Ameliorative Potential of Betanin on Cigarette Smoke Extract-induced Respiratory Mucosal Inflammation and Oxidative Stress in the Adult Zebrafish Model

Abstract

Background

Betanin, a natural pigment and glycosidic bioactive compound, possesses anti-inflammatory antioxidant activity.

Objectives

In this study, we evaluated the potential effect of betanin on cigarette smoke extract (CSE)-induced pulmonary inflammation in the zebrafish model.

Materials and Methods

Zebrafish were randomly divided into five groups with control, CSE-exposed and betanin-treated after CSE exposure for 3 and 6 days. Oxidative stress-related parameters like reactive oxygen species (ROS), nitric oxide (NO) and myeloperoxidase (MPO) were analysed, histopathological studies were carried out and gene expression of proinflammatory tumour necrosis factor-alpha, inducible NO synthase and anti-inflammatory interleukin-10 cytokines was determined.

Results

Treatment with betanin reduced ROS, MPO and NO with histopathological improvement, alleviating CSE-induced pulmonary inflammation. Further, decreased expression of the proinflammatory gene and increased expression of the anti-inflammatory gene were observed after 6 days of treatment.

Conclusion

Betanin exhibits a protective effect against CSE exposure by inhibiting oxidative stress and inflammation.

Keywords

Betanin Pulmonary inflammation Zebrafish Gill toxicity Oxidative stress Cigarette smoke extract Gene studies

Introduction

Chronic obstructive pulmonary disease (COPD) is the third leading cause of death worldwide,^1–2 with characteristics of emphysema persistent airflow limitation and impairment of lung function. Cigarette smoking is considered to be the main risk factor for COPD; cigarettes have toxic ingredients that induce inflammation in the respiratory tract.³ Chronic exposure to cigarette smoke extract (CSE) leads to lung inflammation with infiltration of neutrophil, macrophage, and dendritic cells, which destroys lung tissue and promote remodeling.⁴ CSE induces synthesis of reactive oxygen species (ROS), resulting in an imbalance of the oxidant and antioxidant system, which is the main mechanism involved in the onset of COPD. It also promotes proinflammatory cytokines such as tumour necrosis factor-alpha (TNF-α), interleukin-1 (IL-1), interleukin-6 (IL-6), interleukin-8 (IL-8) and granulocyte-macrophage colony-stimulating factor.⁵ No treatments are available that can prevent the progressive course of COPD and lung fibrosis. As it includes a cascade of inflammatory events induced by oxidative stress by affecting the activity of enzymes and metabolic pathways, natural compounds can be effective due to their antioxidant activity.

Betanin (betanidin 5-O-b-glucoside), found commonly in beetroot (Beta vulgaris L.), is called betacyanin pigment and shows free radical scavenger activity and induces antioxidant defence mechanisms.⁶ It possesses anti-inflammatory, anticancer anti-lipoperoxidation and heme integration activity.⁷ Recent research proved the capacity of betanin to suppress NF-κB DNA-binding activity and COX-2 activity with similar or greater effect than anti-inflammatory drugs and some phenolic compounds.⁸ However, no study was carried out to study its protective effect on pulmonary inflammation induced by CSE.

The gills of zebrafish exhibit the same gas-exchange function and have the same architecture of mammalian airways, with a mucus-covered respiratory epithelium scattered with immune cells and smooth muscle cells at the base of the lamella.⁹ Thus, pulmonary inflammation was induced in the zebrafish model to study the efficacy of betanin for treating lung inflammatory stimuli as observed in COPD cases. The current treatment strategy controls bronchitis, but does not reverse the pathological damage. Hence, there is a great demand for pharmacological agents derived from plants. The current study will enlighten anti-inflammatory and anti-oxidative properties of betanin towards the CSE-induced COPD model.

Materials and Methods

Study Area

This study was carried out at the Public Health Department, School of Health Sciences, Building B, Saudi Electronic University, Jeddah City Sary Road, Faisaliyah Dist, Saudi Arabia from June 2021 to May 2022.

