Glutamate synaptic pathway plays an important role in neodymium oxide-incduced oxidative stress and inflammation of the brain

Abstract

Introduction

Rare earth elements (REEs) are increasingly used across various industries, raising concerns regarding their potential health impacts. Exposure to REEs has been linked to systemic diseases affecting the respiratory, nervous, and immune systems. We aimed to explore the effects of REE exposure on neurological health.

Methods

We performed high-throughput sequencing to identify differentially expressed proteins in the plasma of REE-exposed patients compared to healthy individuals. Additionally, in the mouse model, we employed western blotting, quantitative real-time PCR (qRT-PCR), and kits to verify the association between REE exposure and brain damage.

Results

We identified 144 differentially expressed proteins in the plasma of REE-exposed patients. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses indicated that these proteins were primarily related to synaptic functions and the glutamate synaptic pathway. A protein–protein interaction network constructed using the STRING database revealed strong interactions among brain injury-related proteins following REE exposure. In animal experiments, western blot analysis showed that exposure to Nd₂O₃ significantly increased protein levels of calcium channel voltage-dependent P/Q-type alpha 1A subunit, phospholipase A2 group IVA, and SH3 and multiple ankyrin repeat domains 1. qRT-PCR results confirmed increased expression of corresponding genes. Concurrently, elevated levels of malondialdehyde and nitric oxide and decreased total antioxidant capacity were observed.

Discussion

Overall, our findings suggest that Nd₂O₃ exposure is closely associated with brain damage, and the glutamate synaptic pathway plays a significant role. Our study provides novel insights into the molecular mechanisms underlying Nd₂O₃-induced neurotoxicity.

Introduction

Rare earth elements (REEs), which include 15 lanthanides along with yttrium and scandium, are increasingly mined and utilized owing to their critical roles in electronics, medicine, renewable energy, manufacturing, and agriculture. Global demand for REEs is projected to reach approximately 400,000 tons by 2035. ¹ China, particularly regions such as Bayan Obo and Ganzhou, leads global REE production because of its abundant reserves.^2,3 However, large-scale mining and processing have led to broader environmental distribution and increased population exposure to REEs. ⁴ Exposure to REEs has been linked to various systemic diseases, including those affecting the respiratory, nervous, cardiovascular, reproductive, and immune systems. ⁵ Among these elements, neodymium is notable for its magnetic properties and is widely used in electronics, catalysis, magnets, and sensors. With rising global demand, neodymium now accounts for the fourth-largest REE production in the world.^6,7 Neodymium oxide (Nd₂O₃) is a key component in REE industries and is used to produce neodymium through the electrolysis of rare earth oxides in molten salts. ⁸ Given its widespread use, investigating Nd₂O₃’s toxic mechanisms and identifying potential biomarkers is essential.

The nervous system maintains critical physiological functions. As its central organ, the brain regulates homeostasis and defends against pathology. ⁹ Exposure to environmental pollutants, such as heavy metals, atmospheric fine particulate matter, and organic compounds, can damage the central nervous system, leading to brain injury.^10–12 Neurological diseases and brain damage caused by environmental pollutants are major public health issues. Understanding the pathogenic mechanisms of these harmful agents and their molecular targets is essential for effective prevention.

During mining, refining, and processing, neodymium can contaminate the environment, accumulate in ecosystems, and enter the human body via the digestive or respiratory tracts, subsequently accumulating in tissues and organs. ¹³ REEs can cross the blood-brain barrier, potentially disrupting brain development and impairing cognitive functions. The underlying mechanisms may involve oxidative stress, inflammation, lipid peroxidation, and apoptosis.^14,15 However, few studies have examined Nd₂O₃-induced brain injury, and its neurotoxic mechanisms remain poorly understood.

