Sage Journals: Discover world-class research

Abstract

Glioblastoma multiforme (GBM) is one of the most aggressive astrocytic tumors; it is resistant to most chemotherapeutic agents currently available and is associated with a poor patient survival. Thus, the development of new anticancer compounds is urgently required. Herein, we studied the molecular mechanisms of cell death induced by the experimental drugs resveratrol and MG132 or the antineoplastic drugs cisplatin and etoposide on a human GBM cell line (D54) and on primary cultured mouse astrocytes (PCMAs). Caspases, Bcl-2, inhibitors of apoptosis proteins (IAP) family members, and p53 were identified as potential molecular targets for these drugs. All drugs had a cytotoxic effect on D54 cells and PCMAs, with a similar inhibitory concentration (IC₅₀) after 24 h. However, MG132 and cisplatin were more effective to induce apoptosis and autophagy than resveratrol and etoposide. Cell death by apoptosis involved the activation of caspases-3/7, -8, and -9, increased lysosomal permeability, LC3 lipidation, poly-(ADP-ribose) polymerase (PARP)-1 fragmentation, and a differential expression of genes related with apoptosis and autophagy like Mcl-1, Survivin, Noxa, LC3, and Beclin. In addition, apoptosis activation was partially dependent on p53 activation. Since experimental and antineoplastic drugs yielded similar results, further work is required to justify their use in clinical protocols.

Keywords

Glioblastoma antineoplastic drugs resveratrol MG132 apoptosis autophagy p53

Introduction

Glioblastoma multiforme (GBM) is the most common, yet incurable, type of brain tumor. GBM, usually a heterogeneous population of cells, is highly infiltrative, angiogenic, and resistant to standard chemotherapy.¹ The current treatment consists of surgical resection, radiotherapy, and chemotherapy with the alkylating agent temozolomide; however, the overall survival rate is low.² Thus, the development of novel chemotherapeutic drugs for GBM treatment is much needed to improve the prognosis of these patients.

New drugs with antitumor properties are being evaluated for GBM treatment, including resveratrol and MG132. Resveratrol (3,5,4′-trihydroxystilbene) is a plant-derived phytoalexin,³ while proteasome inhibitors such as MG132 (Z-Leu-Leu-Leu-CHO) are emerging as a new class of anticancer agents.⁴ Several reports suggest that both compounds have a cytotoxic effect on GBM, inducing apoptosis through caspase activation and autophagy.^4

–11 However, further studies are required to determine its mechanism of action and identify the key molecules involved in cell death, such as p53. p53 is a tumor-suppressor protein that regulates deoxyribonucleic acid (DNA) repair, metabolism, and cell death; its activity is induced by DNA damage or cellular stress.¹² Some reports suggest that p53 could play an important role in apoptosis induction by resveratrol in GBM cell lines.^9,13,14

For years, toxic drugs like cisplatin and etoposide have been used in cancer treatment. Cisplatin (cis-diamminedichloroplatinum II) is a cross-linking agent that binds purine bases in DNA. Cisplatin is widely used against solid tumors.¹⁵ On the other hand, etoposide is a topoisomerase II inhibitor, often given as a first-line treatment against solid tumors in combination with other drugs.¹⁶ In several GBM cell lines, both antineoplastic drugs have been shown to inhibit proliferation and induce apoptosis and autophagy.^17

– 23

This work is aimed to investigate the molecular mechanisms underlying the activation of apoptosis and autophagy by the experimental drugs resveratrol and MG132 or the antineoplastic drugs currently used for solid tumor treatment, cisplatin and etoposide. The cytotoxic and proapoptotic effects of these drugs were assessed in a human GBM cell line and in nontumoral mouse astrocytes. In addition, we identified potential targets of these agents, such as caspases, Bcl-2 or IAP family members, and p53.