Animal Acclimatation

Adult zebrafishes were purchased from a local vendor. Before the start of the experiment, the animals were acclimatised to the laboratory condition as per organisation for economic co-operation and development (OECD) guidelines (203). According to the guideline, the static system of water is monitored for the optimum temperature, pH, salinity and dissolved oxygen levels on daily basis. The temperature and pH were maintained as 27°C ± 2 and 6.8–7.4 pH, respectively. The zebrafish were fed with commercially available fish pellets from pet shops twice a day. Both male and female zebrafishes were reared on a 12 h L/12 h D cycle. Adult zebrafishes that were healthy and devoid of any malformations or infections were chosen for the study. Fishes were grouped and separated into various tanks for toxicity assessments.

LC₅₀ Determination of CSE

Zebrafishes of interest were weighed and separated into various tanks for the toxicity study. The cigarette smoke was extracted with the help of a manually designed prototype/apparatus. The number of cigarettes was kept as a dosage for acute toxicity assessment. The dosage given was 0.2, 0.4, 0.6, 0.8 and 1.0 cigarettes per litre. Control fishes were also maintained in a separate tank. The toxicity analysis was performed for up to 7 days. The mortality and abnormal behaviour were noted.

LC₅₀ Determination for Betanin

The drug, betanin, was also checked for its toxicity towards the zebrafish. Gavage administration of betanin was carried out for the toxicity assessment. For this, 2 mg/kg, 4 mg/kg, 8 mg/kg and 16 mg/kg range were given as gavage feed. Then, the dose was reduced to 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0 mg/kg. The acute toxicity study was carried out for up to 7 days.

Experimental Model

The zebrafishes with weights similar to both male and female fishes were chosen for the experiment. The fishes were separated into five groups containing 10 fishes each. The process is duplicated for accurate output.

Group 1: Control fishes/untreated.

Group 2: Pulmonary inflammation induction by CSE (0.3 cigarette/litre).

Group 3: CSE induction with 0.25 mg/kg of betanin treatment.

Group 4: CSE induction with 0.50 mg/kg of betanin treatment.

Group 5: CSE induction with 0.75 mg/kg of betanin treatment.

Based on the toxicity study of CSE, 0.3 cigarette per litre concentration was given for the induction of pulmonary inflammation in the zebrafish for 7 days. After the induction period, treatment of betanin was initiated and an oral dose was given once daily for every fish based on the weight. The treatment was given for 7 days. The fishes were fed with commercial feed throughout the study. The fishes were assayed for its biological functions on day 3 and day 6. The fishes were euthanised on day 3 for its oxidative stress enzyme analysis and day 6 for analysis of the level of oxidative stress enzymes, gene expression and morphology of gill tissues through histopathology.

Estimation of Nitric Oxide

The amount of nitric oxide (NO) present in the gill tissues on day 3 and day 6 of treated, untreated and induced groups of zebrafish was estimated by the method given in ref¹⁰, with slight modification. 100 µl of 100 µM nitrite solution was added to the 96-well plate for the nitrite standard reference curve. 50 µl of the appropriate matrix or buffer was dispensed into the remaining wells. By serial dilution, the following concentrations of 100, 50, 25, 12.5, 6.25, 3.13 and 1.56 µM were obtained. The supernatant of ground gill tissue of untreated, induced and treated groups was added. To the wells, 50 µl of the 1% sulphanilamide in 5% phosphoric acid was added and incubated for 5 min at room temperature (RT) in dark. Then, 50 µl of the 0.1% NED Solution was added and incubated at RT for 5–10 min and protected from light. The absorbance was measured at 520 nm. The values were recorded, and the standard graph was plotted.

ROS Estimation

The reduction process of nitroblue tetrazolium (NBT) assay was performed for tissues taken for day 3 and day 6 to estimate the percentage release of ROS, based on the method given in ref¹¹, with slight changes. The gill tissue from untreated, treated and induced was ground. The tissue homogenate was washed with PBS twice, and 100 µl of 0.1% NBT solution was added and incubated for 1 h in dark. Then, NBT was removed and washed with 70% methanol for three times. Then, to the washed pellet, 120 µl of 2M potassium hydroxide (KOH) and 120 µl of DMSO were added. The absorbance was recorded at 630 nm with KOH or DMSO as blank.