Recent advances in research technologies, including high-throughput omics and bioinformatics, offer powerful tools for investigating clinical problems related to environmental pollutant exposure. ¹⁶ Proteomics offers a comprehensive analysis of the protein composition of cells, tissues, and organisms, serving as a bridge between gene expression and metabolic processes. This approach facilitates the discovery of novel diagnostic markers and therapeutic targets. ¹⁷ Proteomics has been used to identify a range of differentially expressed proteins. This technology has developed through stages, from conventional methods to advanced, quantitative, and high-throughput techniques. ¹⁸ In biological research, it enables dynamic analysis of protein composition, abundance, modifications, and interactions, shedding light on functional patterns and biological variability. ¹⁹ Proteomic studies have identified changes in protein expression in plants exposed to REEs, enabling the identification of biomarkers for exposure and susceptibility.^20,21 However, despite the advancements in proteomics and its applications in environmental studies, further research is needed to fully understand the underlying effects of REEs on protein expression in humans.

In this study, we explored the potential mechanisms underlying Nd₂O₃-induced brain injury. First, we used proteomic analysis to identify differentially expressed proteins associated with REE exposure. Next, we assessed the expression of calcium channel voltage-dependent P/Q-type alpha 1A subunit (CACNA1A), phospholipase A2 group IVA (PLA2G4A), and SH3 and multiple ankyrin repeat domains 1 (SHANK1) in brain tissue, along with oxidative stress and inflammatory markers, in a mouse model of Nd₂O₃ exposure. Our goal was to provide new insights into the molecular basis of brain injury caused by Nd₂O₃ exposure.

Materials and methods

Study subjects

Nine individuals who had been exposed to REEs from rare earth smelters between 2016 and 2018 were enrolled in the exposed group. Additionally, nine individuals undergoing routine physical examinations were selected as healthy controls. In the exposed group, there were no smokers, and the mean age was 50.01 ± 4.16 years. The healthy control group had no history of smoking or dust exposure. All participants were male and had no history of lung or bronchial disease. This study was approved by the Medical Ethics Committee of Baotou Medical College (Batch number: Baotou Medical College Ethics Review 2021 No. 009). Written informed consent was obtained from all participants.

Biological sample collection

Fasting venous blood (5 mL) was collected in EDTA anticoagulant tubes, and plasma was separated by centrifugation for subsequent experiments. Samples were stored at −80°C prior to analysis. To reduce individual variation, plasma samples from each group were randomly pooled into three test tubes, as described in our previous study. ²²

iTRAQ and LC-MS/MS analysis

High-abundance proteins were removed, digested, and labeled with commercial kits. Peptides were separated and analyzed using the TripleTOF 5600 system (SCIEX, Framingham, MA, USA). All MS/MS spectra were processed using Mascot software. The automated software IQuant was used for quantitative analysis of peptides with isobaric labels. Proteins with fold change (FC) > 1.2 or <0.83 and p < 0.05 were considered differentially expressed. Hypergeometric tests were used for GO, KEGG, and KOG enrichment analyses of the differentially expressed proteins. The STRING protein interaction database was used to analyze the interactions of differentially expressed proteins. WoLF PSORT software was used for subcellular localization predictions of differentially expressed proteins.