Materials and methods

Reagents

Dulbecco’s modified Eagle’s medium (DMEM; high-glucose and l-glutamine), modified Eagle’s medium (MEM) vitamin solution (100×), antibiotic–antimycotic, Trizol reagent, and moloney murine leukemia virus (M-MLV) reverse transcriptase were purchased from Invitrogen (Carlsbad, California, USA). MG132 was acquired from Calbiochem Millipore (San Diego, California, USA), dissolved in dimethyl sulfoxide (DMSO), and stored at −20°C until used. Resveratrol, cisplatin, etoposide, acridine orange (AO), poly-d-lysine, pifithrin α (PFT-α), mouse monoclonal anti-β-actin-peroxidase antibody, and goat-antimouse horseradish peroxidase (HRP)-conjugated IgG were purchased from Sigma-Aldrich (St Louis, Missouri, USA). Resveratrol, cisplatin, and etoposide were dissolved in 70% ethanol, water, and DMSO, respectively. Dissolution was performed according to the manufacturer’s instructions. Cell Titer 96^® AQ_ueous One Solution and caspase-Glo 3/7, 8, or 9 kits were purchased from Promega (Madison, Wisconsin, USA). Maxima SYBR green/ROX quantitative polymerase chain reaction (qPCR) Master Mix and SuperSignal West Femto Maximum Sensitivity were acquired from Thermo Scientific (Foster City, California, USA). X-ray films were obtained from Kodak (Rochester, New York, USA). Anti-p53 HRP-conjugated human antibody was obtained from Santa Cruz Biotechnology (Dallas, Texas, USA); antihuman LC3A/B and PARP-1 were obtained from Cell Signaling (Danvers, Massachusetts, USA).

Cell culture

The human glioblastoma cell line D54 was cultured in DMEM supplemented with 10% fetal bovine serum and 1× antibiotic–antimycotic (10,000 units of penicillin, 10 mg of streptomycin, and 25 μg of amphotericin B) at 37°C under a 5% CO₂ atmosphere. A primary culture of mouse astrocytes (PCMAs) was obtained from Balb/c neonatal mice.²⁴ All experimental procedures on animals were performed in accordance with applicable institutional guidelines. The culture was previously characterized by the expression of the glial fibrillary acidic protein (GFAP) protein.²⁴ Briefly, mouse brains were removed under sterile conditions and placed in Hank’s solution, followed by mechanical and enzymatic disaggregation with 0.1% trypsin and 0.1% DNAse type I, under agitation, for 10 min at 37°C. Astrocytes were washed by centrifugation and resuspended in DMEM supplemented with 10% fetal bovine serum, MEM vitamin solution 10×, and antibiotic–antimycotic. Astrocytes were grown in Petri dishes pretreated overnight with 0.5 mg/mL of poly-d-lysine.

Cytotoxic effect of experimental and anti-neoplastic drugs

To determine the IC₅₀ of the drugs under study, either D54 cells or PCMAs were seeded at a density of 10,000 cells/well in a 96-well plate and cultured in the presence of different concentrations of resveratrol (100, 250, or 500 µM), MG132 (20, 40, or 80 µM), cisplatin (20, 40, or 80 µM), or etoposide (50, 100, or 250 µM) for 24 or 48 h. Additionally, 70% of ethanol and DMSO were added to cell cultures in the same volume as the experimental or antineoplastic drugs as controls. Then, 20 μL/well of tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (Cell Titer 96^® AQ_ueous One Solution) was added to the plates and incubated for 2 h at 37°C under a 5% CO₂ atmosphere. To determine the cytotoxic effect of each drug, two absorbance measurements were performed at 490 and 690 nm using a microplate reader (LabSystems Multiskan, Thermo Scientific). MTS values were normalized and expressed as a percentage, with 100% viability corresponding to control (untreated) cells.

Detection of caspase-3/7, -8, and -9 activity

The cells were seeded at a density of 10,000 cells/well in a 96-well plate and treated with each of the drugs under study at the IC₅₀: resveratrol (100 µM), MG132 (40 µM), cisplatin (80 µM), or etoposide (250 µM for D54 cells or 100 µM for PCMAs) and incubated for 24 h; these concentrations were used in later experiments. To measure the activity of caspase-3/7, -8, and -9, 100 µL of Caspase-Glo reagent was added to each well. The plates were incubated at room temperature for 30 min, and the luminescence of each sample was measured in a GloMax plate-reading luminometer (GloMax, Promega).