MPO Activity Assay

MPO assay was carried out using the method given in ref¹², with slight modification. Gill tissues of zebrafish from various groups were collected and weighed on day 3 and day 6. Based on the tissue weight, the ice-cold 50 mM potassium phosphate buffer (pH 6.0) containing 0.5% cetyltrimethylammonium bromide (CTAB) was added, and the tissue was homogenised. The homogenised tissue was centrifuged at 5000 rpm for 5 min, and the supernatant was collected. 7 µl of tissue homogenate was mixed with 200 µl of O-dianisidine and diluted H₂O₂ mixture. The sample was measured at 450 nm at 30-second intervals up to 90 s spectrophotometrically. The absorbance was recorded, and MPO activity was expressed as MPO activity (U/mg of tissue).

Gene Expression Analysis

Gill tissues from various groups of fishes were excised on day 6 for the assessment of impairment and rehabilitation of tissue morphology at the molecular level. DNA was extracted from the gill tissues as described in ref¹³, with slight modification. Briefly, the gill tissue was collected and homogenised with digestion buffer, followed by immersion of the tissue in 1.5 ml of digestion buffer with proteinase K at 55°C overnight for lysis. Organic extraction was performed with the phenol: chloroform: isoamylalcohol mixture. The content was centrifuged, and to the aqueous phase, 2X volume of 100% ethanol was added and kept for overnight precipitation. Then, the precipitate was washed and the pellet was air-dried. DNA was diluted with TE buffer and subjected to PCR. Oxidative stress, inflammation and anti-inflammatory genes such as inducible nitric oxide synthase (iNOS), TNF-α and IL-10 respectively were analysed for the level of expression. The primers were designed with the NCBI Primer-BLAST tool. The sequences are given in Table 1.

Table 1.

Primer Sequence.

S. No	Genes	Primer Sequence
1	iNOS	Forward: 5’ACACTTCGAAAAGCAAGATGG 3’ Reverse: 5’ ACGGGCATCGAAAAGCTGTA 3’
2	TNF-α	Forward: 5’ TCATTTTGGCTGTGGGCCTT 3’ Reverse: 5’ GGCGGTTCAAAATCTCACTCAC 3’
3	IL-10	Forward: 5’ ACCAGCAGTTATTCGCACTCA 3’ Reverse: 5’ TCAATCCAAAACACTTACGCATT 3’

Abbreviations: iNOS, inducible nitric oxide synthase; TNF-α, tumour necrosis factor-alpha, IL-10, interleukin 10.

The PCR mixture was prepared with Emerald master mix, template and forward and reverse primers. The PCR was performed based on optimised PCR conditions for 34 cycles. The PCR products were subjected to qualitative analysis using 1% agarose gel electrophoresis. The gel image was photographed.

Histopathology Analysis

Gill tissues of control, induced and treated groups were taken for the histopathological analysis to study its morphometric alterations and damage. The tissues were stored in 10% formalin, and the tissues were embedded in paraffin wax. Then, the tissue sectioning was subjected to staining with Haemotoxylin and Eosin stains and photographed under a phase contrast microscope (Optica).

Data Analysis

All the experiments were duplicated, and the data were subjected to statistical analysis using GraphPad Prism software, version 5.1. The data are expressed as mean ± SD. The results were analysed with two-way analysis of variance, and the treatments were analysed by Tukey’s multiple comparison test. p < 0.05 was considered as significant.

Results

Acute Toxicity Assessment of CSE

Lethal Concentration to kill half of the population (LC₅₀) was studied for CSE between 0.2 and 1.0 cigarette/litre. Figure 1 shows the survival percentage of zebrafishes in CSE. It is evident that there was 100% survival at 0.2 and 0.4 cigarette/litre, whereas at 0.6, 0.8 and 1.0 cigarette/litre, the percentage was decreased in a dose-dependent manner. LC₅₀ was fixed as 0.6 and showed 54.16% mortality, which is indicated as the dotted line. The dose of CSE was fixed as 0.3 cigarette/litre for the induction of pulmonary inflammation based on the result of acute toxicity determination that showed 100% survival at 0.3 cigarette/litre up to 7 days. The result is presented as mean ± SD and error.