Grouping and treatment of experimental animals

To investigate the potential relationship between REE exposure and brain tissue injury, mice were treated with Nd₂O₃. Healthy male C57BL/6 J mice weighing 21–23 g and aged 6–8 weeks were purchased from SIPEIFU Biotechnology Co., Ltd. (Beijing, China). A total of 48 mice (Animal License No. SCXK (Beijing) 2019-0010) were randomly assigned to four groups based on body weight: one control group and three groups exposed to Nd₂O₃ at low, medium, and high doses. The exposure doses, determined by preliminary experiments conducted by the research group, were set at 0, 62.5, 125, and 250 mg/mL Nd₂O₃, with 12 mice in each group. After 2 weeks of adaptive feeding, the mice were anesthetized by intraperitoneal injection with supersaturated tribromoethanol solution. Subsequently, 0.1 mL of normal saline (for the control group) or Nd₂O₃ suspension was administered via non-exposed tracheal perfusion. Nd₂O₃ was dissolved in sterile saline, sterilized at 121°C under high pressure for 20 min to make a suspension, and sonicated for 30 min to completely dissolve it. During perfusion, the mouse’s head was tilted upward using a silk thread, and a needle was inserted through the glottis. The metal needle was withdrawn, and the solution was injected using a trocar. After inhalation of the full volume, the mice were suspended for 5–10 s and placed on a temperature-controlled heating plate for recovery. On days 7 and 35 post-exposure, mice were euthanized by intraperitoneal injection of supersaturated tribromoethanol solution (0.009 mL/g) to induce unconsciousness prior to respiratory arrest. Throughout the experiment, dietary intake, mental state, activity, and overall condition of the mice were monitored daily, and body weights were recorded weekly. Predefined humane endpoints included weight loss exceeding 20%, reduced mobility, or signs of neurological distress. This study was approved by the Medical Ethics Committee of Baotou Medical College (Batch number: Baotou Medical College Ethics Review 2021 No. 009).

Assessment of oxidative stress and inflammation

To minimize bias, personnel blinded to group assignments conducted all subsequent analyses. Brain tissue of mice exposed for 7 and 35 days was harvested. Oxidative stress and inflammation markers were extracted according to the manufacturer’s instructions in the respective kits. Malonaldehyde (MDA) (Boxbio, Beijing, China) and total antioxidant capacity (T-AOC) (Boxbio) were selected as markers of oxidative stress, and nitric oxide (NO) (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) levels were used to assess inflammation.

RNA extraction and quantitative real-time PCR analysis

RNA was extracted from the brain tissue of exposed mice using an RNA extraction kit and reverse-transcribed into cDNA. qRT-PCR was conducted using the corresponding primers (Table 1). Amplification conditions: 95°C denaturation, 60°C annealing, and 72°C extension; 40 cycles. After amplification, the fluorescence data were converted to threshold cycle (Ct) values and analyzed.

Table 1.

PLA2G4A, SHANK1, CACNA1A, β-actin Gene primer sequence.

Gene	Primer sequence (5ʹ→3ʹ)
PLA2G4A	F: CAGCACATTATAGTGGAACACCA
	R: AGTGTCCAGCATATCGCCAAA
SHANK1	F: TGCATCAGACGAAATGCCTAC
	R: AACAGTCCATAGTTCAGCACG
CACNA1A	F: CACCGAGTTTGGGAATAACTTCA
	R: ATTGTGCTCCGTGATTTGGAA
β- actin	F: GCAGCTCAGTAACAGTCCGC
	R: AGTGTGACGTTGACATCCGT

Western blot analysis

Brain tissues of mice exposed for 7 and 35 days were collected for western blotting. Proteins were extracted and quantified using a BCA assay kit (Beyotime, Shanghai, China) following the manufacturer’s instructions. Proteins were separated by SDS-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. The membranes were blocked with 5% skim milk powder and incubated overnight at 4°C with primary antibodies against β-actin (Absin, Shanghai, China), PLA2G4A (Abcam, Shanghai, China), CACNA1A (Abcam), and SHANK1 (Abcam). Subsequently, the membranes were incubated with secondary antibody at 25°C for 1 h. Protein bands were visualized using an enhanced chemiluminescence plus detection system. The density of each band was quantified using the ImageJ software. ²³

Hematoxylin and eosin (HE) staining

Mouse brain tissue was dissected, fixed for 24 h, dehydrated with graded ethanol, cleared with xylene, and embedded in paraffin. The tissues were then cut into 5 μm sections, dehydrated, rehydrated, and stained using HE. After mounting, changes in the morphology and quantity of nerve cells in the cerebral cortex of the mouse were observed under an optical microscope.

