid chromatography (HPLC)) and a 60% tannin content. It was stored in an airtight container at room temperature. Atorvastatin, an anti-hyperlipidemic drug used as a positive control (PC), was procured from the local pharmacy (Lipvas, Cipla Ltd.).

Ethical Statement

This study was initiated after obtaining approval from the Institutional Animal Ethics Committee (IAEC) of Bharati Vidyapeeth (Deemed to be University) Medical College, Pune, India (BVDUMC/3293/2016/007/002) and was carried out following “Committee for the Purpose of Control and Supervision of Experiments on Animals” (CPCSEA) guidelines.

Animals and Treatments

Thirty-six male albino Wistar rats (125–150 g, 5–6 weeks old) were procured and kept under standard laboratory conditions (temperature 22 ± 2°C, 12:12 h light and dark cycle, and 55 ± 5% humidity). After acclimatization, they were randomly divided into six groups (n = 6 per group). Of these six groups, group 1 served as normal control (NC) that received a normal chow diet, while other groups received HFD (35.80% fat) throughout the study duration. The composition of the normal chow diet and HFD is presented in Table 1.

Table 1.

Composition of Normal Chow and HFD (in Percentage).

Sl. No.	Parameters (%)	Normal Chow Diet	HFD
1	Moisture	7.05	5.10
2	Protein	21.00	18.00
3	Fat	3.08	35.08*
4	Fiber	4.02	2.90
5	Calcium	0.96	1.20
6	Phosphorus	0.67	0.50
7	Total ash	6.12	4.50

Note: *Three types of fats were used such as soybean oil + lard + laboratory reagent (LR) grade cholesterol.

Abbreviation: HFD, high-fat diet.

Experimental Design

The details of the study groups are provided in Table 2. Except first group (NC), all the groups received HFD for the entire duration of the study (i.e., 48 days). Group 2 received HFD but no other treatment, served as disease control (DC). Group 3 received atorvastatin (1.2 mg/kg/day), which was the PC group, while groups 4–6 received TP in three different doses, such as 50, 100, and 200 mg/kg/day. These doses were selected on the basis of earlier reported studies on herbal drugs in a similar model (Meriga et al., 2017; Singh & Mani, 2015). Atorvastatin and TP were administered using oral gavage needles.

Table 2.

Details of Study Groups.

Group No.	Experimental Group	Treatment
Group 1	NC group	Normal chow diet
Group 2	DC group (DC)	HFD
Group 3	PC group (PC)	HFD + atorvastatin [1.2 mg/kg body weight (b.w.)/day]
Group 4	TP 50 group (TP 50)	HFD + Triphala 50 mg/kg b.w./day
Group 5	TP 100 group (TP 100)	HFD + Triphala 100 mg/kg b.w./day
Group 6	TP 200 group (TP 200)	HFD + Triphala 200 mg/kg b.w./day

Abbreviations: NC, normal control; DC, disease control; PC, positive control; TP, Triphala; HFD, high-fat diet.

Blood was collected from these rats on day 0, 24, and 48 retro-orbitally after overnight fasting. On day 48, after sacrificing the rats, their liver, visceral adipose tissue, and brain were collected and stored appropriately till further use.

Biochemical Estimations from the Serum

From the serum separated from the collected blood, total cholesterol, triglycerides, high-density lipoprotein (HDL), and glucose were estimated using commercially available kits (Coral Clinical Systems, India). Leptin, adiponectin, interleukin-6 (IL-6), and C-reactive protein (CRP) were analyzed using enzyme-linked immunosorbent assay kits (ELISA kits, Cloud Clone, USA). For the estimation of oxidative stress in the liver, snap-frozen tissue was used. Lipid peroxidation as malondialdehyde (MDA) was measured in liver homogenates using the thiobarbituric acid reactive substances (TBARS) method (Melo et al., 2013). Superoxide dismutase (SOD) activity was assessed by McCord and Fridovich method in the liver homogenates (Wheeler et al., 1990).

Histological Examination of the Liver and Adipose Tissue

For histological examination, sections of the liver and visceral adipose tissue were immediately fixed in 10% neutral buffered formalin, and histological examination was carried out by hematoxylin and eosin staining. Additionally, in the case of adipose tissue, adipocytes diameter was measured using an EVOS inverted microscope (Thermo Fisher Scientific, USA). The method mentioned by Li et al. (2009) was followed with some modifications. Briefly, images from various fields of 5–7 µM thick sections of formalin-fixed adipose tissues from all the groups were taken using an EVOS inverted microscope at 40× magnification. Using ImageJ software, the diameters of adipocytes were manually measured from four different positions. The measured diameters were further used to calculate the mean diameter.

Gene Expression Study by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Transcription factors such as sterol regulatory element binding protein-1c (SREBP-1c) and peroxisome proliferator-activated receptor gamma (PPAR-γ) which regulate the expression of fatty acid metabolism genes, such as acetyl-CoA carboxylase (ACC), acyl-CoA synthetase short chain family member 2 (ACSS2), and fatty acid synthase (FASN) were selected for the study. Total RNA was extracted from the snap-frozen liver tissues using the TRIZOL method (Invitrogen, Carlsbad, CA, USA). The quality of RNA was assessed by agarose gel electrophoresis (Bio-Rad, Hercules, CA, USA). The quantification of RNA was done by ND-1000 UV spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). For qRT-PCR study, cDNA was synthesized from 2 µg of total RNA using the high-capacity reverse transcriptase kit (Invitrogen, USA). The qRT-PCR was performed with TB Green Premix SYBr green expression assays (TAKARA, Japan) in StepOne RT-PCR System (Applied Biosystems, USA). KicqStart^ۚ Primers were procured from Sigma-Aldrich (New York, USA) as per the sequence given in Table 3.

Table 3.

Primer Oligosequence.

Gene	Oligo Name	Sequence
SREBP-1c	Forward	AAACCTGAAGTGGTAGAAAC
	Reverse	TTATCCTCAAAGGCTGGG
PPAR-γ	Forward	AAGACAACAGACAAATCACC
	Reverse	CAGGGATATTTTTGGCATACTC
ACC	Forward	TCAAGTGGGGTGATATAGAG
	Reverse	ATGGTATCACTGTACACGAC
ACSS2	Forward	AGACCACCAAGATCACATAC
	Reverse	CTTCTGAACACCCTGTTTAC
FASN	Forward	ATTATAAGCTCCTTTGGCTG
	Reverse	CATCTGAGACATTCATTGGC

Abbreviations: SREBP-1c, sterol regulatory element binding protein-1c; PPAR-γ, peroxisome proliferator-activated receptor gamma; ACC, acetyl-CoA carboxylase; ACSS2, acyl-CoA synthetase short chain family member 2; FASN, fatty acid synthase.

