Sage Journals: Discover world-class research

Abstract

Objective:

To explore the mechanism of dexmedetomidine (DEX)-mediated miR-134 inhibition in hypoxia-induced damage in PC12 cells.

Methods:

Hydrogen peroxide (H₂O₂)-stimulated PC12 cells were divided into control, H₂O₂, DEX + H₂O₂, miR-NC/inhibitor + H₂O₂, and miR-NC/ mimic + DEX + H₂O₂ groups. Cell viability and apoptosis were assessed by the 3-(4,5-dimethylthiazol(-2-y1)-2,5-diphenytetrazolium bromide (MTT) assay and Annexin V-FITC/PI staining, while gene and protein expression levels were detected by qRT-PCR and western blotting. Reactive oxygen species (ROS) levels were tested by 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) staining, and malondialdehyde (MDA) content was determined with a detection kit.

Results:

DEX treatment decreased H₂O₂-elevated miR-134 expression. H₂O₂-induced PC12 cell damage was improved by DEX and miR-134 inhibitor; additionally, cell viability was increased, while cell apoptosis was reduced. In addition, both DEX and miR-134 inhibitor reduced the upregulated expression of cleaved caspase-3 and increased the downregulated expression of Bcl-2 in H₂O₂-induced PC12 cells. However, compared to that in the DEX + H₂O₂ group, cell viability in the mimic + DEX + H₂O₂ group was decreased, and the apoptotic rate was elevated with increased cleaved caspase-3 and decreased Bcl-2 expression. Inflammation and oxidative stress were increased in H₂O₂-induced PC12 cells but improved with DEX or miR-134 inhibitor treatment. However, this improvement of H₂O₂-induced inflammation and oxidative stress induced by DEX in PC12 cells could be reversed by the miR-134 mimic.

Conclusion:

DEX exerts protective effects to promote viability and reduce cell apoptosis, inflammation, and oxidative stress in H₂O₂-induced PC12 cells by inhibiting the expression of miR-134.

Keywords

Dexmedetomidine miR-134 PC12

Introduction

Neurological disease severely affects patients’ physical health and quality of life, bringing heavy burdens to their families and society. Thus, the prevention and treatment of neurological disease are subjects of intense research focus, especially regarding the aging population.^1,2 Pathologically, the key features of neurological diseases are the degeneration and loss of neurons and myelin sheaths, and oxidative stress, chronic sclerosis, mitochondrial dysfunction, and endoplasmic reticulum stress lead to neuron loss.^3,4 Accumulating evidence suggests that oxidative stress and the imbalance between the production of reactive oxygen species (ROS) and antioxidant capacity are the main causes of neuron loss.⁵ ROS are primarily produced by aerobic cells in metabolic processes, including superoxide, hydrogen peroxide (H₂O₂), and hydroxyl free radicals.⁶ When ROS are excessively produced, neurological systems and neuroendocrine functions are altered, contributing to various neurological diseases, such as Alzheimer’s disease, Parkinson’s disease, and stroke.⁷ Therefore, inhibition of oxidative stress damage to reduce neuron loss could be a leading strategy to prevent and treat neurological diseases.^8,9

Dexmedetomidine (DEX), a highly potent α-adrenergic receptor agonist, regulates the release of norepinephrine by acting on the presynaptic membrane α2 receptor and is universally used for sedation and analgesia in the intensive care unit (ICU) and against cerebral injury. Increasing data from clinical research has determined DEX to be safe and tolerable in patients.^10,11 Moreover, microRNA (miRNA), a short noncoding RNA, plays a critical role in the posttranscriptional regulation of gene expression through base pairing with its target messenger RNA (mRNA). Reportedly, DEX exerts neuroprotective effects through miRNAs, such as miR-381¹² and miR-151-3p.¹³ In addition, DEX significantly inhibits the expression of miR-134, a brain-specific miRNA, in the lipopolysaccharide (LPS)-induced hippocampus and cortex.^14,15 However, whether DEX-mediated miR-134 inhibition has any effects on neuronal hypoxic injury is not yet known. PC12 cells, a differentiated cell line of rat adrenal medulla pheochromocytoma, exhibit the general characteristics of neuroendocrine cells and have been widely used in neurophysiological and neuropharmacological research. Exogenous hydrogen peroxide (H₂O₂) penetrates the cell membrane and leads to the overproduction of ROS, which causes cellular oxidative stress-induced damage, further resulting in cell DNA damage and death.^16,17 Therefore, this study established an oxidative damage model with H₂O₂-damaged PC12 cells treated with DEX, miR-134 inhibitor, or miR-134 mimic alone or in combination to explore the effect of DEX-mediated miR-134 inhibition on H₂O₂-induced PC12 cell damage.