Statistical analysis

All data are expressed as the mean ± SD. SPSS was used for ANOVA (LSD/SNK post hoc tests), and GraphPad Prism 5.0 was used to generate bar graphs. Statistical significance was set at p < 0.05.

Results

Plasma proteomic analysis between REEs-exposed patients and healthy individuals

Using the healthy group data as a reference, proteomic analysis was conducted on plasma proteins from the REEs-exposed and healthy groups (Figure 1(a)). A total of 263,950 spectra were detected in the plasma total protein levels test, including 20,572 unique spectra (Figure 1(b)). Quantitative analysis of protein coverage revealed that the largest proportion of proteins had coverage of 0%–10%, followed by 10%–20% (Figure 1(c)). Comparative proteomic analysis between the exposed and healthy groups using iTRAQ labeling and the human protein database identified 551 proteins, of which 144 were differentially expressed—60 upregulated (FC >1.2, p < 0.05) and 84 downregulated (FC <0.83, p < 0.05) (Figure 1(d), Supplemental Tables 1 and 2). Notable differentially expressed proteins included SLC14A2 (FC = 6.58; function: urea transporter 2); ALOXE3 (5.18; hydroperoxide isomerase); RDH12 (4.91; retinol dehydrogenase 12); PCDHGB2 (0.50; protocadherin gamma-B2), and WT1 (0.52; Wilms tumor protein) (Figure 1(e)). These findings indicate significant alterations in human plasma protein expression following REEs exposure.

Figure 1.

Quantitative plasma proteomic analysis between REE-exposed and healthy groups. (a) Human plasma was collected from the REE-exposed and healthy groups for proteomic sequencing. (b) The number of spectra is represented using a bar chart with data processed using the Mascot software. (c) Pie chart showing protein coverage. Volcano plot (d) and heatmap (e) depicting the levels of differentially expressed proteins in proteomics.

Synapse-related functions are significantly enriched after REE exposure

GO analysis categorizes proteins by molecular function (MF), cellular component (CC), and biological process (BP). A total of 1733 GO terms were identified, including 1314 BP, 220 CC, and 199 MF terms. The top 10, 16, and 27 terms were selected based on the p-values for visualization (Figure 2(a)). Enrichment analysis showed that MF-related genes were predominantly involved in binding, whereas BP-related genes were mainly associated with cellular processes. Most genes were enriched in organelles, cells, and cell parts (gene count >100). Functional categorization of upregulated and downregulated proteins revealed more downregulated proteins across all three functional categories. However, proteins associated with synapse and synapse-related functions showed an upward trend (Figure 2(b)), suggesting significant enrichment in these pathways after REEs exposure.

Figure 2.

GO analysis of differentially expressed proteins between REE-exposed and healthy groups. (a and b) GO enrichment analysis of differentially expressed proteins using the DAVID platform. Annotation: CCOB: cellular component organization or biogenesis, PRBP: positive regulation of biological process, NRBP: negative regulation of biological process, PPICST: presynaptic process involved in chemical synaptic transmission.

Glutamate synaptic pathway is significantly enriched after REE exposure

The 24 most significant pathways were identified through KOG functional annotation analysis (Figure 3(a)), primarily involving four domains: cellular processes and signaling, information storage and processing, metabolism, and poorly characterized pathways. The signal transduction mechanism contained the highest number of proteins. To assess nerve damage in the REE-exposed group, “neural” was used as the retrieval term to identify the related signaling pathways. Forty pathways fulfilled the criteria set for the pathway term p value. Among these, pathways associated with the immune system, bacterial diseases, and signal transduction had more differentially expressed proteins (Figure 3(b)). The number of up and downregulated proteins in each pathway was also quantified, showing that hypertrophic cardiomyopathy, platelet activation, arrhythmogenic right ventricular cardiomyopathy, rap1 signaling pathway, small cell lung cancer, and glutamatergic synapses had more upregulated proteins (Figure 3(c)). A bubble plot showed that REE exposure might contribute to brain injury via multiple pathways, particularly the glutamate synaptic pathway (Figure 3(d)). These results indicate that this pathway is significantly enriched.