In qRT-PCR study, the initial denaturation step was performed at 95°C for 10 min. This step was followed by 40 cycles of 95°C for 3 s (denaturation), 60°C for 30 s (annealing), and at 95°C for 15 s (extension). The final extension step was performed at 60°C for 0.15 s. The relative amounts of RNA were normalized with the housekeeping control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Monoamines Estimation from the Brain Tissue

As obesity is linked with alterations in neurotransmitter levels leading to obesity-associated neuropsychiatric complications, it was interesting to estimate the brain monoamines (neurotransmitters) (Labban et al., 2020). For the estimation of brain monoamines (dopamine, serotonin, and noradrenaline), the brain tissue was stored in 10% perchloric acid immediately after collection or after initial flash freezing at 2°C–8°C, and further processed using the HPLC method (Lakshmana & Raju, 1997).

Statistical Analysis

The data are presented as mean ± SD. Intra-group comparison was done using repeated measures analysis of variance (ANOVA) or paired t-test as applicable. Inter-group comparison of the parameters recorded on single time point was done using one-way ANOVA followed by post hoc test, while the parameters evaluated on more than two time points were analyzed using two-way ANOVA. The data were analyzed using GraphPad InStat (Version 3.5) and GraphPad Prism (Version 5.01).

Results

Effect of Triphala on the Body Weight

HFD is routinely used to induce obesity in the rats. Table 4 represents the body weight gain due to HFD treatment and effect of TP and standard drug (PC group) on the weight gain. On day 24, all the groups receiving HFD and a normal chow diet had significant weight gain. HFD receiving groups had significantly higher (p < 0.05) weight compared to NC. From day 24 to day 48, TP and standard drugs were administered along with HFD. From Table 4, it is clear that TP and PC groups resisted weight gain where weights for these groups were comparable to the weight of NC. In fact, TP 50 resisted the weight gain maximally. This group also showed a reduction in weight faster (from day 38 onwards) as compared to other treatment groups, where the weight of the rats was significantly lower (p < 0.01) as compared to DC. Other treatment groups showed significantly lower weight only on day 48.

Table 4.

Effect of Triphala on the Body Weight (Gram).

Groups	Day 0	Day 7	Day 14	Day 21	Day 24	Day 31	Day 38	Day 45	Day 48
NC	148.67 ± 6.44	196.67 ± 10.58	248.33 ± 20.07	261.5 ± 14.76	268.33 ± 12.74***	290.33 ± 14.64	308.83 ± 15.01	336 ± 21.40^@	344 ± 6.10^@
DC	156.5 ± 10.17	216.33 ± 18.61	236.83 ± 14.77	288 ± 25.39	309.5 ± 26.47***^#	322.33 ± 31.22	368.17 ± 46.09^$	384.17 ± 51.43^@	406.67 ± 50.99^@
PC	155.33 ± 3.68	202.33 ± 9.55	283.17 ± 18.99	308.00 ± 17.02	336.83 ± 17.10***^#	335.17 ± 40.77	351.50 ± 33.12	346.50 ± 29.94	340.50 ± 29.99
TP 50	148.13 ± 6.77	209.75 ± 20.74	250.38 ± 12.63	283.00 ± 13.78	302.13 ± 17.33***^#	299.25 ± 30.78	308.25 ± 35.43	313.50 ± 30.59	319.38 ± 35.62^%
TP 100	149.38 ± 4.72	210.75 ± 11.13	269.25 ± 13.78	301.13 ± 28.58	318.25 ± 27.35***^#	334.25 ± 30.35	344.38 ± 47.20	342.50 ± 50.29	341.25 ± 41.49
TP 200	161.00 ± 7.26	220.88 ± 13.98	271.13 ± 13.64	291.50 ± 10.55	314.50 ± 18.87***^#	329.38 ± 30.25	337.25 ± 37.69	345.75 ± 48.47	342.50 ± 41.05

Notes: NC group received normal chow diet while rats in all other groups were fed with HFD from day 0 to day 48. TP (TP 50, TP 100, and TP 200) and atorvastatin (PC) were administrated from day 24 to day 48. Effect of Triphala on the body weight was monitored at above-mentioned days in gram. Two-way ANOVA and Bonferroni post-tests were applied to determine statistically significant differences.

NC: Normal control; DC: Disease control; PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards); TP 50: group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards). ***p < 0.5 vs. day 0, ^#p < 0.05 vs. NC, ^$p < 0.01 vs. day 24, ^@p < 0.001 vs. day 24, and ^%p < 0.05 vs. day 48 DC.

Effect of Triphala on the Blood Glucose and Lipid Profiles

The effect of TP on glucose and lipid profiles after HFD treatment is presented in Table 5. Table 5 represents the effect of TP on the blood glucose. Blood sugar levels for all the groups were comparable at day 0. On day 24, blood sugar in the HFD-fed groups showed a significant rise as compared to NC. On day 48, the difference between NC and DC was significant. However, there was no statistically significant difference between NC and other groups indicating normalization of glucose levels after treatment. A significant difference was noted between PC or other treatment groups and DC. There was no significant difference noted among the different doses of TP. When the intra-group comparison was done, blood glucose levels in PC and TP 200 groups on day 48 reduced significantly as compared to day 24.

Table 5.

Effect of Triphala on Blood Glucose.

Groups	Day 0	Day 24	Day 48
NC	91.03 ± 9.42	90.45 ± 10.10	90.14 ± 10.63
DC	85.20 ± 10.44	127.69 ± 27.31***^@	177.78 ± 18.52***^@@@$
PC	90.96 ± 8.09	114.85 ± 17.07*^@	91.24 ± 11.64^###$
TP 50	93.10 ± 12.48	110.95 ± 17.93*	99.75 ± 8.94^###
TP 100	90.04 ± 7.74	114.82 ± 29.79**	94.94 ± 10.55^###
TP 200	92.82 ± 11.55	111.03 ± 25.22*^@	92.72 ± 12.21^###$

Notes: Rats were fed with HFD from day 0 to day 48. TP (TP 50, TP 100, and TP 200) and atorvastatin (PC) were administrated from day 24 to day 48. Blood glucose levels were determined at 0, 24, and 48 day from serum. Values are expressed as mean ± SD. The data were analyzed using two-way ANOVA test. *p < 0.05, **p < 0.01, ***p < 0.001 as compared to NC of same day, ^###p < 0.001 as compared to DC of same day. The data were analyzed using repeated measures ANOVA test. ^@p < 0.05, ^@@@p < 0.001 as compared to day 0, ^$p < 0.05 as compared to day 24. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards).