Materials and methods

Cell culture

Rat pheochromocytoma PC12 cells are a clonal cell line derived from a pheochromocytoma of the rat adrenal medulla. The cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and were cultured in high-sugar Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich, St. Louis, MO, USA) containing 10% heat-inactivated horse serum (HS, HyClone, Logan, UT, USA), 5% fetal bovine serum (FBS, Sigma-Aldrich, St. Louis, MO, USA), 100 units/mL penicillin (Sigma-Aldrich, St. Louis, MO, USA), and 50 μg/mL gentamycin sulfate (Sigma-Aldrich, St. Louis, MO, USA) in a 37°C, 5% CO₂ incubator. To induce differentiation, PC12 cells were incubated for 5 days in DMEM containing low serum, which included 1% HS, 1% FBS, and 100 ng/mL nerve growth factor (NGF, Sigma-Aldrich, St. Louis, MO, USA). The medium was replaced daily. If the length of one or more neurites was longer than the diameter of the cell body, they were counted as differentiated cells.

Cell grouping

H₂O₂ solution was obtained from Sigma-Aldrich (catalog# 323381, St. Louis, MO, USA). DEX (Precedex, Hospira Inc., Lake Forest, IL, USA) was diluted in 0.9% normal saline prepared using Milli-Q water. MiR-134 mimic (catalog# 4464066), miR-134 inhibitor (catalog# 4464084), and miRNA negative control (miR-NC, catalog# 4464058) purchased from Thermo Fisher Scientific (Shanghai, China) were transfected with Lipofectamine™ 3000 transfection reagent (catalog# L3000015, Carlsbad, CA, USA). PC12 cells were divided into seven groups as follows: Control group (cells were cultured normally); H₂O₂ group (cells were treated with 300 μM H₂O₂ for 24 h); DEX + H₂O₂ group (cells were pre-treated with 300 μM H₂O₂ for 24 h and then incubated with 100 μM DEX for another 24 h); miR-NC/inhibitor + H₂O₂ groups (cells transfected with miR-NC/miR-134 inhibitor were treated with 300 μM H₂O₂ for 24 h); and miR-NC/mimic + DEX + H₂O₂ group (cells transfected with miR-NC/miR-134 mimic were pre-treated with 300 μM H₂O₂ followed by 100 μM DEX for another 24 h).

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

PC12 cells (1 × 10⁴ cells per well) in the logarithmic growth phase were inoculated into 96-well plates in 100 µL of cell culture medium. A CyQUANT™ MTT Cell Proliferation Assay Kit (V13154, Life Technologies Corporation, Carlsbad, CA, USA) was used to determine the cell number using standard microplate absorbance readers. The optical density (OD) value of cells was measured at 490 nm on an ELx800 Universal Microplate Reader (BioTek Instruments, Highland Park, USA).

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Total RNA was extracted using a TRIzol™ Reagent Extraction kit (catalog# 15596018, Invitrogen), and cDNA was synthesized by reverse transcription using a High-Capacity cDNA Reverse Transcription Kit (catalog# 4368814, Applied Biosystems, Foster City, CA, USA). The primer sequences are listed in Table 1. qRT-PCR was performed on a 7500 Fast Real-Time PCR System (catalog# 4351106, Applied Biosystems, Foster City, CA, USA) using PowerUp™ SYBR™ Green Master Mix (catalog# A25742, Applied Biosystems, Foster City, CA, USA). U6 and GAPDH (glyceraldehyde-phosphate dehydrogenase) were used as independent internal references. The differential gene mRNA expression between the experimental and control groups was calculated using the 2^ΔΔ^CT method.

Table 1.

The primers of qRT-PCR used in the study.

Gene	Primer sequence (5′-3′)
miR-134	Forward: GCAGTGTGACTGGTTGAC
	Reverse: CAGTTTTTTTTTTTTTTTCCCCTCT
U6	Forward: ATACAGAGAAGATTAGCATGGCC
	Reverse: ATACAGAGAAGATTAGCATGGCC
IL-1β	Forward: AACAAAAATGCCTCGTGCTGTCT
	Reverse: TGTTGGCTTATGTTCTGTCCATTG
TNF-α	Forward: TCGAGTGACAAGCCCGTAGC
	Reverse: CTCAGCCACTCCAGCTGCTC
IL-6	Forward: GAGGATACCACTCCCAACAGACC
	Reverse: AAGTGCATCATCGTTGTTCATACA
GAPDH	Forward: GATGCTGGTGCTGAGTATGTCGT
	Reverse: TCAGGTGAGCCCCAGCCT