Figure 1.

Abbreviation: CSE, cigarette smoke extract.

Lethal Concentration Determination for Betanin

The toxicity analysis was performed for betanin. Initially, the dose was taken as 2, 4, 8 and 16 mg/kg for the study. The 100% mortality was observed for 8 and 16 mg/kg within 24 h. Data were not shown. Then, the dose was reduced to 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0 mg/kg. Figure 2 shows the acute toxicity analysis of betanin. Betanin showed 100% survival up to 1.5 mg/kg. The mortality rate slightly increased at 2.0 mg/kg, whereas at 2.5 and 3.0 mg/kg, there was a moderate increase in the mortality rate. The LC₅₀ value was fixed as 3.0 mg/kg, which showed 50% mortality on day 6, as indicated by the dotted lines. The betanin dose for treatment is fixed as 0.25, 0.50 and 0.75 mg/kg based on the acute toxicity analysis. The result is presented as mean ± SD and error.

Figure 2.

Lethal Concentration Determination for Betanin. LC₅₀ Determination of Betanin was Plotted against the Days of Treatment based on the Different Oral Dosage Range of Betanin. The Survival Percentage was Shown Up to 7 Days. The Results were Represented as Mean ± SD and Error.

NO Estimation

The synthesis of NO level was determined on day 3 and day 6, which is shown in Figure 3. An elevated level of NO was observed in an induced group such as 39.9 ± 0.16 for day 3 and 39 ± 0.01 for day 6 compared to the control. The treatment of pulmonary inflammation was given with betanin at 0.25, 0.5 and 0.75 mg/kg. The figure shows the slight reduction in the NO level in a dose-dependent manner on day 3. In day 6, the moderate reduction of NO was observed when compared to day 3 in a dose-dependent manner. The alleviation of NO was significant in high doses of betanin, and there was no significance between the treatment periods, that is, day 3 and day 6.

Figure 3.

Note: #significance between untreated and induced group, *significance between induced and treated groups, a, non-significant.

ROS Determination

The percentage of ROS was estimated. Figure 4 represents the percentage of ROS levels in induced, control and treated groups. From the figure, it is clearly indicated that the CSE induction escalates the percentage of ROS compared to the control as 49.53 and 50.64 for day 3 and day 6, respectively. Betanin treatment showed a significant reduction in the percentage of ROS in a dose-dependent manner. There was an appropriate reduction was observed in day 3 and day 6 compared to the induced group. 0.75 mg/kg dosage showed a high impact in the reduction of ROS percentage as 12.97 and 8.35 for day 3 and day 6, respectively.

Figure 4.

Note: *significance between induced and treated groups.

Myeloperoxidase Enzyme Estimation

Myeloperoxidase (MPO) activity was determined to know the oxidative stress responses in inflammatory diseases, and the impact of the treatment on MPO activity is shown in Figure 5. The MPO activity of the induced group was significantly high, 1.99 and 1.85 U/mg on day 3 and day 6, respectively, compared to the control group. Betanin treatment provides dosage dependent attenuation in the MPO activity, 1.65, 1.32 and 0.88 U/mg of tissue was observed for day 3 and 1.50, 1.15 and 0.61 U/mg of tissue was observed for day 6 for 0.25, 0.50 and 0.75 mg/Kg of betanin respectively.

Figure 5.

Note: #significance between untreated and induced group, *significance between induced and treated groups, a, non-significant.

Gene Expression Analysis

The molecular level of analysis was carried out for untreated, induced and treated groups. The inflammatory genes TNF-α and iNOS showed upregulation in the induced group, and the expression was reduced based on the betanin dose range in treated groups (Figure 6A and 6B). The anti-inflammatory gene IL-10 showed downregulation in the induced group, whereas in treated groups, the level of gene expression increased in a dose-dependent manner (Figure 6C).