Abbreviations: NC, normal control; DC, disease control; PC, positive control; HFD, high-fat diet; TP, triphala; SD, standard deviation.

Table 6 represents the effect of TP on the blood lipid profile. Total cholesterol increased on day 24 in all HFD-fed groups. The increase was significant only in the DC, PC, and TP 200 groups as compared to NC. On day 48, no significant decrease was noted between NC and PC and TP 200. The DC group continued to be significantly different from NC. Like cholesterol, serum triglycerides were also found to be significantly increased in all the groups fed with HFD. On day 48, though all treatment groups (except DC) showed a reduction, only in TP 50 groups, the levels were normalized as evident from no significant difference with NC. HDL-cholesterol significantly decreased on day 24 in all HFD-fed groups. PC and TP treatment did not increase these levels except in TP 50, where the levels significantly increased as compared to DC. No significant difference was noted among the different doses of TP. In case of intra-group comparison, only TP 200 showed significant reduction in total cholesterol on day 48 as compared to day 24.

Table 6.

Effect of Triphala on Lipid Profile.

Groups	Day 0	Day 24	Day 48
Total cholesterol
NC	136.09 ± 15.55	154.78 ± 10.96	146.07 ± 20.66
DC	132.63 ± 17.19	215.61 ± 65.70*^@	232.46 ± 57.52***^@
PC	123.58 ± 9.03	227.30 ± 52.27**^@@@	191.66 ± 43.27^@
TP 50	141.69 ± 18.74	184.93 ± 74.65	143.46 ± 35.46^###
TP 100	145.09 ± 26.75	186.68 ± 62.72	141.07 ± 29.68^###
TP 200	137.57 ± 25.68	226.14 ± 44.82**^@@@	155.088 ± 30.28^##$$
Triglycerides
NC	79.42 ± 14.74	85.03 ± 10.25	89.65 ± 16.27
DC	106.91 ± 29.52	184.40 ± 56.87***^@@	226.23 ± 46.53***^@@
PC	87.51 ± 15.69	154.91 ± 44.99***^#@@	145.20 ± 34.33**^###@
TP 50	101.60 ± 25.80	151.62 ± 35.17***^#@	128.72 ± 15.06^###
TP 100	96.29 ± 18.51	177.91 ± 66.22***^@@	146.31 ± 33.86**^###
TP 200	100.50 ± 26.06	163.58 ± 30.19***^@@@	148.38 ± 20.52**^###@@
HDL-cholesterol
NC	70.70 ± 7.64	71.93 ± 6.12	71.69 ± 7.97
DC	73.85 ± 7.17	52.06 ± 7.37***^@@	47.74 ± 8.3***^@@@
PC	70.16 ± 10.57	50.55 ± 8.01***^@@	51.31 ± 5.75***^@@
TP 50	70.89 ± 8.55	56.43 ± 9.59**^@	59.60 ± 5.89*^#
TP 100	69.13 ± 4.44	57.75 ± 11.96**^@	57.60 ± 8.34**^@
TP 200	64.56 ± 3.84	51.72 ± 13.61***^@@	52.94 ± 9.21***^@@

Notes: Rats were fed with HFD from day 0 to day 48. TP (TP 50, TP 100, and TP 200) and atorvastatin (PC) were administrated from day 24 to day 48. Blood lipid profile was determined at 0, 24, and 48 day from serum. Values are expressed as mean ± SD. The data were analyzed using two-way ANOVA test. *p < 0.05, **p < 0.01, ***p < 0.001 as compared to NC of same day, ^#p < 0.05, ^##p < 0.01, ^###p < 0.001 as compared to DC of same day. The data were analyzed using repeated measures ANOVA test. ^@p < 0.05, ^@@p < 0.01, ^@@@p < 0.001 as compared to day 0. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w. (day 24 onwards).

Abbreviations: NC, normal control; DC, disease control; PC, positive control; HDL, high-density lipoprotein; HFD, high-fat diet; TP, triphala.

Effect of Triphala on the Adipokines Secretion

The effect of TP on adipokines secretion is represented in Table 7. HFD administration increased leptin levels, while it decreased adiponectin levels on day 24. After treatment with PC and different doses of TP, a decrease in leptin levels was observed on day 48. At this time point, leptin levels in the treatment groups were significantly lower than HFD group. There was no significant difference between NC and treatment groups indicating normalization of leptin levels after the treatment. In the case of adiponectin, all the treatment groups showed a significant increase as compared to DC.

Table 7.

Effect of Triphala on Leptin and Adiponectin Levels.

Groups	Leptin (pg/mL)		Adiponectin (pg/mL)
Groups	Day 24	Day 48	Day 24	Day 48
NC	6.20 ± 3.42	8.61 ± 2.2	113.86 ± 56.30	171.29 ± 38.12^$
DC	17.91 ± 6.18***	21.56 ± 2.75***	72.99 ± 17.54***	66.95 ± 14.77***
PC	18.12 ± 2.02***	10.17 ± 3.76^###$$$	82.02 ± 41.64***	108.91 ± 84.48^###
TP 50	15.54 ± 3.12***	12.4 ± 3.76^###	71.63 ± 57.36***	132.29 ± 61.93^###$$
TP 100	13.10 ± 3.70***^#	8.81 ± 2.68^###$	63.88 ± 14.85***	113.84 ± 27.43^###$
TP 200	17.67 ± 2.16***	13.54 ± 3.61*^###$	72.78 ± 33.69***	115 ± 29.68*^###$

Notes: Rats were fed with HFD from day 0 to day 48. TP (TP 50, TP 100, and TP 200) and atorvastatin (PC) were administrated from day 24 to day 48. Adipokines were determined at 24 and 48 day from serum. Values are expressed as mean ± SD. The data were analyzed using two-way ANOVA test. *p < 0.05, ***p < 0.001 as compared to NC of same day, ^#p < 0.05, ^###p < 0.001 as compared to DC of same day. The data were also analyzed using paired t-test. ^$p < 0.05, ^$$p < 0.01, ^$$$p < 0.001 as compared to day 24. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards).

Abbreviations: DC, disease control; NC, normal control; PC, positive control; HFD, high-fat diet; TP, Triphala ; SD, standard deviation.