Lysosome integrity assessment

D54 cells and PCMAs (600,000 cells/well) were incubated for 24 h in the presence of resveratrol, MG132, cisplatin, or etoposide at the IC₅₀. After detaching the cells with a trypsin solution (0.1% trypsin, 0.025% tetrasodium EDTA, 0.1% glucose), they were washed and collected by centrifugation at 2500 r/min for 5 min. Next, the cells were resuspended in Hank’s solution (140 mM NaCl, 27 mM KCl, 0.34 mM Na₂HPO₄, 0.44 mM KH₂PO₄, and 0.1% glucose) and incubated with 5 µg/mL of AO for 15 min at 37°C in the dark. The cells were washed with phosphate-buffered saline (PBS 1×), and 10,000 events were analyzed by flow cytometry in a FACS Aria II cytometer (BD Biosciences, San Jose, California, USA). The FACSdiva software (BD Biosciences) was used for data acquisition.

Real-time polymerase chain reaction

The cells were seeded at a density of 600,000 cells/well in a six-well plate and incubated with the drugs under study for 24 h. Total ribonucleic acid (RNA) was isolated with Trizol reagent following the manufacturer’s instructions. To obtain DNA-free RNA, total RNA was treated with RNAse-free DNAse-I (Thermo Scientific). Complementary DNA (cDNA) was synthetized using 1 µg of total RNA, 200 U of M-MLV reverse transcriptase, and 0.5 µg of oligo dT primer. The cDNA obtained was diluted 1:10, and 2 µL of each diluted cDNA product was used to perform real-time (RT) qPCR in a Maxima SYBR Green/ROX qPCR Master Mix, following the manufacturer’s instructions. To perform the qPCR, 5 pg of each primer was used. The 18S ribosomal gene was used to normalize the expression of antiapoptotic (Mcl-1 and Survivin), proapoptotic (Noxa), and autophagic genes (Beclin and LC3) in each sample (Table 1).²⁵ A Beclin mouse QuantiTect® primer assay (Qiagen, Germantown, Maryland, USA) was also performed. Reaction conditions for all genes were 10 min at 95°C, 40 cycles of 15 s at 95°C, and 60 s at 60°C. A melting curve analysis was conducted to determine the specificity of the amplification products and detect possible primer dimers. For each gene, a standard curve was plotted using fivefold dilutions. The efficiency of PCR amplification for the 18S ribosomal gene as well as for Mcl-1, Survivin, Beclin, LC3, and Noxa was calculated by the standard curve method, E10^(−1/slope) − 1. Data were analyzed using the equation: 2^−ΔΔCT.²⁶ All reactions were performed in a StepOne Plus Real-Time system (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

Table 1.

Primer sequences and RT-PCR conditions.

Primer	Sequence (5′→3′)	Reference/source
Mcl-1 h	F: AAACCAAGAAAGCTGCATCGA	Primer Express V3.0 software
Mcl-1 h	R: ACATTCCTGATGCCACCTTCTAG
Mcl-1 m	F: CATCGAACCATTAGCAGAAACTATCA
Mcl-1 m	R: GCAAAAGCCAGCAGCACATT
Survivin h	F: TCGGCTGTTCCTGAGAAATAAAA
Survivin h	R: CCAGGACGCTCATCCTCACT
Survivin m	F: CACTGCCCTACCGAGAACGA
Survivin m	R: TTCCATCTGCTTCTTGACAGTGA
Noxa h	F: CTGTGTGAAGAGCCCGATGT
Noxa h	R: TTAGGGCTGATCTCCCTGCT
Noxa m	F: CACGCGCTCCAGCTAGAATC
Noxa m	R: GAGAAGAAGCACAGCGCAGAGT
Beclin h	F: TGGCAGAAAATCTCGAGAAGGT
Beclin h	R: GGGCATAACGCATCTGGTTT
LC3 h	F: GGTCCACGATTTCTCTTCTGTTG	Primer Express V3.0 software
LC3 h	R: CAGTCAGACACAGGATAGAACAGGAT	Primer Express V3.0 software
LC3 m	F: CCCAC AAGATCCCAGTG AT	Ref. 26
LC3 m	R: CCAGGAACTTGGTCTTGTCCA	Ref. 26
18S h	F: GGCTACCACATCCAAGGAAG	Primer Express V3.0 software
18S h	R: TCCAATGGATCCTCGCGGAA
18S m	F: CGCCGCTAGAGGTGAAATTC
18S m	R: CCAGTCGGCATCGTTTATGG

h: human; m: mouse; F: forward; R: reverse; RT-PCR: real-time polymerase chain reaction.