Western blotting

Total cell protein was extracted, and the concentration was estimated using the BCA Protein Assay (catalog# 23223, Thermo Scientific, Shanghai, China). An equivalent of 30 µg of protein was resolved by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, catalog# 89888, Thermo Scientific, Shanghai, China) and transferred to a polyvinylidene fluoride (PVDF, catalog# 8852, Thermo Scientific, Shanghai, China) membrane. Subsequently, the membrane was blocked with skimmed milk powder at room temperature and probed with anti-cleaved caspase-3 (1:1000, catalog# PA5-23921), anti-Bcl-2 (1:1000, catalog# PA5-27094), and anti-β-actin (1:1000, catalog# PA1-183) antibodies (Thermo Scientific, Shanghai, China) at room temperature for 1 h. Next, the membranes were incubated with the corresponding secondary antibodies at room temperature for 1 h. The immunoreactive bands were developed using horseradish peroxidase (HRP) substrate (Thermo Scientific, Shanghai, China). β-Actin was used as the internal reference protein, and the ratio of the target protein to β-actin was represented the relative content of the target protein.

Fluorescein isothiocyanate (FITC)-annexin/propidium iodide (PI) staining

A FITC Annexin V/Dead Cell Apoptosis Kit was used to detect apoptosis (V13242, Invitrogen, Ltd., Paisley, UK). The cells (2 × 10⁵ cells/mL) were harvested using trypsin without ethylenediaminetetraacetic acid (EDTA), collected by centrifugation at 2000 rpm at room temperature for 5–10 min, and resuspended in precooled (4°C) 1X phosphate-buffered saline (PBS), followed by washing by centrifugation at 2000 rpm for 5–10 min. Then, the cells were suspended in 1X annexin-binding buffer, followed by the addition of 5 µL of FITC annexin V and 1 µL of the 100 μg/mL PI working solution. Apoptosis was measured on a flow cytometer (BD FACSCalibur; BD Biosciences, New Jersey, USA) after 5 min. The flow cytometric apoptotic scatter plot is shown as follows: the lower right quadrant shows early apoptotic cells; the upper right quadrant shows necrotic and late apoptotic cells; the upper left quadrant shows mechanically damaged or necrotic cells; and the lower left quadrant shows live cells. Apoptosis rate (%) = early apoptosis percentage + late apoptosis percentage.

Detection of the oxidative stress index

Intracellular ROS production was tested using 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA, catalog# HY-D0940, MedChemExpress, China). Malondialdehyde (MDA) content was detected by a Lipid Peroxidation Assay Kit (Abcam, USA).

Statistical analysis

SPSS 21.0 statistical software (SPSS Inc., Chicago, IL, USA) was used to analyze the data, which are presented as the mean ± standard deviation (SD). The differences among groups were compared by one-way analysis of variance (ANOVA), and Tukey’s honest significant difference (HSD) test was performed if the differences were statistically significant (P < 0.05, P < 0.01, P < 0.005, P < 0.001).

Results

Effects of H₂O₂ and DEX on the viability of PC12 cells

The MTT assay showed that H₂O₂ significantly reduced the viability of PC12 cells in a concentration-dependent manner (Figure 1(A)). When the concentration of H₂O₂ was 300 μM, the PC12 cell viability was approximately 50%; thus, 300 μM was used as the experimental concentration. As shown in Figure 1(B), 0-100 μM DEX did not affect PC12 cell viability, whereas 200 μM DEX significantly decreased cell viability. Therefore, 100 μM DEX was selected for subsequent experiments.

Figure 1.

Effects of H₂O₂ and DEX on the viability of PC12 cells. Notes: The effects of different concentrations of H₂O₂ (0, 100, 200, 300, and 400 μM (A) and DEX (0, 25, 50, 100, and 200 μM (B) on the viability of PC12 cells were determined by the MTT assay. The experiment was repeated three times, and the data are presented as the mean ± SD (n = 3). One-way ANOVA followed by Tukey’s HSD test was performed if the differences among groups were statistically significant. Compared to 0 μM H₂O₂ or 0 μM DEX, *P < 0.05, **P < 0.01, ***P < 0.005, ****P < 0.001.

Effects of DEX on miR-134 expression in H₂O₂-induced PC12 cells

Increasing H₂O₂ concentrations (0, 100, 200, 300, and 400 μM) gradually upregulated the expression of miR-134 in PC12 cells. However, treatment with 100 μM DEX significantly decreased the H₂O₂-mediated increase in the expression of miR-134 (all P < 0.05, Figure 2(A)). Compared to that in the miR-NC + H₂O₂ group, miR-134 expression in H₂O₂-induced PC12 cells was significantly decreased in the miR-134 inhibitor group (P < 0.001). In addition, miR-134 expression in PC12 cells was obviously higher in the mimic + DEX + H₂O₂ group than in the miR-NC + DEX + H₂O₂ group (P < 0.001, Figure 2(B)).