When the intra-group comparison was done, all treatment groups showed significant decrease in the levels of leptin, except TP 50. On the other hand, all treatment groups improved the adiponectin levels. However, PC group could not demonstrate a statistically significant elevation in adiponectin level.

Effect of Triphala on Inflammation

The effect of TP on inflammatory markers was determined from the serum, and the data are presented in Table 8. IL-6, an inflammatory cytokine, showed a similar trend to that of Leptin. Further, the levels on day 48 were significantly less as compared to day 24 of the same group. CRP was also found to be significantly increased with the administration of HFD. All the treatment groups prevented this increase further. Though there was a significant decrease on day 48 as compared to the DC group, no difference was observed as compared to day 24 of the same group.

Table 8.

Effect of Triphala on Inflammation.

Groups	IL-6 (pg/mL)		CRP (µg/mL)
Groups	Day 24	Day 48	Day 24	Day 48
NC	27.18 ± 5.58	28.64 ± 6.16	316.67 ± 17.76	406.36 ± 18.54^$$$
DC	60.43 ± 2.84***	79.84 ± 4.50***^$$$	665.57 ± 122.55***	845.39 ± 93.48***^$$
PC	59.17 ± 5.25***	22.79 ± 2.21^###$$$	582.67 ± 102.25***	577.63 ± 66.94*^###
TP 50	61.01 ± 5.19***	22.77 ± 3.14^###$$$	616.11 ± 98.19***	586.01 ± 123.96**^###
TP 100	62.09 ± 4.91***	26.99 ± 10.16^###$$$	618.42 ± 168.04***	602.96 ± 117.98***^###
TP 200	65.15 ± 5.39***	21.34 ± 8.08*^###$$$	573.85 ± 110.89***	542.11 ± 77.49*^###

Notes: Rats were fed with HFD from day 0 to day 48. TP (TP 50, TP 100, and TP 200) and atorvastatin (PC) were administrated from day 24 to day 48. IL-6 and CRP were determined at day 24 and day 48 from serum. Values are expressed as mean ± SD. The data were analyzed using two-way ANOVA test. *p < 0.05, **p < 0.01, ***p < 0.001 as compared to NC of same day, ^###p < 0.001 as compared to DC of the same day. The data were also analyzed using paired t-test. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards).

Abbreviations: DC, disease control; NC, normal control; PC, positive control; HFD, high-fat diet; TP, triphala

Effect of Triphala on Histology of Liver and Adipose Tissue

Histological evaluation was performed on the formalin-fixed liver and adipose tissue, and the data are presented in Figure 1. In the case of liver, DC rats showed more number of lipid droplets and marked fatty changes as compared to NC rats. These fatty changes were less in the TP-treated groups.

Figure 1.

Notes: NC: Rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and Atorvastatin (1.2 mg/kg b.w./day (day 24 onwards).

The size of adipocytes was increased in DC rats compared to NC, while a decrease was observed in all TP-treated and PC rats (Table 9).

Table 9.

Effect of Triphala on Adipocyte Diameter.

Groups	Adipocyte Diameter (µm)
NC	57.92 ± 4.4
DC	118 ± 6.3***
PC	73.25 ± 1.8***^###
TP 50	74.92 ± 1.72***^###
TP 100	71.45 ± 0.91***^###
TP 200	64.45 ± 0.98**^###

Notes: Rats were fed with HFD from day 0 to day 48. TP (TP 50, TP 100, and TP 200) and atorvastatin (PC) were administrated from day 24 to day 48. Adipose tissues were harvested and fixed on day 48 followed by histological examination. Adipocyte size was determined. Values are expressed as mean ± SD. The data were analyzed by one-way ANOVA and Tukey’s multiple comparison test. **p < 0.01 and ***p < 0.001 as compared to NC, ^###p < 0.001 as compared to DC. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards).

Abbreviations: DC, disease control; NC, normal control; PC, positive control; HFD, high-fat diet; TP, triphala; SD, standard deviation.

Effect of Triphala on Liver Oxidative Stress

Liver oxidative stress was evaluated by estimating MDA content (Figure 2A) and SOD activity (Figure 2B). MDA levels were significantly higher in DC as compared to NC. After TP treatment, these levels were found to be lowered. This reduction was statistically significant in TP 100 and TP 200 groups. PC rats also showed a reduction in MDA levels.

Figure 2.

Notes: Values are expressed as mean ± SD. The data were analyzed by one-way ANOVA and Tukey’s multiple comparison test. ***p < 0.001 as compared to DC. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards).

SOD activity was lowered (p ≤ 0.001) in DC as compared to NC. All TP-treated groups showed significant (p ≤ 0.001) elevation in SOD activity as compared to the DC group. PC also demonstrated significant increase in SOD activity.

Effect of Triphala on Hepatic Gene Expression

The effect of TP on genes involved in lipid metabolism in the liver was determined by qRT-PCR, and the data are presented in Figure 3. In DC rats, PPAR-γ expression was upregulated by ∼5.26-fold, which was statistically significant (p ≤ 0.001) as compared to NC rats. All the studied doses of TP, such as 50, 100, and 200 mg/kg demonstrated its downregulation by ∼0.35-fold while atorvastatin (PC) downregulated the PPAR-γ expression by ∼0.25-fold (Figure 3A).

Figure 3.

Notes: Values are expressed as mean ± SD. The data were analyzed by one-way ANOVA and Tukey’s multiple comparison test. ^###p < 0.001 as compared to NC, **p < 0.01 and ***p < 0.001 as compared to DC. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards).

The expression of SREBP-1c gene was significantly (p ≤ 0.001) increased in DC rats by ∼10.19-fold as compared to NC rats. Only the TP 100-treated group showed decreased expression of SREBP-1c by ∼ 0.52-fold which was statistically significant (p ≤ 0.01). PC-treated rats also showed downregulation by ∼0.46-fold (Figure 3B).

DC group displayed upregulation of ACC gene by ∼2.62-fold as compared to NC group (Figure 3C). PC group showed downregulation of ACC gene by 0.86 fold. No such effect was observed in any of the TP-treated groups.

Expression of ACSS2 gene was elevated in DC rats by ∼1.7-fold compared to NC rats. A statistically nonsignificant downregulation of the gene expression was observed in PC, TP 100, and TP 200 groups (Figure 3D).

As compared to NC, DC showed increase in FASN gene expression by ∼1.83-fold (Figure 3E). Both PC and TP 100 significantly (p ≤ 0.01) decreased FASN by ∼0.55- and ∼0.65-fold, respectively.