Western blot

After treatment, the cells were detached and collected by centrifugation, as described above. The cells were lysed in radioimmunoprecipitation assay buffer (RIPA) buffer, as previously described.²² Fifty micrograms of total protein were separated through 10% and 15% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked for 1 h with 5% skimmed milk and incubated overnight at 4°C with anti-p53 HRP-conjugated human antibody (diluted 1:500 in PBS), antihuman LC3B (diluted 1:2000), or antihuman PARP-1 (diluted 1:2000). Immune complexes were visualized with the SuperSignal West Femto Maximum Sensitivity Substrate and recorded on X-ray film. Antimouse actin HRP-conjugated monoclonal antibody was used as a loading control. Antirabbit HRP-conjugated IgG (diluted 1:10 000) was used as a secondary antibody to detect LC3B or PARP-1 signals on Western blot film, which were densitometrically quantified with the ImageJ software (Java2HTML version 1.5). Densitometric values of the PARP-1, LC3B, or p53 proteins were normalized with respect to actin concentration in each sample. The target protein/actin ratio was normalized with respect to the vehicle (culture medium for cisplatin, DMSO for etoposide and MG132, and ethanol for resveratrol). The relative expression of control (untreated) cells or the respective solvent was set as 100%. The total relative expression of LC3B was determined as the sum of LC3B-I (16 kDa) plus LC3B-II (14 kDa); the sum of the relative density values for both bands was considered as 100%. This value was normalized with respect to actin concentration in the same sample (LC3/actin), as described above.

Statistical analysis

Data were analyzed with the software STATA version 14 (StataCorp, College Station, Texas, USA). One-way analysis of variance was performed to analyze differences between treatments and between cell types; p value <0.05 was considered as statistically significant. Bonferroni correction was used to correct the family-wise error by multiple comparisons.

Results

Experimental and antineoplastic drugs have similar cytotoxic effects on D54 cells and PCMAs

To compare the cytotoxic effect induced by resveratrol, MG132, and the antineoplastic compounds (cisplatin and etoposide), D54 cells and PCMAs were incubated in the presence of several drugs at various concentrations for 24 and 48 h. Experimental and antineoplastic compounds induced a statistically significant, dose-dependent cytotoxic effect in both cell types after 24 and 48 h of treatment (Figure 1). After 24 h, IC₅₀ was similar for both cell types treated with resveratrol (100 µM), MG132 (40 µM), or cisplatin (80 µM); in contrast, D54 cells were more resistant to etoposide than PCMAs (250 and 100 µM, respectively). The IC₅₀ after 24 h of treatment was used in later experiment.

Figure 1.

Cytotoxic effect of experimental and antineoplastic drugs. D54 cells or PCMAs were treated with various drugs at different concentrations for 24 or 48 h. Cell viability was determined with the MTS reagent. Viability percentage was normalized with respect to untreated control cells; all doses evaluated had a statistically significant cytotoxic effect. The charts show the mean result of three independent experiments, each one performed in duplicate ± SE, p < 0.05. PCMA: primary cultured mouse astrocytes; SE: standard error.

The four compounds are effective to induce a cytotoxic effect in GBM cells and PCMAs; however, in GBM, the experimental drugs MG132 and resveratrol were statistically different compared with antineoplastic drugs (MG132 versus etoposide and cisplatin, p < 0.01 or resveratrol versus cisplatin and etoposide, p < 0.001). In addition, MG132 had a cytotoxic effect at a lower dose than the other drugs.

Resveratrol, MG132 and antineoplastic drugs induce apoptotic cell death through intrinsic and extrinsic pathways

The possibility that experimental and antineoplastic drugs induced apoptosis through executor caspases-3 and-7, and either extrinsic or intrinsic pathway (caspase-8 and -9, respectively) was tested by treating cells with the drugs under study at the IC₅₀ for 24 h. The activity of each caspase was compared with appropriate controls. Even though resveratrol activates caspase-3/7, -8, and -9, no statistically significant differences in the activity of any caspase were observed in D54 cells (Figure 2(a)). Cisplatin, etoposide, and MG132 were the main activators of caspase-3/7 in these cells (3.7-, 3.5-, and 2.9-fold increase, respectively). The four drugs induced the activity of this caspase in PCMAs; however, MG132 was the primary activator of this protein (14.4-fold increase, Figure 2(a)), followed by cisplatin.