Figure 2.

Effects of DEX on miR-134 expression in H₂O₂-induced PC12 cells. Notes: (A) The effects of different concentrations of H₂O₂ (0, 100, 200, 300, and 400 μM) with/without 100 μM DEX on the expression of miR-134 in PC12 cells were detected by qRT-PCR compared to the same dose of H₂O₂ treatment (***P < 0.005, ****P < 0.001). (B) miR-134 expression in different groups of PC12 cells were detected by qRT-PCR (* compared to the control group, P < 0.05; # compared to the H₂O₂ group, P < 0.05; & compared to the DEX + H₂O₂ group, P < 0.05 @ compared to the miR-NC + H₂O₂ group, P < 0.05; % compared to the inhibitor + H₂O₂ group, P < 0.05; ˆ compared to the miR-NC + DEX + H₂O₂ group, P < 0.05). The experiment was repeated three times, and the data are presented as the mean ± SD (n = 3). One-way ANOVA followed by Tukey’s HSD test was performed if the differences among groups were statistically significant.

Effects of DEX-mediated miR-134 inhibition on oxidative stress in H₂O₂-induced PC12 cells

As shown in Figure 3, compared to that in control cells, oxidative stress was significantly increased in H₂O₂-induced PC12 cells, accompanied by increases in ROS levels (P < 0.05) and MDA content (P < 0.001). Conversely, compared to those in the H₂O₂ group, the oxidative stress levels in the DEX + H₂O₂ group (ROS: P < 0.05; MDA: P < 0.001) and the inhibitor + H₂O₂ group (ROS: P < 0.05; MDA: P < 0.001) were significantly decreased. However, the effects of DEX on the improvement of H₂O₂-induced oxidative stress in PC12 cells were significantly reversed by the miR-134 mimic (ROS: P < 0.05; MDA: P < 0.005). In addition, no significant differences were observed in the ROS levels and the MDA contents between the H₂O₂ group and the mimic + DEX + H₂O₂ group (all P > 0.05).

Figure 3.

Effects of DEX-mediated miR-134 inhibition on oxidative stress in H₂O₂-induced PC12 cells. Note: (A and B) Cells were stained with DCFH-DA and examined by flow cytometry (A), and the increment ratio of intracellular ROS in PC12 cells is shown in a bar graph (B); (C) Detection of MDA content in PC12 cells of each group. * Compared to the control group, P < 0.05; # compared to the H₂O₂ group, P < 0.05; & compared to the DEX + H₂O₂ group, P < 0.05; @ compared to the miR-NC + H₂O₂ group, P < 0.05; % compared to the inhibitor + H₂O₂ group, P < 0.05; ˆ compared to the miR-NC + DEX + H₂O₂ group, P < 0.05. The experiment was repeated three times, and the data are presented as the mean ± SD (n = 3). One-way ANOVA followed by Tukey’s HSD test was performed if the differences among the groups were statistically significant.

Effects of DEX-mediated miR-134 inhibition on the viability and apoptosis of H₂O₂-induced PC12 cells

The MTT assay showed that the decrease in H₂O₂-induced PC12 cell viability was reversed by DEX and the miR-134 inhibitor (all P < 0.005). However, viability was significantly decreased in the mimic + DEX + H₂O₂ group compared to the miR-NC + DEX + H₂O₂ group (P < 0.001, Figure 4(A)). Additionally, Annexin V-FITC/PI staining revealed that H₂O₂ significantly induced PC12 cell apoptosis, and the apoptosis rate was 39.50 ± 6.85%. However, when PC12 cells were co-treated with DEX and H₂O₂, the apoptosis rate was markedly reduced (38.80 ± 3.94% vs. 6.50 ± 0.47%, P < 0.001), while the apoptosis rate of PC12 cells in the mimic + DEX + H₂O₂ group was significantly higher than that in the DEX + H₂O₂ group (41.00 ± 5.87% vs. 8.90 ± 0.60%, P < 0.001, Figure 4(B) and (C)). Western blotting (Figure 5) demonstrated that the upregulated cleaved caspase-3 expression and the downregulated Bcl-2 expression in H₂O₂-induced PC12 cells was decreased and increased, respectively, with DEX and miR-134 inhibitor treatment (all P < 0.001). Compared to that in the DEX + H₂O₂ group, the expression of cleaved caspase-3 in PC12 cells of the mimic + DEX + H₂O₂ group was significantly upregulated, while the expression of Bcl-2 was significantly downregulated (all P < 0.001).