Effect of Triphala on Brain Monoamines

Monoamine levels were measured in the brain tissue after TP treatment. The monoamine levels of Control and treatment groups are presented in Table 10. DC rats showed lower levels of serotonin and dopamine while higher levels of noradrenaline as compared to NC rats. All groups treated with TP demonstrated an increase in serotonin and dopamine along with a decrease in noradrenaline. PC rats also exhibited similar trend.

Table 10.

Effect of Triphala on Brain Monoamines (ng/gm of Tissue).

Groups	Serotonin	Dopamine	Noradrenaline
NC	0.4678 ± 0.0124	0.3833 ± 0.0249	1.0930 ± 0.0478
DC	0.2587 ± 0.0257	0.1607 ± 0.0288	1.7960 ± 0.1860
PC	0.4415 ± 0.0430	0.6769 ± 0.0328	0.7970 ± 0.0743
TP 50	0.5448 ± 0.0581	0.4408 ± 0.0295	1.1175 ± 0.0715
TP 100	0.6253 ± 0.0576	0.5599 ± 0.0104	1.3085 ± 0.0592
TP 200	0.6296 ± 0.0157	0.4491 ± 0.0168	1.2990 ± 0.0483

Notes: Rats were fed with HFD from day 0 to day 48. TP (TP 50, TP 100, and TP 200) and atorvastatin (PC) were administrated from day 24 to day 48. Brain tissues were harvested on day 48 followed by estimation of monoamines. Values are expressed as mean ± SD. NC: rat group receiving only chow diet; DC: rat group receiving HFD; TP 50: rat group receiving HFD and TP 50 mg/kg b.w./day (day 24 onwards); TP 100: rat group receiving HFD and TP 100 mg/kg b.w./day (day 24 onwards); TP 200: rat group receiving HFD and TP 200 mg/kg b.w./day (day 24 onwards); and PC: rat group receiving HFD and atorvastatin 1.2 mg/kg b.w./day (day 24 onwards).

Abbreviations: DC, disease control; NC, normal control; PC, positive control; HFD, high-fat diet; TP, triphala; SD. standard deviation.

Discussion

This study was carried out to investigate the anti-obesity effects of TP at biochemical and molecular levels in rat model of HFD-induced obesity. We observed that TP treatment decreased body weight, serum glucose, total cholesterol, triglycerides, leptin, IL-6, CRP, MDA, and noradrenaline levels along with a reduction in adipocyte diameter. Further, it increased serum HDL-cholesterol, adiponectin, SOD, serotonin, and dopamine levels. The alterations in the above-mentioned parameters were further confirmed by studying effect of TP on gene expression associated with lipogenesis.

We also assessed the effect of TP on adipokines such as leptin and adiponectin. Leptin controls the food intake and energy expenditure (Chrysafi et al., 2020; Klok et al., 2007), which in turn is associated with body fat mass (Klein et al., 1996). It is also a pro-inflammatory adipokine. TP treatment decreased the elevated levels of leptin. This decrease has further contributed to the reduction in weight. Adiponectin, another adipokine, plays an important role in the regulation of carbohydrate and fat metabolism (Díez & Iglesias, 2003). Lowered adiponectin levels are associated with an increase in insulin resistance and diabetes (Díez & Iglesias, 2003; Ozenoglu et al., 2008). The treatment with TP has increased adiponectin levels indicating improved insulin sensitivity, which is also reflected in the reduction of glucose levels. TP, thus corrected the adipose (tissue) dysfunction observed in obesity. The key feature of adipose dysfunction is hypertrophy of adipocytes (inflammatory phenotypes) that brings out abnormal secretion of adipokines. Interestingly, in TP-treated groups, adipocyte size was found to be decreased along with the correction of adipokine levels.

Adipose tissue secretes inflammatory mediator IL-6, which plays a key role in triglyceride release, lipoprotein lipase inhibition, and insulin sensitivity in obesity (Gani et al., 2009; Kojta et al., 2020). The increase in inflammation and insulin resistance leads to the increase in the secretion of CRP, an acute-phase protein, in the liver (Tanaka et al., 2011). The CRP levels are positively associated with adipose tissue mass (Faber et al., 2010). Maithili-Karpagaselvi et al. (2016) have reported that the HFD-fed rats showed increased body weight with concomitant increase in liver and adipose tissue weight. The increased weight of the organs basically due to excess fat accumulation caused infiltration of macrophages, which in turn resulted in the increased levels of TNF-α, CRP, monocyte chemoattractant protein-1 (MCP-1), leptin, and IL-6 and there by promoted low-grade inflammation (Maithili-Karpagaselvi et al., 2016). TP effectively reduced these inflammatory markers.

Lipid accumulation in the liver is a characteristic feature in the development of nonalcoholic fatty liver disease concomitantly associated with obesity (Pettinelli & Videla, 2011). This is also associated with upregulation of lipogenic genes such as SREBP-1c and PPAR-γ (Devarshi et al., 2013; Mandave et al., 2017). SREBP is a transcription factor that plays crucial role in lipid metabolism (Horton et al., 2002; Khadke et al., 2020). SREBP-1c expression is relatively higher in the liver and its over-expression is associated with an increase in the triglycerides level (Shiman et al., 1997). It is also involved in the regulation of different lipogenic genes such as ACC, ACSS2, and FASN which are found to be upregulated in obesity (Luong et al., 2000; Shimomura et al., 1999). In this study, fatty changes were observed in the liver after administration of HFD along with upregulation of SREBP and PPAR-γ. The expression of ACC, FASN, and ACSS2 was also found upregulated after HFD administration. These changes resulted in increased serum cholesterol and triglyceride levels in HFD-fed rats. All TP-treated groups downregulated the expression of lipogenic genes leading to an improvement in the lipid profile and also a reduction in the fatty infiltration in liver. In obesity along with lipid abnormalities, oxidative stress is routinely detected (Hasty et al., 2007). The reactive oxygen species react with polyunsaturated fatty acids and lead to increased lipid peroxidation through increased MDA levels. These fatty acids are important structural and functional components of the cells (Memişoğullari & Bakan, 2004). Ansari et al. (2012) studied the effect of pitavastatin and rosuvastatin on the obesity-induced oxidative stress. The possible mechanisms behind development of oxidative stress in obesity includes an increase in the blood glucose, lipid abnormalities, impaired antioxidant defenses, and hyperleptinemia (Vincent et al., 2007). We observed significant increase in MDA levels of the liver after HFD administration, which was normalized by TP treatment. TP improved the antioxidant mechanism as evidenced by improvement in the SOD activity.