Figure 3.

KOG and KEGG analysis of differentially expressed proteins between REE-exposed and healthy groups. (a) KOG functional annotation analysis of differentially expressed proteins. (b and c) KEGG functional annotation analysis of differentially expressed proteins. (d) KEGG functional enrichment analysis of differentially expressed proteins.

Prediction of protein interaction networks and subcellular localization

We constructed and analyzed protein interaction networks based on differentially expressed proteins (Figure 4(a)). In the central part of the diagram, interactions between proteins are high, and the surrounding proteins show a weaker interaction. Comparison with the STRING protein interaction database showed that Fibronectin (FN1), C3, Alpha-2-HS-glycoprotein (AHSG), and Alpha-1 antitrypsin (SerpinA1) were closely related to REE exposure. Subcellular prediction of differentially expressed proteins showed that most of the differentially expressed proteins were found in the extracellular matrix, nucleus, and cytoplasm (Figure 4(b)). The differentially expressed proteins related to the glutamate synaptic pathway, namely CACNA1A, PLA2G4A, and SHANK1, were plotted as bar graphs. All three proteins were significantly upregulated in the REE-exposed group (Figure 4(c)–(e)).

Figure 4.

Protein–protein interaction and subcellular localization analysis of differentially expressed proteins. (a) Protein interaction analysis: each circle in the figure represents a protein. (b) Bar chart of subcellular localization predictions for differentially expressed proteins according to the WoLF PSORT software. (c–e) Human plasma was collected from REE-exposed and healthy groups for proteomic sequencing. Proteomics was used to determine the relative protein levels of CACNA1A, SHANK1, and PLA2G4A.

Protein levels of CACNA1A, PLA2G4A, and SHANK1 are increased in the brain tissue of mice exposed to Nd₂O₃

We examined protein levels in the brain tissues of male C57BL/6 J mice treated with 0, 62.5, 125, and 250 mg/mL Nd₂O₃ for 7 or 35 days (Figure 5(a)). In the HE sections, the cell nuclei in the control group were clear, the cytoplasm was abundant, and the tissue structure was tight. However, after Nd₂O₃ treatment, the neuronal cells became degenerated; the cell bodies shrank and stained dark, especially in the 250 mg/mL Nd₂O₃ group; the brain tissue was severely damaged, and a large number of neurons became degenerated (Figure 5(b)–(i)). Western blot analysis revealed that CACNA1A protein levels were significantly elevated in mice treated with 125 and 250 mg/mL Nd₂O₃ for 35 days (Figure 5(o)). PLA2G4A levels were markedly increased in mice treated with 62.5, 125, and 250 mg/mL Nd₂O₃ for 7 days, showing a dose-effect relationship. PLA2G4A levels in the brain tissue of mice treated with 250 mg/mL Nd₂O₃ for 35 days were also increased (Figure 5(l) and (p)). The levels of SHANK1 in the brain tissue of mice treated with 250 mg/mL Nd₂O₃ for 7 and 35 days were markedly higher than those in the control group (Figure 5(m) and (q)). These results indicate that Nd₂O₃ increases the protein levels of CACNA1A, PLA2G4A, and SHANK1 in the brain tissue of mice.

Figure 5.