Figure 4.

Effects of DEX-mediated miR-134 inhibition on the viability and apoptosis of H₂O₂-induced PC12 cells. Notes: (A) PC12 cell viability in each group was evaluated by the MTT assay; (B and C) PC12 cell apoptosis in each group was assessed by Annexin V-FITC/PI staining. * Compared to the control group, P < 0.05; # compared to the H₂O₂ group, P < 0.05; & compared to the DEX + H₂O₂ group, P < 0.05; @ compared to the miR-NC + H₂O₂ group, P < 0.05; % compared to the inhibitor+ H₂O₂ group, P < 0.05; ˆ compared to the miR-NC + DEX + H₂O₂ group, P < 0.05. The experiment was repeated three times, and the data are presented as the mean ± SD (n = 3). One-way ANOVA followed by Tukey’s HSD test was performed if the differences among groups were statistically significant.

Figure 5.

Effects of DEX-mediated miR-134 inhibition on the expression of apoptosis-related proteins (cleaved caspase-3 and Bcl-2) in H₂O₂-induced PC12 cells evaluated by Western blotting. Notes: * compared to the control group, P < 0.05; # compared to the H₂O₂ group, P < 0.05; & compared to the DEX + H₂O₂ group, P < 0.05; @ compared to the miR-NC + H₂O₂ group, P < 0.05; % compared to the inhibitor + H₂O₂ group, P < 0.05; ˆ compared to the miR-NC + DEX + H₂O₂ group, P < 0.05. The experiment was repeated three times, and the data are presented as the mean ± SD (n = 3). One-way ANOVA followed by Tukey’s HSD test was performed if the differences among groups were statistically significant.

Effects of DEX-mediated miR-134 inhibition on inflammatory factors in H₂O₂-induced PC12 cells

The expression levels of inflammatory factors, including IL-1β, TNF-α, and IL-6, in PC12 cells (Figure 6) were quantified by qRT-PCR. The results showed that the expression levels of these factors were increased in H₂O₂-induced PC12 cells compared to control cells (all P < 0.001), while inflammation was significantly reduced after DEX or miR-134 inhibitor treatment, accompanied by declines in IL-1β, TNF-α, and IL-6 levels (all P < 0.001). Consistent with the above findings, the reduction effect of DEX on the abovementioned H₂O₂-induced inflammatory factors in PC12 cells was reversed by the miR-134 mimic (all P < 0.001).

Figure 6.

Effects of DEX-mediated miR-134 inhibition on inflammatory factors in H₂O₂-induced PC12 cells. Notes: The expression levels of the inflammatory factors IL-1β (A), TNF-α (B), and IL-6 (C) in PC12 cells measured by qRT-PCR. * Compared to the control group, P < 0.05; # compared to the H₂O₂ group, P < 0.05; & compared to the DEX + H₂O₂ group, P < 0.05; @ compared to the miR-NC + H₂O₂ group, P < 0.05; % compared to the inhibitor+ H₂O₂ group, P < 0.05; ˆ compared to the miR-NC + DEX + H₂O₂ group, P < 0.05. The experiment was repeated three times, and the data are presented as the mean ± SD (n = 3). One-way ANOVA followed by Tukey’s HSD test was performed if the differences among groups were statistically significant.

Discussion

In the current study, PC12 cells were exposed to different concentrations of H₂O₂ for 24 h, and cell viability was determined to be 50% in normal PC12 cells when the concentration of H₂O₂ was 300 μM, which was similar to a previous study that used the MTT assay.¹⁸ Therefore, 300 µM H₂O₂ was used to construct the oxidative damage model for subsequent experiments. A number of recent studies have shown that DEX exerts protective roles against ischemia, hypoxia, and ischemia reperfusion (I/R) damage in the myocardium, brain, and liver since it can inhibit the release of catecholamines, reduce the toxicity of excitatory amino acids, and inhibit neuronal apoptosis.^19–21 ROS are chemically reactive substances containing oxygen; their levels increase sharply in H₂O₂-induced PC12 cells, causing severe damage to the cell structure.²² MDA is the final product of membrane lipid peroxidation, and the content change is one of the major signs of plasma membrane damage.²³ In this study, PC12 cells showed high levels of oxidative stress after H₂O₂-induced damage, and the contents of ROS and MDA increased significantly, revealing that H₂O₂ causes severe oxidative stress damage in PC12 cells, which could be alleviated by DEX, as described previously.^18,24,25

MiR-134 (as member of the miR-379-410 cluster) regulates neuronal development, synaptic plasticity, and cognitive and social behaviors since it is a brain-specific miRNA with a crucial role in neurodevelopmental disorders.^26,27 In addition, miR-134 expression was significantly increased after experimental hypoxic-ischemic brain injury (HIBD) in rats and after oxygen-glucose deprivation (OGD) in PC12 cells, which was in line with the current findings.²⁸ Moreover, PC12 cells were protected by HIF-1α overexpression from oxygen-glucose deprivation/reoxygenation (OGD/R)-induced damage by downregulating the miR-134 level.²⁹ In this study, H₂O₂-induced PC12 cell damage was significantly improved by a miR-134 inhibitor, accompanied by increased cell viability.