Neurotransmitters play an important role in the obesity pathology. Serotonin controls feeding behavior through the stimulus to eat. Leptin-mediated regulation of appetite and energy expenditure takes place by inhibiting serotonin synthesis and release in the brainstem neurons (Oury & Karsenty, 2011). Dopamine plays a key role in hyperphagia. Noradrenaline is also involved in the stimulation of hunger and satiety as well as thermogenesis (Johnston, 1987). Brain imaging studies on rats and humans implicate the involvement of dopamine in eating behaviors, therefore new strategies are in line for targeting improvement in the dopamine function for the prevention and treatment of obesity (Bello & Hajnal, 2010). We observed decreased levels of serotonin and dopamine in HFD-fed rats, while the levels of noradrenaline were found elevated. TP reversed these changes. The improved levels of neurotransmitters must have resulted in normalization of hunger and thereby reduction in weight.

Conclusion

This study thus provides convincing evidence about anti-obesity effect of TP at biochemical and molecular levels. Since we did not observe any dose-dependent effects of TP, further studies with wider dose range are warranted. However, the findings of our study can be used for possible future applications of TP as an anti-obesity medicine.

Footnotes

Abbreviations

ACC: Acetyl-CoA carboxylase; ACSS2: Acyl-CoA synthetase short chain family member 2; CRP: C-reactive protein; DC: Disease control; FASN: Fatty acid synthase; HFD: High-fat diet; IL-6: Interleukin-6; MDA: Malondialdehyde; NC: Normal control; PC: Positive control; PPAR-γ: Peroxisome proliferator-activated receptor gamma; qRT-PCR: Quantitative real-time polymerase chain reaction; SOD: Superoxide dismutase; SREBP-1c: Sterol regulatory element binding protein-1c; TP 100: HFD + Triphala 100 mg/kg b.w./day; TP 200: HFD + Triphala 200 mg/kg b.w./day; TP 50: HFD + Triphala 50 mg/kg b.w./day; TP: Triphala.; TBARS: Thiobarbituric acid reactive substances; HPLC: High performance liquid chromatography; ANOVA: Analysis of variance; LR: Laboratory reagent; MCP-1: Monocyte chemoattractant protein-1.

Acknowledgments

The authors are thankful to M/s Pharmanza Herbal Ltd. for providing the aqueous extract of Triphala. We also thank Dr. Megha Salunke and Jyotibala Banjare for their help in data collection.

Author’s Contribution Statements

SB: Concept, design, definition of intellectual content, statistical analysis, manuscript editing and review.

AJ: Data interpretation, manuscript drafting and review.

SK: Gene expression studies and analysis.

AS: Study design and monitoring, tissue-based experiments, manuscript review.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors acknowledge Central Council for Research in Ayurvedic Sciences (CCRAS), Ministry of Ayush, Government of India for the financial support.

ORCID iD

Supriya Sudhakar Bhalerao

References

Ansari

J. A.

, Bhandari

, Haque

S. E.

, & Pillai

K. K.

(2012). Enhancement of antioxidant defense mechanism by pitavastatin and rosuvastatin on obesity-induced oxidative stress in Wistar rats. Toxicology Mechanisms and Methods , 22(1), 67–73. https://doi.org/10.3109/15376516.2011.603391

Banjare

, Raina

, Mansara

, Ghanekar

R. K.

, & Bhalerao

(2017). Triphala, regulates adipogenesis through modulation of expression of adipogenic genes in 3T3-L1 cell line. Pharmacognosy Magazine , 13(Suppl S4), S834–S839. https://doi.org/10.4103/pm.pm_153_17

Banjare

J. B.

, & Bhalerao

(2016). A survey of marketed ayurvedic/herbal anti-obesity products. International Journal of Pharmacy and Pharmaceutical Sciences , 8, 384–386.

Bansal

, Bhandari

, & Ahmad

(2020). Embelin from Embelia ribes ameliorates oxidative stress and inflammation in high-fat diet-fed obese C57BL/6 mice. Pharmacognosy Magazine , 16(5), S443–S449. https://doi.org/10.4103/pm.pm_77_20

Belapurkar

, Goyal

, & Tiwari-Barua

(2014). Immunomodulatory effects of Triphala and its individual constituents: A review. Indian Journal of Pharmaceutical Sciences , 76(6), 467–475.

Bello

N. T.

, & Hajnal

(2010). Dopamine and binge eating behaviors. Pharmacology, Biochemistry, and Behavior , 97(1), 25–33. https://doi.org/10.1016/j.pbb.2010.04.016

Chrysafi

, Perakakis

, Farr

O. M.

, Stefanakis

, Peradze

, Sala-Vila

, & Mantzoros

C. S.

(2020). Leptin alters energy intake and fat mass but not energy expenditure in lean subjects. Nature Communications , 11(1), 5145. https://doi.org/10.1038/s41467-020-18885-9

Devarshi

P. P.

, Jangale

N. M.

, Ghule

A. E.

, Bodhankar

S. L.

, & Harsulkar

A. M.

(2013). Beneficial effects of flaxseed oil and fish oil diet are through modulation of different hepatic genes involved in lipid metabolism in streptozotocin-nicotinamide induced diabetic rats. Genes & Nutrition , 8(3), 329–342. https://doi.org/10.1007/s12263-012-0326-2

Díez

J. J.

, & Iglesias

(2003). The role of the novel adipocyte-derived hormone adiponectin in human disease. European Journal of Endocrinology , 148(3), 293–300. https://doi.org/10.1530/eje.0.1480293

10.

Faber

D. R.

, van der Graaf

, Westerink

, & Visseren

F. L.

(2010). Increased visceral adipose tissue mass is associated with increased C-reactive protein in patients with manifest vascular diseases. Atherosclerosis , 212(1), 274–280. https://doi.org/10.1016/j.atherosclerosis.2010.04.029

11.

Forhan

, & Gill

S. V.

(2013). Obesity, functional mobility and quality of life. Best Practice & Research. Clinical Endocrinology & Metabolism , 27(2), 129–137. https://doi.org/10.1016/j.beem.2013.01.003

12.

Gani

D. K.

, Lakshmi

, Krishnan

, & Emmadi

(2009). Evaluation of C-reactive protein and interleukin-6 in the peripheral blood of patients with chronic periodontitis. Journal of Indian Society of Periodontology , 13(2), 69–74. https://doi.org/10.4103/0972-124X.55840

13.