Protein levels of CACNA1A, SHANK1, and PLA2G4A are increased after Nd₂O₃ exposure. (a) Male C57BL/6 J mice were treated with 0, 62.5, 125, or 250 mg/mL of Nd₂O₃ for 7 and 35 days. (b–i) The condition of neurons in the brain tissue of mice was observed through HE staining. b–e represent the results of the 7 days treatment, while f–i represents the results of the 35 days treatment. The red arrows indicate necrotic neurons. The scale bar in the figure represents 20 µm. (j) Western blotting was performed, and (k–m) relative protein levels of CACNA1A, PLA2G4A, and SHANK1 were determined in the brain tissue of mice exposed to different concentrations of Nd₂O₃ for 7 days (n) Western blotting was performed, and (o–q) relative protein levels of CACNA1A, PLA2G4A, and SHANK1 were determined in the brain tissue of mice exposed to different concentrations of Nd₂O₃ for 35 days ^*p < 0.05, ^**p < 0.01, ^***p < 0.001, different from the control group. See Supplemental Tables 3 and 4 for full protein list.

mRNA levels of CACNA1A, PLA2G4A, and SHANK1 are increased in the brain tissue of mice exposed to Nd₂O₃

mRNA levels of CACNA1A, PLA2G4A, and SHANK1 in the brain tissue of mice were measured using qRT-PCR. mRNA levels of CACNA1A in the brain tissue of mice treated with 125 mg/mL Nd₂O₃ for 7 and 35 days were markedly higher than those in the control groups. Simultaneously, mRNA levels of CACNA1A in the brain tissue of mice treated with 250 mg/mL Nd₂O₃ for 35 days were significantly higher than those of the control group (Figure 6(a) and (d)). mRNA levels of PLA2G4A in the brain tissue of mice treated with 0, 62.5, 125, and 250 mg/mL Nd₂O₃ for 7 and 35 days were markedly increased, with a dose-effect relationship (Figure 6(b) and (e)). mRNA levels of SHANK1 in the brain tissue of mice treated with 250 mg/mL Nd₂O₃ for 7 and 35 days were markedly higher than those in the control group; however, mRNA levels of SHANK1 in the brain tissue of mice treated with 125 mg/mL Nd₂O₃ for 35 days were significantly higher than those in the control group (Figure 6(c) and (f)). These results indicate that Nd₂O₃ increases the mRNA levels of CACNA1A, PLA2G4A, and SHANK1 in the brain tissue of mice.

Figure 6.

mRNA levels of CACNA1A, PLA2G4A, and SHANK1 are increased in the brain tissue of mice exposed to Nd₂O₃. mRNA levels of CACNA1A (a and d), PLA2G4A (b and e), and SHANK1 (c and f) in the brain tissue of mice were measured using qRT-PCR.

Nd₂O₃ aggravates oxidative stress reactions and inflammation in brain tissue

MDA and T-AOC are indicators of oxidative stress in tissues, ²⁴ whereas NO is an inflammatory mediator, and its increased content may kill target cells. ²⁵ To assess the roles of oxidative stress and inflammation in Nd₂O₃-induced brain damage, we measured the levels of MDA, T-AOC, and NO in the brain tissue of mice after male C57BL/6 J mice were treated with 0, 62.5, 125, or 250 mg/mL Nd₂O₃ for 7 and 35 days. In the brain tissue of mice treated with 125 and 250 mg/mL Nd₂O₃ for 7 and 35 days, MDA levels were markedly higher than those in the control group (Figure 7(a) and (d)). T-AOC levels in brain tissue of mice treated with 125 and 250 mg/mL Nd₂O₃ for 7 and 35 days were markedly lower than those in the control group (Figure 7(b) and (e)). Similarly, NO levels in brain tissue of mice treated with 250 mg/mL Nd₂O₃ for 7 and 35 days were markedly higher than those in the control group (Figure 7(c) and (f)). These results indicate that Nd₂O₃ exacerbates oxidative stress and inflammation in mouse brain tissue.

Figure 7.

Nd₂O₃ induces an increase in MDA and NO levels and a decrease in T-AOC levels in the brain tissue of mice. (a and d) MDA levels in the brain tissue of mice were measured using MDA detection kits. (b and e) T-AOC levels in the brain tissue of mice were measured using a T-AOC detection kit. (c and f). NO levels in the brain tissue of mice were measured using an NO detection kit.