Some studies have shown that the expression of miRNAs in PC12 cells is affected by DEX. For example, Xue et al. indicated that the proliferation, migration, and invasion of PC12 cells are promoted and that cell apoptosis is inhibited with DEX treatment via upregulation of miR-381 expression.³⁰ Wu et al. stated that oxidative damage in PC12 cells was inhibited by DEX by regulating the miR-199a/HIF-1α content.¹⁷ Furthermore, DEX exerted neuroprotective effects on PC12 cells under high glucose by regulating the miR-125b-5p/VDR axis.³¹ Accumulating evidence suggests that oxidative stress induces inflammation and tissue damage. Notably, after LPS treatment, the levels of miR-134, IL-1β, and TNF-α were significantly increased in the hippocampus and cortex but decreased after DEX treatment, indicating that miR-134 is a marker of neuroinflammation.¹⁴ Additionally, H₂O₂ was found to stimulate the production of IL-1β, TNF-α, and IL-6 in NGF-differentiated PC12 cells.³² Similarly, the study showed that the H₂O₂-mediated increase in miR-134 expression was decreased by DEX, accompanied by decreases in IL-1β, TNF-α, and IL-6 levels. These phenomena indicated that H₂O₂-induced oxidative stress damage in PC12 cells is improved by DEX-mediated miR-134 inhibition; consequently, inflammation is inhibited.

Cell apoptosis is a type of cell death resulting from oxidative stress damage.³³ Reportedly, oxidative stress damage and/or apoptosis in various organs, such as the lung, kidney, intestine, and hippocampus, can be prevented by DEX pretreatment.^34,35 Mitochondria are the main proapoptotic targets of excessive ROS production, which can induce the opening of mitochondrial double-layer membrane permeable pores, release calcium ions, cytochrome C, and apoptosis-inducing factor (AIF), activate caspase-3 and caspase-9, decouple the mitochondrial electron transport chain, decrease ATP production, upregulate the expression of the proapoptotic protein Bax, downregulate the expression of the antiapoptotic protein Bcl-2, and ultimately rupture the outer mitochondrial membrane, leading to cell apoptosis.^36,37 In this study, qRT-PCR revealed that DEX alleviates H₂O₂-induced PC12 cell apoptosis, downregulates the expression of cleaved caspase-3, and upregulates the expression of Bcl-2.^31,34,38 Furthermore, this phenomenon could be reversed by the overexpression of miR-134, and HIBD pathology in neonatal rats and OGD-induced neuronal death in PC12 cells could be prevented by miR-134 inhibition.²⁸ Thus, these results indicate that H₂O₂-induced PC12 cell apoptosis can be inhibited by DEX by reducing miR-134 levels. There are two major limitations in our study. First, although PC12 cells are widely used as a neuronal model to investigate hypoxia-mediated neurotoxicity, these cells are not real nerve cells. Therefore, further work focusing on primary neurons will be necessary to verify the protective effects of DEX. Second, in vivo experiments in animal models are needed to confirm whether miR-134 inhibition can enhance the anti-apoptotic, anti-inflammatory and anti-oxidative effects of DEX.

In summary, with increasing H₂O₂ concentration (0, 100, 200, 300, and 400 μM), miR-134 expression in PC12 cells was upregulated gradually and decreased significantly after 100 μM DEX treatment. Moreover, DEX exerted a protective effect against hypoxia-induced damage in PC12 cells by inhibiting miR-134 expression.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

C-A Wu

References

Zhao

Sheng

Wang

, et al. Astrocyte-derived extracellular vesicles: a double-edged sword in central nervous system disorders. Neurosci Biobehav Rev 2021; 125: 148–159.

Vitale

Foss

. Immune-Mediated central nervous system disease-current knowledge and recommendations. Top Companion Anim Med 2019; 34: 22–29.

Schmidt

Gan

Komander

, et al. Ubiquitin signalling in neurodegeneration: mechanisms and therapeutic opportunities. Cell Death Differ 2021; 28: 570–590.

Golub

Reddy

. Cannabidiol therapy for refractory epilepsy and seizure disorders. Adv Exp Med Biol 2021; 1264: 93–110.