Figure 2.

Effect of experimental and antineoplastic drugs on apoptosis induction through caspase-8, caspase-9, and caspase-3/7 activity in D54 cells and PCMAs. (a) Cells were incubated with the drugs at the IC₅₀ for each drug for 24 h. Control treatment with DMSO or ethanol was included. Caspase activity was measured using Caspase-Glo kits. The charts show the mean result of three independent experiments ± SE, p < 0.05. Statistically significant differences between controls and treatments for each cell type are marked with an asterisk (*), whereas significant differences between cell types are marked with (**). (b) Western blot of a representative experiment of PARP-1 fragmentation (89 kDa) induced by experimental or antineoplastic drugs. (c) PARP-1 expression was densitometrically quantified, as described in “Materials and methods” section. PCMA: primary cultured mouse astrocytes; SE: standard error; PARP: poly-(ADP-ribose) polymerase; DMSO: dimethyl sulfoxide.

On the other hand, cisplatin was the most effective inductor of caspase-8 activity (2.3-fold increase) in D54 cells, while MG132 and cisplatin were the primary activators of this caspase in PCMAs (8.1- and 5.8-fold increase, respectively). Similarly, cisplatin was the most active inducer of caspase-9 in D54 cells (2.5-fold increase). PCMAs showed a fivefold increase in the activation of this caspase after treatment with cisplatin and MG132. In D54 cells, resveratrol failed to significantly activate any caspase. The effectiveness of MG132, etoposide, and cisplatin to activate caspase-3/7 was similar, while cisplatin mainly activated caspase-8 and caspase-9. In PCMAs, MG132 was the chief inductor of the extrinsic and intrinsic apoptosis pathways, followed by cisplatin and etoposide. In PCMAs and D54 cells, resveratrol had the lowest effect among all tested drugs.

PARP-1 (a 116-kDa nuclear poly-ADP-ribose polymerase) participates in DNA repair and maintains cell viability. PARP is a target of caspase-3. The activation of caspase-3 cleavages the PARP amino-terminal domain (24 kDa) from the carboxy-terminal domain (89 kDa).²⁷

In D54 cells, no significant increase in the concentration of the 89-kDa fragment of PARP-1 was observed after treatment with etoposide, cisplatin, resveratrol, nor MG132 (Figure 2(b) and (c)). The complete 116-kDa PARP-1 protein was not detected in this work.

Experimental and antineoplastic drugs induced autophagy in D54 cells and PCMAs

To determine whether other types of cell death were activated in D54 cells or PCMAs by the drugs under study, the activation of autophagy was assessed through the permeability of lysosomal membranes by flow cytometry. In D54 cells, all drugs induced lower levels of autophagy cell death with respect to apoptosis. MG132 was the most active autophagy inducer (4.8-fold increase with respect to untreated control cells), followed by resveratrol and cisplatin (3.4- and 3.1-fold increase, respectively, Figure 3(a) and (b)). Likewise, the chief inducer of changes in the permeability of lysosomal membranes in PCMAs was also MG132 (13-fold increase), followed by cisplatin and resveratrol (5.2- and 4.6-fold increase, respectively). No change in the permeability of lysosomal membranes was observed in the control, DMSO, or ethanol groups in either cell type. In addition, resveratrol, MG132, and etoposide induced lipidation of the cellular autophagy marker LC3BI to LC3BII in D54 cells (Figure 3(b) and (c)).

Figure 3.

Induction of autophagy in D54 cells or PCMAs by experimental or antineoplastic drugs. (a) After 24 h of treatment, the cells were stained with acridine orange and analyzed by flow cytometry. A representative histogram is shown for each cell type. (b) The chart shows the mean result of three independent experiments ± SE, p < 0.05. Statistically significant differences between control and drugs for each cell type are indicated with an asterisk (*), whereas significant differences between cell types are marked with (**). (c) Representative Western blot for the lipidated LC3B protein in D54 cells. The image shows a representative film. (d) LC3B expression was densitometrically quantified, as indicated above. The chart shows the mean result of three independent experiments ± SE, p < 0.05. Significant differences between treatments are marked with (*). PCMA: primary cultured mouse astrocytes; SE: standard error.