Figure 6.

Note: Lane 1, control; lane 2, induced with CSE; lane 3, CSE + treated with betanin 0.25 mg/kg; lane 4, CSE + treated with betanin 0.50 mg/kg and lane 5, CSE + treated with betanin 0.75 mg/kg.

Histopathological Examination

Figure 7 shows the histopathological analysis of gill tissues from control, induced and treated groups of day 6. The control group showed normal architecture with proper gill filament, primary and secondary lamella. The induced group indicates the massive disintegration of tissue with lamellar fusion, hyperemia and abrasion of tissue cells. After treatment, the damaged tissue architecture was significantly restored in a dose-dependent manner.

Figure 7.

Abbreviation: CSE, cigarette smoke extract.

Discussion

Cigarette smoking contributes to the imbalance of oxidant/antioxidant due to exogenous ROS and results in the inflammatory process and mitochondrial dysfunction due to endogenously released ROS, providing the path for disease progression. Betanin are red pigments found in beetroot (B. vulgaris), amaranths, rose and cactus pear. It contains phenolic and cyclic amine groups, which are good electron donors with exceptionally high free radical scavenging ability. Several studies have shown that betanin possesses antioxidant and anti-inflammatory activity. In this study, pulmonary inflammation was established in the zebrafish model in order to investigate the effect of betanin on cigarette smoking-induced COPD.

With the purpose of establishing the model of CSE-induced COPD, the zebrafish was exposed to CS extract. LC₅₀ dosage was kept constant and fixed for establishing the lung inflammation model. 0.3 cig/L dosage was given to induce pulmonary inflammation for up to 7 days. Similarly, drug toxicity was also determined up to 16 mg/kg and the dosage of 0.25, 0.50 and 0.75 mg/kg was fixed for the study.

Our investigation of CSE resulted in increased oxidative stress via increasing ROS, NO and MPO, which was associated with increased levels of TNF-α and iNOS and decreased levels of IL-10 gene expression in gill tissue. Betanin was able to reduce ROS levels in a time-dependent manner and dose-dependent manner, which was highly significant on the 6^th day (0.25, 0.50 and 0.75 mg/kg). When the delicate balance between ROS and antioxidant production surpasses the limit after exposing to CSE, it induces oxidative stress resulting in cell injury. The MPO level is also increased with ROS, which is the main enzyme involved in phagocytes to produce ROS, leading to macrophage activation along with increase in NO production.^{14, 15} Thus, the CSE-exposed group showed a significant increase in ROS, MPO, and NO, which decreased with treatment based on dosage and time duration. As flavonoids are antioxidants, they can scavenge free radicals and no longer react with NO and result in less damage.^{16, 17} Our finding coincides with pre-treatment of quercetin, which reduced ROS and NO to baseline levels due to the high rate of diffusion through cell membranes and on the surfaces of lipid bilayers and also in the aqueous phase.¹⁸

Betanin could enhance IL-10 production, an anti-inflammatory compound, by combined inhibition of TNF-α and iNOS in gill tissue. The expression of cytokine TNF-α plays an important role in driving the expression of iNOS in inflammatory conditions.¹⁹ In the present study, a consistent increase in TNF-α has been observed, which in turn increases IkB-α degradation, leading to NF-κB activation and transcription of several inflammatory genes, including iNOS, which produces a large amount of NO,²⁰ which is consistent with a possible role of this cytokine.^21–23 Many flavonoid shaves proved inhibition effect on TNF-α and iNOS,^{24, 25} in inflammatory condition. Catechin and quercetin showed similar results with a concomitant increase of IL-10 expression with a decrease in TNF-α.²⁶

We found damages in gill lamella and filaments after exposure of zebrafish to CSE for 6 days. It also showed neutrophil infiltration in the CSE-exposed group. Gills absorb toxic substances dissolved in the aquatic environment due to direct water and gaseous exchange.^{27, 28} After treatment with betanin, lamellae and filament damage reduced in a dose-dependent manner with restoration of the morphological architecture of gills. A decrease in neutrophil infiltration was also observed, indicating the potency of betanin against pulmonary inflammation.