Ahn

Macpherson

PCD

, et al. Transgenic expression of SOD1 specifically in neurons of Sod1 deficient mice prevents defects in muscle mitochondrial function and calcium handling. Free Radic Biol Med 2021; 165: 299–311.

Borisov

Siletsky

Nastasi

, et al. ROS Defense systems and terminal oxidases in bacteria. Antioxidants 2021; 10(6): 839.

Gage

Thippeswamy

. Inhibitors of Src family kinases, inducible nitric oxide synthase, and NADPH Oxidase as Potential CNS drug targets for neurological diseases. CNS Drugs 2021; 35: 1–20.

Goloshvili

Barbakadze

Mikeladze

. Sodium nitroprusside induces H-Ras depalmitoylation and alters the cellular response to hypoxia in differentiated and undifferentiated PC12 cells. Cell Biochem Funct 2019; 37: 545–552.

Khurana

Peng

McDonald

, et al. Phenylethanolamine N-methyltransferase gene expression in PC12 cells exposed to intermittent hypoxia. Neurosci Lett 2018; 666: 169–174.

10.

. Effectiveness in block by dexmedetomidine of hyperpolarization-activated cation current, independent of its agonistic effect on alpha2-adrenergic receptors. Int J Mol Sci 2020; 21(23):9110.

11.

Zhao

, et al. Mechanisms of dexmedetomidine in neuropathic pain. Front Neurosci 2020; 14: 330.

12.

Fang

Yan

, et al. Dexmedetomidine-up-regulated microRNA-381 exerts anti-inflammatory effects in rats with cerebral ischaemic injury via the transcriptional factor IRF4. J Cell Mol Med 2021; 25: 2098–2109.

13.

Guo

, et al. Up-regulation of miRNA-151-3p enhanced the neuroprotective effect of dexmedetomidine against beta-amyloid by targeting DAPK-1 and TP53. Exp Mol Pathol 2021; 118: 104587.

14.

Paeschke

von Haefen

Endesfelder

, et al. Dexmedetomidine prevents lipopolysaccharide-induced MicroRNA expression in the adult rat brain. Int J Mol Sci 2017; 18(9): 1830.

15.

Baby

Alagappan

Dheen

, et al. MicroRNA-134-5p inhibition rescues long-term plasticity and synaptic tagging/capture in an Abeta(1-42)-induced model of Alzheimer’s disease. Aging Cell 2020; 19: e13046.

16.

Koo

Lee

Chung

, et al. A water extract of Curcuma longa L. (Zingiberaceae) rescues PC12 cell death caused by pyrogallol or hypoxia/reoxygenation and attenuates hydrogen peroxide induced injury in PC12 cells. Life Sci 2004; 75: 2363–2375.

17.

Kong

. Dexmedetomidine protects PC12 cells from oxidative damage through regulation of miR-199a/HIF-1alpha. Artif Cells Nanomed Biotechnol 2020; 48: 506–514.

18.

Kushairi

Phan

Sabaratnam

, et al. Comparative neuroprotective, anti-inflammatory and neurite outgrowth activities of extracts of king oyster Mushroom, Pleurotus eryngii (Agaricomycetes). Int J Med Mushrooms 2020; 22: 1171–1181.

19.

Zhou

Liu

Wang

, et al. microRNA-129-5p involved in the neuroprotective effect of dexmedetomidine on hypoxic-ischemic brain injury by targeting COL3A1 through the Wnt/beta-catenin signaling pathway in neonatal rats. J Cell Biochem 2018. DOI: 10.1002/jcb.26704. Online ahead of print.

20.

Kuyrukluyildiz

Onk

, et al. The effect of dexmedetomidine on gastric ischemia reperfusion injury in rats. Biochemical and histopathological evaluation. Acta Cir Bras 2021; 36: e360104.

21.

Tang

Gao

, et al. Dexmedetomidine pretreatment attenuates myocardial ischemia reperfusion induced acute kidney injury and endoplasmic reticulum stress in human and rat. Life Sci 2020; 257: 118004.

22.

Nakayama

Nakahara

Matsugi

, et al. Protective effect of ferulic acid against hydrogen peroxide induced apoptosis in PC12 Cells. Molecules 2020; 26(1): 90.

23.

Disasa

Cheng

Manzoor

, et al. Amarogentin from gentiana rigescens franch exhibits antiaging and neuroprotective effects through antioxidative stress. Oxid Med Cell Longev 2020; 2020: 3184019.

24.