Gurjar

, Pal

, & Kapur

(2012). Triphala and its constituents ameliorate visceral adiposity from a high-fat diet in mice with diet-induced obesity. Alternative Therapies in Health and Medicine , 18(6), 38–45.

14.

Hasty

A. H.

, Gruen

M. L.

, Terry

E. S.

, Surmi

B. K.

, Atkinson

R. D.

, Gao

, & Morrow

J. D.

(2007). Effects of vitamin E on oxidative stress and atherosclerosis in an obese hyperlipidemic mouse model. The Journal of Nutritional Biochemistry , 18(2), 127–133. https://doi.org/10.1016/j.jnutbio.2006.03.012

15.

Horton

J. D.

, Goldstein

J. L.

, & Brown

M. S.

(2002). SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. The Journal of Clinical Investigation , 109(9), 1125–1131. https://doi.org/10.1172/JCI15593

16.

Ioannides-Demos

L. L.

, Piccenna

, & McNeil

J. J.

(2011). Pharmacotherapies for obesity: Past, current, and future therapies. Journal of Obesity , 2011, 179674. https://doi.org/10.1155/2011/179674

17.

Jantrapirom

, Hirunsatitpron

, Potikanond

, Nimlamool

, & Hanprasertpong

(2021). Pharmacological benefits of Triphala: A perspective for allergic rhinitis. Frontiers in Pharmacology , 12, 628198. https://doi.org/10.3389/fphar.2021.628198

18.

Johnston

J. L.

(1987). A role for norepinephrine metabolism in energy balance and obesity: A review. Canadian Institute of Food Science and Technology Journal , 20(5), 331–335.

19.

Kamali

S. H.

, Khalaj

A. R.

, Hasani-Ranjbar

, Esfehani

M. M.

, Kamalinejad

, Soheil

, & Kamali

S. A.

(2012). Efficacy of ‘Itrifal Saghir’, a combination of three medicinal plants in the treatment of obesity; A randomized controlled trial. Daru: Journal of Faculty of Pharmacy, Tehran University of Medical Sciences , 20(1), 33. https://doi.org/10.1186/2008-2231-20-33

20.

Khadke

, Mandave

, Kuvalekar

, Pandit

, Karandikar

, & Mantri

(2020). Synergistic effect of omega-3 fatty acids and oral-hypoglycemic drug on lipid normalization through modulation of hepatic gene expression in high fat diet with low streptozotocin-induced diabetic rats. Nutrients , 12(12), 3652. https://doi.org/10.3390/nu12123652

21.

Klein

, Coppack

S. W.

, Mohamed-Ali

, & Landt

(1996). Adipose tissue leptin production and plasma leptin kinetics in humans. Diabetes , 45(7), 984–987. https://doi.org/10.2337/diab.45.7.984

22.

Klok

M. D.

, Jakobsdottir

, & Drent

M. L.

(2007). The role of leptin and ghrelin in the regulation of food intake and body weight in humans: A review. Obesity Reviews: An Official Journal of the International Association for the Study of Obesity , 8(1), 21–34. https://doi.org/10.1111/j.1467-789X.2006.00270.x

23.

Kojta

, Chacińska

, & Błachnio-Zabielska

(2020). Obesity, bioactive lipids, and adipose tissue inflammation in insulin resistance. Nutrients , 12(5), 1305. DOI: 10.3390/nu12051305

24.

Labban

R. S. M.

, Alfawaz

, Almnaizel

A. T.

, Hassan

W. M.

, Bhat

R. S.

, Moubayed

N. M.

, Bjørklund

, & El-Ansary

(2020). High-fat diet-induced obesity and impairment of brain neurotransmitter pool. Translational Neuroscience , 11(1), 147–160. https://doi.org/10.1515/tnsci-2020-0099

25.

Lakshmana

M. K.

, & Raju

T. R.

(1997). An isocratic assay for norepinephrine, dopamine, and 5-hydroxytryptamine using their native fluorescence by high-performance liquid chromatography with fluorescence detection in discrete brain areas of rat. Analytical Biochemistry , 246(2), 166–170. https://doi.org/10.1006/abio.1996.9997

26.

, Xie

, Qin

, Jeha

G. S.

, Saha

P. K.

, Yan

, Haueter

C. M.

, Chan

, Tsai

S. Y.

, & Tsai

M. J.

(2009). The nuclear orphan receptor COUP-TFII plays an essential role in adipogenesis, glucose homeostasis, and energy metabolism. Cell Metabolism , 9(1), 77–87. https://doi.org/10.1016/j.cmet.2008.12.002

27.

Luong

, Hannah

V. C.

, Brown

M. S.

, & Goldstein

J. L.

(2000). Molecular characterization of human acetyl-CoA synthetase, an enzyme regulated by sterol regulatory element-binding proteins. The Journal of Biological Chemistry , 275(34), 26458–26466. https://doi.org/10.1074/jbc.M004160200

28.

Maithili-Karpagaselvi

, Sridhar

M. G.

, Swaminathan

R. P.

, & Sripradha

(2016). Preventive effect of curcumin on inflammation, oxidative stress and insulin resistance in high-fat fed obese rats. Journal of Complementary & Integrative Medicine , 13(2), 137–143. https://doi.org/10.1515/jcim-2015-0070

29.

Mandave

, Khadke

, Karandikar

, Pandit

, Ranjekar

, Kuvalekar

, & Mantri

(2017). Antidiabetic, lipid normalizing, and nephroprotective actions of the strawberry: A potent supplementary fruit. International Journal of Molecular Sciences , 18(1), 124. https://doi.org/10.3390/ijms18010124

30.

Melo

J. U.

, Melo

R. B.

, Santos

J. M.

, Campos Júnior

M. M.

, Guimarães

S. B.

, & Vasconcelos

P. R.

(2013). Effects of bioflavonoid ternatin on liver regeneration and oxidative stress in rats. Acta Cirurgica Brasileira , 28(6), 435–440. https://doi.org/10.1590/s0102-86502013000600006

31.

Memişoğullari

, & Bakan

(2004). Levels of ceruloplasmin, transferrin, and lipid peroxidation in the serum of patients with type 2 diabetes mellitus. Journal of Diabetes and its Complications , 18(4), 193–197. https://doi.org/10.1016/S1056-8727(03)00032-1

32.