Conclusion

In conclusion, our study confirms that CSE exposure enhances the release of ROS, MPO and NO in the gill tissue of the adult zebrafish model. Betanin acted on oxidative stress by elevating anti-inflammatory cytokines and reducing proinflammatory cytokines in pulmonary inflammation induced by CSE. Extensive studies are needed to explore the mechanisms involved in inhibition of pulmonary inflammation by betanin to substitute as potential herbal medicine. Though the effect has been studied and confirmed in zebrafish model, it is very important to duplicate a similar effect in animal and human trials to elaborate the mechanism of action.

Summary

Cigarette smoking is considered to be the main risk factor of COPD caused by toxic ingredients which induces inflammation in respiratory tract. This study mainly focused on the potential effect of betanin on CSE induced pulmonary inflammation in zebrafish model.

Betanin showed significant reduction in oxidative stress conditions induced by CSE that was confirmed by NO, ROS and MPO assays.

Further, the rehabilitation of gill tissues by betanin treatment was confirmed with histopathological analysis.

Down regulation of proinflammatory gene (TNF-α), NO synthase gene (iNOS) and up regulation of anti-inflammatory gene (IL-0) confirms the anti-inflammatory and antioxidant potency of betanin at molecular level.

Footnotes

Abbreviations

CSE: Cigarette smoke extract; ROS: Reactive oxygen species; NO: Nitric oxide; MPO: Myeloperoxidase; TNF-α: Tumour Necrosis Factor-alpha; iNOS: Inducible nitric oxide synthase; IL-10: Interleukin 10; COPD: Chronic obstructive pulmonary disease; GM-CSF: Granulocyte macrophage colony-stimulating factor; IL-6: Interleukin 6; IL-1: Interleukin 1; NF-kB: Nuclear factor-kappa B; COX-2: Cyclooxygenase; OECD: Organisation for economic co-operation and development; NED-N: (1-Naphthyl)ethylenediamine dihydrochloride; NBT: Nitroblue tetrazolium; KOH: Potassium hydroxide; DMSO: Dimethyl sulfoxide; PBS: Phosphate buffered saline; CTAB: Cetyl trimethyl ammonium bromide; NCBI: National center for biotechnology information; BLAST: Basic local alignment search tool.

Declaration of Conflicting Interests

The author declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author received no financial support for the research, authorship and/or publication of this article.

Statement of Informed Consent and Ethical Approval

Necessary ethical clearances and informed consent was received and obtained respectively before initiating the study from all participants.

References

Pauwels

, Buist

, & Calverley

PMA

, . Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO Global Initiative for Chronic Obstructive Lung Disease (GOLD) Workshop summary. Am J Respir Crit Care Med 2001; 163(5): 1256–76. DOI: 10.1164/AJRCCM.163.5.2101039, PMID 11316667.

, Yin

, & Zhang

, . Prevalence of physician-diagnosed COPD and its association with smoking among urban and rural residents in regional mainland China. Chest 2005; 128(4): 2818–23. DOI: 10.1378/chest.128.4.2818, PMID 16236960.

Strzelak

, Ratajczak

, & Adamiec

, . Tobacco smoke induces and alters immune responses in the lung triggering inflammation, allergy, asthma and other lung diseases: A mechanistic review. Int J Environ Res Public Health 2018; 15(5). DOI: 10.3390/ijerph15051033, PMID 29883409.

, Yu

, & Yuan

, . Cigarette smoke-induced pulmonary inflammation and autophagy are attenuated in Ephx2-deficient mice. Inflammation 2017; 40(2): 497–510. DOI: 10.1007/s10753-016-0495-z, PMID 28028752.

Laniado-Laborín

Smoking and chronic obstructive pulmonary disease (COPD). Parallel epidemics of the 21 century. Int J Environ Res Public Health 2009; 6(1): 209–24. DOI: 10.3390/ijerph6010209, PMID 19440278.