Discussion

Owing to their unique properties, REEs have become indispensable across various industries, and the resulting exposure to REEs has received increasing attention. ²⁶ REEs can enter the human body through inhalation, skin contact, and the food chain. Short- and long-term inhalation exposure can cause acute irritant bronchitis, pneumoconiosis, and pulmonary fibrosis. ²⁷ The development of biosequencing technologies has led to a more detailed understanding of the molecular regulatory mechanisms underlying gene function. However, few studies have investigated the impact of REE exposure at the proteomic level. Animal studies have shown that REE exposure can lead to reduced learning and memory abilities and even axonal abnormalities in offspring neurons.^28,29 Therefore, we performed proteomic analyses of REE-exposed populations and validated our findings using an animal model of Nd₂O₃ exposure to identify potential biomarkers and explore their association with brain damage.

Proteomic analysis detected 144 differentially expressed proteins in the REE-exposed groups, of which 60 were upregulated and 84 were downregulated. KOG database analysis showed that the most enriched proteins were involved in signal transduction pathways, suggesting that REEs may disrupt normal physiological functions by affecting signal transduction. Protein interaction data showed that FN1, C3, AHSG, and SerpinA1 were highly associated with REE exposure. FN1 is involved in glial cell formation and has been implicated in traumatic brain injury and Alzheimer’s disease.^30,31 Complement C3 is a classic complement component, and its overactivation can lead to neuronal damage. ³² AHSG, an anti-inflammatory mediator, is associated with pathological changes in Alzheimer’s disease. ³³ SerpinA1 is an acute-phase protein that appears to play a role in neurodegeneration and neuroinflammation. ³⁴ These findings suggest a close relationship between REE exposure and neural injury.

KEGG analysis indicated that brain damage following REE exposure may be related to the regulation of multiple pathways, particularly the glutamate synaptic pathway. Glutamate, an excitatory neurotransmitter, is crucial for normal brain function. ³⁵ Its release activates NMDA receptors, mediating excessive Ca²⁺ influx into cells and triggering a downstream Ca²⁺-dependent cell death signaling cascade. ³⁶ Glutamate is involved in numerous neural signal transduction pathways. Glutamate receptor 1 (GluR1) plays a key role in neurotransmission, hippocampal plasticity, and memory. Reduced GluR1 surface expression in the hippocampus is associated with cognitive decline, whereas excessive glutamate release is linked with neurodegeneration and cognitive impairment after traumatic brain injury.^37,38 To further investigate the potential association between REE exposure and brain injury, we administered a single tracheal infusion of Nd₂O₃ to simulate REE toxicity in mice and measured markers related to brain injury. The results showed altered expression of the brain injury-associated proteins PLA2G4A, SHANK1, and CACNA1A, along with an increase in the oxidative stress marker MDA, a decrease in T-AOC, and an up-regulation of the inflammatory marker NO.

PLA2G4A is widely expressed in the brain, especially in astrocytes. Excess PLA2G4A can lead to neuronal damage and secondary injury to the central nervous system.^39–41 Moreover, anxiety and depression-like behaviors in animals are associated with increased hippocampal PLA2G4A activity. ⁴² PLA2G4A can release arachidonic acid (AA), and the PLA2G4A/AA pathway plays a role in pulmonary fibrosis. Upregulation of PLA2G4A expression and AA production can activate fibroblasts, indicating a regulatory role for PLA2G4A in fibrotic processes. ⁴³ PLA2G4A is also involved in secondary inflammation and apoptosis. ⁴⁴

SHANK proteins, encoded by SHANK1, SHANK2, and SHANK3, are scaffolding proteins for glutamate receptors and are essential for neurodevelopment and cognition. SHANK1 is involved in maintaining normal synaptic structures and signaling, including long-term potentiation and depression, which underlie learning and memory. ⁴⁵ Normal regulation of SHANK1 is essential for brain function, whereas dysregulation leads to the impairment of many learning and cognitive functions.^46,47 SHANK1 is anatomically located in the postsynaptic density of excitatory neurons and is involved in dendritic spine modification—a process crucial for neuronal development.^48–50 Therefore, SHANK1 may influence nervous system function by directly modifying the neuronal synaptic networks.