These results indicate that MG132 was the most effective lysosomal permeability inductor in PCMAs and D54 cells, whereas resveratrol, MG132, and etoposide were similarly effective to induce LC3B lipidation.

Differential expression of apoptosis- and autophagy-related genes induced by experimental or antineoplastic drugs in D54 cells and PCMAs

To identify whether apoptosis- or autophagy-related genes were induced by treatments, qPCR assays were performed. In D54 cells, resveratrol, MG132, and etoposide tripled the levels of Mcl-1 messenger RNA (mRNA) (an antiapoptotic gene, Figure 4(a)). Additionally, an increase in the expression of the Survivin gene (an antiapoptotic gene) was observed in cells treated with cisplatin, while the mRNA levels of Noxa (a proapoptotic gene) were slightly increased after treatment with resveratrol and etoposide. On the other hand, the expression levels of the autophagy-related genes LC3 and Beclin were increased in cells treated with MG132 (10- and 1.6-fold increase).

Figure 4.

Effect of experimental and antineoplastic drugs on the expression of apoptosis and autophagy-related genes. mRNA levels of cell death-related genes were determined by RT-qPCR after 24 h of treatment. Relative expression was calculated by the 2^−ΔΔCT method. (a) D54 cell line and (b) PCMAs. The mean result of three independent experiments ± SE, p < 0.05, is shown. Statistically significant differences between treatments and the control group for each cell type are marked with an asterisk (*). mRNA: messenger ribonucleic acid; PCMA: primary cultured mouse astrocytes; SE: standard error; RT-qPCR: real-time quantitative polymerase chain reaction.

In PCMAs, cisplatin was the primary inducer of Mcl-1 mRNA expression (2.5-fold increase). Cisplatin also increased the expression of the autophagy-involved genes LC3 and Beclin (3.4- and 1.6-fold increase, respectively) but failed to change the levels of Survivin mRNA. In addition, etoposide and MG132 induced a remarkable increase in the expression of Noxa mRNA (247- and 49-fold increase, respectively). Both experimental and antineoplastic drugs induced a differential expression of apoptosis- and autophagy-related genes in D54 and PCMAs.

P53 activation by experimental and antineoplastic drugs in D54 cells

The p53 tumor-suppressor protein is a master regulator of several cellular functions, including apoptosis. To determine whether cellular stress caused by the antineoplastic or experimental drugs induced the expression of p53, a Western blot analysis was performed. A statistically significant increase in p53 levels was observed in D54 cells treated with resveratrol, etoposide, and MG132 (2.8-, 3-, and 2.5-fold, respectively) with respect to control cells (p < 0.01; Figure 5(a) and (b)). As expected, no increase in the levels of the p53 protein was observed in cells treated with DMSO or ethanol.

Figure 5.

Role of p53 in apoptosis induction by experimental or antineoplastic drugs. D54 cells were treated with the drugs under study for 24 h. (a) Representative Western blot of p53 expression. (b) p53 expression was densitometrically quantified, as indicated above. (c) The cells were cultivated either with or without pifithrin-α (10 µM) 2 h before drug treatment and then incubated for 24 h. Caspase-3/7 activity was measured, as described in “Materials and methods” section. The chart shows the mean result of three independent experiments ± SE, p < 0.01 (p53 expression) or p > 0.001 (p53 activation). Statistically significant differences are marked with an asterisk (*). SE: standard error.

To determine whether the increased levels of the p53 protein play a relevant role in apoptosis induction in cells treated with the drugs under study, cells were incubated with PFT-α, a reversible inhibitor of p53-mediated apoptosis, and the activity of caspase-3/7 was evaluated as an indicator of apoptosis. A decrease in caspase-3/7 activity was observed in cells pretreated with PFT-α for 2 h with respect to resveratrol-, MG132-, cisplatin-, and etoposide-treated cells (1.4, 3.4-, 2.5- and 2.2-fold decrease, respectively) with no PFT-α pretreatment (Figure 5(c)) indicating that p53 activation is partially involved in apoptosis induction (p > 0.001).