Gliszczyńska-Świgło

, Szymusiak

, & Malinowska

. Betanin, The main pigment of red beet: molecular origin of its exceptionally high free radical-scavenging activity. Food Addit Contam 2006; 23(11): 1079–87. DOI: 10.1080/02652030600986032, PMID 17071510.

Livrea

and Tesoriere

. Lipoperoxyl radical scavenging and antioxidative effects of red beet pigments. Red Beet Biotechnology: Food and Pharmaceutical Applications . 2012:105–24. DOI: 10.1007/978-1-4614-3458-0_6.

Reddy

, Alexander-Lindo

, & Nair

MG.

Relative inhibition of lipid peroxidation, cyclooxygenase enzymes, and human tumor cell proliferation by natural food colors. J Agric Food Chem 2005; 53(23): 9268–73. DOI: 10.1021/jf051399j, PMID 16277432.

Progatzky

, Cook

, & Lamb

, . Mucosal inflammation at the respiratory interface: A zebrafish model. Am J Physiol Lung Cell Mol Physiol 2016; 310(6): L551–L561. DOI: 10.1152/ajplung.00323.2015, PMID 26719149.

10.

Tarpey

, Wink

, & Grisham

MB.

Methods for detection of reactive metabolites of oxygen and nitrogen: in vitro and in vivo considerations. Am J Physiol Regul Integr Comp Physiol 2004; 286(3): R431–R444. DOI: 10.1152/ajpregu.00361.2003, PMID 14761864.

11.

Tunc

, Thompson

, & Tremellen

. Development of the NBT assay as a marker of sperm oxidative stress. Int J Androl 2010; 33(1): 13–21. DOI: 10.1111/j.1365-2605.2008.00941.x, PMID 19076253.

12.

Kim

, Shajib

, & Manocha

, . Investigating intestinal inflammation in DSS-induced model of IBD. J Vis Exp 2012; (60). DOI: 10.3791/3678, PMID 22331082.

13.

Ausubel

, Brent

, & Kingston

, . Preface. Curr Protoc Mol Biol 2004; 66(1): 1. DOI: 10.1002/0471142727.mbprefs66.

14.

Kirkham

, Spooner

, & Ffoulkes-Jones

, . Cigarette smoke triggers macrophage adhesion and activation: role of lipid peroxidation products and scavenger receptor. Free Radic Biol Med 2003; 35(7): 697–710. DOI: 10.1016/S0891-5849(03)00390-3, PMID 14583334.

15.

Barnes

PJ.

Mediators of chronic obstructive pulmonary disease. Pharmacol Rev 2004; 56(4): 515–48. DOI: 10.1124/pr.56.4.2, PMID 15602009.

16.

Shutenko

, Henry

, & Pinard

, . Influence of the antioxidant quercetin in vivo on the level of nitric oxide determined by electron paramagnetic resonance in rat brain during global ischemia and reperfusion. Biochem Pharmacol 1999; 57(2): 199–208. DOI: 10.1016/S0006-2952(98)00296-2, PMID 9890569.

17.

Van Acker

SABE

, Tromp

MNJL

, & Haenen

GRMM

, . Flavonoids as scavengers of nitric oxide radical. Biochem Biophys Res Commun 1995; 214(3): 755–59. DOI: 10.1006/bbrc.1995.2350, PMID 7575540.

18.

Kasmi

, Bkhairia

, & Harrabi

, . Modulatory effects of quercetin on liver histopathological, biochemical, hematological, oxidative stress and DNA alterations in rats exposed to graded doses of score 250. Toxicol Mech Methods 2018; 28(1): 12–22. DOI: 10.1080/15376516.2017.1351507, PMID 28679351.

19.

Kang

, Lee

, & Lee

, . Suppression of tumor necrosis factor-α and inducible nitric oxide synthase gene expression by THI 52, a new synthetic naphthyl-benzylisoquinoline alkaloid. Biochem Pharmacol 2003; 65(3): 457–64. DOI: 10.1016/S0006-2952(02)01549-6, PMID 12527339.