CACNA1A encodes the pore-forming α1 subunit of voltage-gated P/Q type Ca²⁺ channels (Cav2.1). ⁵¹ These channels are predominantly located at presynaptic terminals, especially in cerebellar Purkinje cells, and control neurotransmitter release. ⁵² In mammals, Cav2.1 is expressed at neuromuscular junctions, where it regulates presynaptic acetylcholine release. ⁵³ Mutations in CACNA1A have been associated with episodic ataxia type 2, familial hemiplegic migraine, spinocerebellar ataxia, developmental delay, epilepsy, paroxysmal dystonia, and neuropsychiatric disorders.^54–56

Ultrafine particles can induce neurotoxicity via microglial activation. Specifically, activated neuroinflammatory microglia can secrete complement 1q and induce astrocytes to differentiate into type A1 cells, thus losing their ability to promote neuronal synapses and causing synaptic damage through C3 secretion. Neurological damage caused by Nd₂O₃ may also be related to this mechanism. ⁵⁷ As an important component of postsynaptic density, SHANK1 regulates synaptic development, structure, and function through molecular interactions within various synaptic signaling pathways. ⁵⁸ CACNA1A plays an important role in voltage-gated calcium channels, and calcium ions play an important role in the release of neurotransmitters. PLA2G4A plays a role in phospholipid metabolism in cell membranes and indirectly affects neuronal membrane structure and function, thereby affecting the glutamate synaptic pathway. The glutamate synaptic pathway is closely related to brain injury ⁵⁹ ; hence, these three proteins may be used as potential biomarkers of brain injury caused by Nd₂O₃ exposure. This damage relationship is mediated through the glutamate synaptic pathway.

Collectively, these findings provide a deeper understanding of the toxic mechanisms underlying Nd₂O₃ exposure and establish a foundation for identifying markers of brain injury. Our results suggest that the glutamate synaptic pathway plays a crucial role in Nd₂O₃-induced oxidative stress and inflammation in the brain. A limitation of this study is that the functions of key differentially expressed proteins were not evaluated in detail. Pooling reduced inter-individual variability but constrained the statistical power. Furthermore, the regulatory mechanisms of the three identified proteins remain unexplored and require further investigation.

Supplemental Material

Supplemental Material - Glutamate synaptic pathway plays an important role in neodymium oxide-induced oxidative stress and inflammation of the brain

Supplemental Material for Glutamate synaptic pathway plays an important role in neodymium oxide-induced oxidative stress and inflammation of the brain by Xiaoyan Du, Yanrong Gao, Lihong Wu, Jing Cao, Suhua Wang, and Yang Deng in Human & Experimental Toxicology

Supplemental Material

Supplemental Material - Glutamate synaptic pathway plays an important role in neodymium oxide-induced oxidative stress and inflammation of the brain

Supplemental Material for Glutamate synaptic pathway plays an important role in neodymium oxide-induced oxidative stress and inflammation of the brain by Xiaoyan Du, Yanrong Gao, Lihong Wu, Jing Cao, Suhua Wang, and Yang Deng in Human & Experimental Toxicology

Supplemental Material

Supplemental Material - Glutamate synaptic pathway plays an important role in neodymium oxide-induced oxidative stress and inflammation of the brain

Supplemental Material for Glutamate synaptic pathway plays an important role in neodymium oxide-induced oxidative stress and inflammation of the brain by Xiaoyan Du, Yanrong Gao, Lihong Wu, Jing Cao, Suhua Wang, and Yang Deng in Human & Experimental Toxicology