Discussion

In this work, we investigated the molecular mechanisms underlying the activation of cell death by apoptosis and autophagy by experimental drugs (resveratrol and MG132) or antineoplastic drugs currently used to treat solid tumors, such as cisplatin and etoposide. These drugs showed a cytotoxic effect on human glioblastoma D54 cells and on nontumoral mouse astrocytes. Experimental and antineoplastic drugs induced apoptosis and autophagy as measured by the activation of caspase-3/7, -8, and -9, the increase in lysosomal permeability, LC3 lipidation, PARP-1 fragmentation, and differential expression of apoptosis and autophagy-related genes. In addition, apoptosis was found to be partially dependent on p53 activity.

The four drugs used in this work were chosen because they have different molecular targets and some are more toxic than others. The doses of these drugs were established taking as reference different concentrations reported in the literature in glioblastoma cell lines, which were used to perform dose–response curve assays on D54 glioblastoma cell line. In addition, to determine whether the cytotoxic effect of these drugs was specific to D54 cells, we carried out the same experiments on PCMAs.

We found that experimental and antineoplastic drugs induced a dose-dependent cytotoxic effect in both cell types. Resveratrol, MG132, and cisplatin were found to have the same IC₅₀ in D54 and PCMAs. Furthermore, MG132 produced a strong cytotoxic effect using a lower concentration than the other drugs. In contrast, D54 cells were more resistant to etoposide.

Some authors found different IC₅₀ values than those reported in this study. These differences may be due to the cell lines used (U87, A172, T98G, U138MG, and U373), the incubation period, and the methods used to assess cytotoxicity. In most reports, dose values for experimental or antineoplastic drugs used in in vitro cytotoxic assays on GBM or glioma cell lines were in the range from 1 µM to 100 µM, and treatments lasted from 24 h to 72 h.^{4,7,9,10,18,20,23} However, these drugs have only been evaluated on rat or mouse primary culture astrocytes, with results dissimilar to those reported in this study.^10,28

The effect of resveratrol and MG132 has been evaluated in tumoral and nontumoral cells. Resveratrol inhibited cell proliferation in normal and transformed rat hepatocytes, with no differences between both cell types.²⁹ On the other hand, it has been proposed that MG132 could have a synergistic action, enhancing the cytotoxic effect of death ligands in hepatocellular carcinoma cells but not in nontumoral primary human hepatocytes.³⁰

These drugs have also been administered by the intraperitoneal, intravenous, or intratumor route in in vivo assays: cisplatin, 0.05, 1.5–3, and 7 mg/kg^31
–33; etoposide, 3, 4, 80, 160, and 320 mg/kg^34
–36; and resveratrol, 15, 25, and 50 mg/kg.^37

–39 These drugs reduced tumor volume but failed to improve mouse survival. Nevertheless, there is no evidence that MG132 has been evaluated in vivo.

To determine whether drug cytotoxicity was due to apoptosis, the activity of caspases-3/7, -8, and -9 was measured. In D54 cells, resveratrol did not significantly activate any caspase, so its cytotoxic mechanism may not involve apoptosis, at least under the conditions of this study. The other drugs induced apoptosis, mainly cisplatin was the most efficient activating both extrinsic and intrinsic apoptosis pathways. In PCMAs, both experimental and antineoplastic drugs also induced apoptosis. MG132 caused a strong caspase-mediated apoptosis, followed by cisplatin and etoposide. Contrary to D54 cells, resveratrol induced a low but significant caspase-3/7 activation in PCMAs, suggesting no downregulation in the activity of this pathway compared with reported in some tumoral cell lines.

Using different drug concentrations and other GBM cell lines, previous studies have demonstrated that resveratrol, MG132, cisplatin, and etoposide induce caspase-3/7 activity.^{8
–10,18,19,21,23} Additionally, an increase in caspase-8 activity induced by MG132 in the U87MG cell line has been reported.⁶ The cleavage of caspase-9 has been reported in rat primary culture astrocytes.⁴⁰ However, no previous evidence had been reported of caspase-8 or -9 activation induced by experimental or antineoplastic drugs in D54 cells. To our knowledge, these results suggest for the first time that resveratrol, MG132, cisplatin, and etoposide induce apoptosis through both intrinsic and extrinsic pathways in nontumoral PCMAs.