20.

Hecker

, Cattaruzza

, & Wagner

AH.

Regulation of inducible nitric oxide synthase gene expression in vascular smooth muscle cells. Gen Pharmacol 1999; 32(1): 9–16. DOI: 10.1016/S0306-3623(98)00082-2, PMID 9888247.

21.

Mitra

and Abraham

. Participation of superoxide in neutrophil activation and cytokine production. Biochim Biophys Acta 2006; 1762(8): 732–41. DOI: 10.1016/j.bbadis.2006.06.011, PMID 16919916.

22.

Chan

MMY

, Huang

, & Fenton

, . In vivo inhibition of nitric oxide synthase gene expression by curcumin, a cancer preventive natural product with anti-inflammatory properties. Biochem Pharmacol 1998; 55(12): 1955–62. DOI: 10.1016/S0006-2952(98)00114-2.

23.

Nandi

, Saud

, & Zinkievich

, . TNF-α modulates iNOS expression in an experimental rat model of indomethacin-induced jejunoileitis. Mol Cell Biochem 2010; 336(1–2): 17–24. DOI: 10.1007/s11010-009-0259-2, PMID 19802525.

24.

Al-Khayri

, Sahana

, & Nagella

, . Flavonoids as potential anti-inflammatory molecules: a review. Molecules 2022; 27(9). DOI: 10.3390/molecules27092901, PMID 35566252.

25.

Choi

, Choi

, & Park

, . The inhibitory effects of Geranium thunbergii on interferon-γ- and LPS-induced inflammatory responses are mediated by Nrf2 activation. Int J Mol Med 2015; 35(5): 1237–45. DOI: 10.3892/ijmm.2015.2128. PMID 25761198.

26.

Serafini

, Peluso

, & Raguzzini

Flavonoids as anti-inflammatory agents. Proc Nutr Soc 2010; 69(3): 273–78. DOI: 10.1017/S002966511000162X, PMID 20569521.

27.

Shah

, Khan

, & Ali

, . Monitoring bioaccumulation (in gills and muscle tissues), hematology, and genotoxic alteration in Ctenopharyngodon idella exposed to selected heavy metals. Biomed Res Int 2020; 2020: 6185231. DOI: 10.1155/2020/6185231, PMID 32382561.

28.

Hoffman

, Rattner

, & Burton

, . Handbook of Ecotoxicology . 2nd ed; 2002. DOI: 10.1201/9781420032505.ch1.

Ameliorative Potential of Betanin on Cigarette Smoke Extract-induced Respiratory Mucosal Inflammation and Oxidative Stress in the Adult Zebrafish Model

Abstract

Background

Objectives

Materials and Methods

Results

Conclusion

Keywords

Introduction

Materials and Methods

Study Area

Animal Acclimatation

LC50 Determination of CSE

LC50 Determination for Betanin

Experimental Model

Estimation of Nitric Oxide

ROS Estimation

MPO Activity Assay

Gene Expression Analysis

Primer Sequence.

Histopathology Analysis

Data Analysis

Results

Acute Toxicity Assessment of CSE

Lethal Concentration Determination for Betanin

Lethal Concentration Determination for Betanin. LC50 Determination of Betanin was Plotted against the Days of Treatment based on the Different Oral Dosage Range of Betanin. The Survival Percentage was Shown Up to 7 Days. The Results were Represented as Mean ± SD and Error.

NO Estimation

ROS Determination

Myeloperoxidase Enzyme Estimation

Gene Expression Analysis

Histopathological Examination

Discussion

Conclusion

Summary

Footnotes

Abbreviations

Declaration of Conflicting Interests

Funding

Statement of Informed Consent and Ethical Approval

References

LC₅₀ Determination of CSE

LC₅₀ Determination for Betanin

Lethal Concentration Determination for Betanin. LC₅₀ Determination of Betanin was Plotted against the Days of Treatment based on the Different Oral Dosage Range of Betanin. The Survival Percentage was Shown Up to 7 Days. The Results were Represented as Mean ± SD and Error.