Meriga

, Parim

, Chunduri

V. R.

, Naik

R. R.

, Nemani

, Suresh

, Ganapathy

, & Sathibabu Uddandrao

V. V.

(2017). Antiobesity potential of piperonal: Promising modulation of body composition, lipid profiles and obesogenic marker expression in HFD-induced obese rats. Nutrition & Metabolism , 14, 72. https://doi.org/10.1186/s12986-017-0228-9

33.

Onakpoya

I. J.

, Heneghan

C. J.

, & Aronson

J. K.

(2016). Post-marketing withdrawal of anti-obesity medicinal products because of adverse drug reactions: A systematic review. BMC Medicine , 14(1), 191. https://doi.org/10.1186/s12916-016-0735-y

34.

Oury

, & Karsenty

(2011). Towards a serotonin-dependent leptin roadmap in the brain. Trends in Endocrinology and Metabolism: TEM , 22(9), 382–387. https://doi.org/10.1016/j.tem.2011.04.006

35.

Ozenoglu

, Balci

, Ugurlu

, Caglar

, Uzun

, Sarkis

, Gunay

, & Engin Eker

(2008). The relationships of leptin, adiponectin levels and paraoxonase activity with metabolic and cardiovascular risk factors in females treated with psychiatric drugs. Clinics (Sao Paulo, Brazil) , 63(5), 651–660. https://doi.org/10.1590/s1807-59322008000500014

36.

Peterson

C. T.

, Denniston

, & Chopra

(2017). Therapeutic uses of Triphala in ayurvedic medicine. Journal of Alternative and Complementary Medicine (New York N.Y.) , 23(8), 607–614. https://doi.org/10.1089/acm.2017.0083

37.

Pettinelli

, & Videla

L. A.

(2011). Up-regulation of PPAR-gamma mRNA expression in the liver of obese patients: An additional reinforcing lipogenic mechanism to SREBP-1c induction. The Journal of Clinical Endocrinology and Metabolism , 96(5), 1424–1430. https://doi.org/10.1210/jc.2010-2129

38.

Phimarn

, Sungthong

, & Itabe

(2021). Effects of Triphala on lipid and glucose profiles and anthropometric parameters: A systematic review. Journal of Evidence-based Integrative Medicine , 26, 2515690X211011038. https://doi.org/10.1177/2515690X211011038

39.

Prativadibhayankaram

V. S.

, Malhotra

, Pandhi

, & Singh

(2008). Anti-diabetic activity of Triphala fruit extracts, individually and in combination, in a rat model of insulin resistance. Natural Product Communications , 3(2), 1934578X0800300230. https://doi.org/10.1177/1934578X0800300230

40.

Salunke

, Banjare

, & Bhalerao

(2019). Effect of selected herbal formulations on anthropometry and body composition in overweight and obese individuals: A randomized, double blind, placebo-controlled study. Journal of Herbal Medicine , 17, 100298. https://doi.org/10.1016/j.hermed.2019.100298

41.

Saravanan

, Srikumar

, Manikandan

, Parthasarathy

N. J.

, & Devi

R. S.

(2007). Hypolipidemic effect of Triphala in experimentally induced hypercholesteremic rats. Yakugaku zasshi: Journal of the Pharmaceutical Society of Japan , 127(2), 385–388. https://doi.org/10.1248/yakushi.127.385

42.

Shiman

, Horton

J. D.

, Shimomura

, Hammer

R.E

, Brown

M. S.

, & Goldstein

J. L.

(1997). Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. The Journal of Clinical Investigation , 99(5), 846–854. https://doi.org/10.1172/JCI119248

43.

Shimomura

, Bashmakov

, & Horton

J. D.

(1999). Increased levels of nuclear SREBP-1c associated with fatty livers in two mouse models of diabetes mellitus. The Journal of Biological Chemistry , 274(42), 30028–30032. https://doi.org/10.1074/jbc.274.42.30028

44.

Singh

D. P.

, & Mani

(2015). Protective effect of Triphala Rasayana against paracetamol-induced hepato-renal toxicity in mice. Journal of Ayurveda and Integrative Medicine , 6(3), 181–186. https://doi.org/10.4103/0975-9476.146553

45.

Tanaka

, Narazaki

, & Kishimoto

(2011). Anti-interleukin-6 receptor antibody, tocilizumab, for the treatment of autoimmune diseases. FEBS Letters , 585(23), 3699–3709. https://doi.org/10.1016/j.febslet.2011.03.023.

46.

Vincent

H. K.

, Innes

K. E.

, & Vincent

K. R.

(2007). Oxidative stress and potential interventions to reduce oxidative stress in overweight and obesity. Diabetes, Obesity & Metabolism , 9(6), 813–839. https://doi.org/10.1111/j.1463-1326.2007.00692.x

47.

Wheeler

C. R.

, Salzman

J. A.

, Elsayed

N. M.

, Omaye

S. T.

, & Korte

D. W.

Jr. (1990). Automated assays for superoxide dismutase, catalase, glutathione peroxidase, and glutathione reductase activity. Analytical Biochemistry , 184(2), 193–199. https://doi.org/10.1016/0003-2697(90)90668-y

Anti-obesity Effects of Triphala at Biochemical and Molecular Level in High-Fat Diet-induced Obese Rats

Abstract

Background

Purpose

Materials and Methods

Results

Conclusion

Keywords

Introduction

Materials and Methods

Procurement of Study Drugs

Ethical Statement

Animals and Treatments

Composition of Normal Chow and HFD (in Percentage).

Experimental Design

Details of Study Groups.

Biochemical Estimations from the Serum

Histological Examination of the Liver and Adipose Tissue

Gene Expression Study by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Primer Oligosequence.

Monoamines Estimation from the Brain Tissue

Statistical Analysis

Results

Effect of Triphala on the Body Weight

Effect of Triphala on the Body Weight (Gram).

Effect of Triphala on the Blood Glucose and Lipid Profiles

Effect of Triphala on Blood Glucose.

Effect of Triphala on Lipid Profile.

Effect of Triphala on the Adipokines Secretion

Effect of Triphala on Leptin and Adiponectin Levels.

Effect of Triphala on Inflammation

Effect of Triphala on Inflammation.

Effect of Triphala on Histology of Liver and Adipose Tissue

Effect of Triphala on Adipocyte Diameter.

Effect of Triphala on Liver Oxidative Stress

Effect of Triphala on Hepatic Gene Expression

Effect of Triphala on Brain Monoamines

Effect of Triphala on Brain Monoamines (ng/gm of Tissue).

Discussion

Conclusion

Footnotes

Abbreviations

Acknowledgments

Author’s Contribution Statements

Declaration of Conflicting Interests

Funding

ORCID iD

References