Pan

Sun

Zhang

, et al. Structure, antioxidant property and protection on PC12 of a polysaccharide isolated and screened from Abelmoschus esculentus L.Moench (okra). Nat Prod Res 2021: 1–7. DOI: 10.1080/14786419.2021.1887867.

25.

Jalili-Baleh

Nadri

Forootanfar

, et al. Chromone-lipoic acid conjugate: Neuroprotective agent having acceptable butyrylcholinesterase inhibition, antioxidant and copper-chelation activities. Daru 2021. DOI: 10.1007/s40199-020-00378-1.

26.

Krug

Wohr

Seffer

, et al. Advanced paternal age as a risk factor for neurodevelopmental disorders: a translational study. Mol Autism 2020; 11: 54.

27.

Bicker

Lackinger

Weiss

, et al. MicroRNA-132, -134, and -138: a microRNA troika rules in neuronal dendrites. Cell Mol Life Sci 2014; 71: 3987–4005.

28.

Chen

Zhang

Zhao

, et al. C/EBPalpha-mediated transcriptional activation of miR-134-5p entails KPNA3 inhibition and modulates focal hypoxic-ischemic brain damage in neonatal rats. Brain Res Bull 2020; 164: 350–360.

29.

Zhang

Liu

Yang

, et al. Overexpression of HIF-1alpha protects PC12 cells against OGD/R-evoked injury by reducing miR-134 expression. Cell Cycle 2020; 19: 990–999.

30.

Xue

Jiang

. Dexmedetomidine protects PC12 cells from ropivacaine injury through miR-381/LRRC4/SDF-1/CXCR4 signaling pathway. Regen Ther 2020; 14: 322–329.

31.

Hou

Zhang

, et al. Dexmedetomidine exerts neuroprotective effects during high glucose-induced neural injury by inhibiting miR-125b. Biosci Rep 2020; 40(6): BSR20200394.

32.

Yang

Mong

, et al. Gynura bicolor aqueous extract attenuated H₂O₂ induced injury in PC12 cells. Biomedicine (Taipei) 2019; 9: 12.

33.

Pomara

Neri

Bello

, et al. Neurotoxicity by synthetic androgen steroids: oxidative stress, apoptosis, and neuropathology: a review. Curr Neuropharmacol 2015; 13: 132–145.

34.

Liu

Wang

Yang

, et al. Effects and mechanism of dexmedetomidine on neuronal cell injury induced by hypoxia-ischemia. BMC Anesthesiol 2017; 17: 117.

35.

Dardalas

Stamoula

Rigopoulos

, et al. Dexmedetomidine effects in different experimental sepsis in vivo models. Eur J Pharmacol 2019; 856: 172401.

36.

Mollazadeh

Tavana

Fanni

, et al. Effects of statins on mitochondrial pathways. J Cachexia Sarcopenia Muscle 2021; 12(2):237–251.

37.

Mei

Zhao

. Sepsis and Cerebral Dysfunction: BBB Damage, Neuroinflammation, Oxidative Stress, apoptosis and autophagy as key mediators and the potential therapeutic approaches. Neurotox Res 2021; 39: 489–503.

38.

Zhang

Guo

, et al. Dexmedetomidine attenuates glutamate-induced cytotoxicity by inhibiting the mitochondrial-mediated apoptotic pathway. Med Sci Monit 2020; 26: e922139.

Protective effect of dexmedetomidine on neuronal hypoxic injury through inhibition of miR-134

Abstract

Objective:

Methods:

Results:

Conclusion:

Keywords

Introduction

Materials and methods

Cell culture

Cell grouping

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Western blotting

Fluorescein isothiocyanate (FITC)-annexin/propidium iodide (PI) staining

Detection of the oxidative stress index

Statistical analysis

Results

Effects of H2O2 and DEX on the viability of PC12 cells

Effects of DEX on miR-134 expression in H2O2-induced PC12 cells

Effects of DEX-mediated miR-134 inhibition on oxidative stress in H2O2-induced PC12 cells

Effects of DEX-mediated miR-134 inhibition on the viability and apoptosis of H2O2-induced PC12 cells

Effects of DEX-mediated miR-134 inhibition on inflammatory factors in H2O2-induced PC12 cells

Discussion

Footnotes

Declaration of conflicting interests

Funding

ORCID iD

References

Effects of H₂O₂ and DEX on the viability of PC12 cells

Effects of DEX on miR-134 expression in H₂O₂-induced PC12 cells

Effects of DEX-mediated miR-134 inhibition on oxidative stress in H₂O₂-induced PC12 cells

Effects of DEX-mediated miR-134 inhibition on the viability and apoptosis of H₂O₂-induced PC12 cells

Effects of DEX-mediated miR-134 inhibition on inflammatory factors in H₂O₂-induced PC12 cells