Caspase-3/7 induces proteolytic breakdown of PARP-1. PARP-1 is involved in key cellular processes, such as DNA replication, cell proliferation, and apoptosis.⁴⁰ We evaluated PARP-1 fragmentation in D54 cells treated with experimental or antineoplastic drugs and found increased levels of the 89-kDa PARP-1 fragment, chiefly induced by resveratrol and MG132, suggesting that these compounds are capable of activating apoptosis. There are no previous reports of PARP-1 fragmentation during apoptosis in D54 cells caused by any of the experimental or antineoplastic drugs evaluated in this study.

In D54 cells, we found that resveratrol induced PARP-1 fragmentation but did not activate caspase-3/7. This could be explained by the activation of other caspases besides the caspase-3/7 executor; alternatively, other proteases such as caspase-1 may be involved in PARP-1 cleavage during apoptosis.^27,41,42

To determine if transcription is a mechanism required in apoptosis induction, we analyzed the changes in the expression of genes related to apoptosis and autophagy. In D54 cells, resveratrol and etoposide induced the expression of Noxa, but only cisplatin induced the expression of Survivin mRNA. Resveratrol, MG132, and etoposide increased the levels of Mcl-1 mRNA, while MG132 was the most active inducer of LC3 and Beclin expression. In PCMAs, the highest increase in the levels of Noxa mRNA was observed after treatment with etoposide. Cisplatin increased the expression of Mcl-1, LC3, and Beclin mRNA. This differential expression of genes could be due because the drugs have different cell targets. These results suggest that induction of proapoptotic and proautophagic genes is required for the cytotoxic effect of the drugs studied in D54 cells and PCMAs. Previously, only one study has reported the failure of etoposide to change the expression of Survivin mRNA in the GBM U251 cell line.²²

In order to assess if the cytotoxic effect of these compounds was due to the induction of other types of death in addition to apoptosis, we evaluated autophagy cell death. All drugs analyzed induced it, most notably, MG132; this compound increased lysosomal permeability in D54 cells, an event that coincided with the increased expression of the LC3 and Beclin genes and lipidation of the LC3BI protein to generate LC3BII. Nevertheless, PCMAs were more sensitive to lysosomal permeability caused by MG132 than D54 cells. Also, in PCMAs, resveratrol and cisplatin were equally effective to induce this type of cell death, while etoposide had the least effect. In this work, LC3B lipidation was not analyzed in PCMAs.

In agreement with our results, other studies have found autophagy induction in response to resveratrol and etoposide in the U251MG, U87, and GBM9 cell lines,^7,18,43 suggesting that autophagy is induced in glioblastoma cell lines by these compounds. Additionally, lipidation of the LC3BI protein to LC3BII or an increase in the expression of the Beclin protein was reported in U87 and U373 cell lines treated with the experimental or antineoplastic drugs herein studied.^6,8,18,44,45

The p53 protein regulates several cell physiological events, including cell death. We evaluated the expression of this protein as a possible player in the response to the cytotoxic effects of antineoplastic or experimental drugs. The D54 cell line has a basal level of p53 expression. The experimental and antineoplastic drugs herein evaluated were equally effective to induce the expression of p53. An increase in the levels of the p53 protein in response to etoposide in D54 cells was previously reported.⁴⁶ Other authors found that resveratrol, cisplatin, and etoposide also induced p53 expression in the U87, A172, U343, and T98G GBM cell lines, as well as in rat astrocyte primary cultures.^{9,14,17,18,23,37,47} However, our study is the first one to demonstrate the induction of p53 by MG132 in D54 cells.

Furthermore, we found that p53 plays an important role in the induction of apoptosis by experimental or antineoplastic drugs, as shown by the decrease in the activity of caspase-3/7 by 20–50% in cells treated with these drugs after exposure to PFT-α, a reversible p53 inhibitor. Unfortunately, no experimental evidence is available about other master genes (like p53) that regulates apoptosis or autophagy pathways. Our results suggest that p53 is partially involved in the apoptotic cell death induced by the experimental and antineoplastic drugs.

Conclusions

The four compounds were equally effective to induce a cytotoxic effect on a GBM cell line and on PCMAs. MG132 was more effective to induce cell death by apoptosis and autophagy. The main mechanism of action for cisplatin was apoptosis induction. In contrast, resveratrol failed to activate any type of cell death. Etoposide was as effective as cisplatin to activate caspase-3/7, and it induced LC3B lipidation in a similar extent to MG132. The molecular mechanisms of apoptosis and autophagy induction involved the participation of players, such as caspase-3/7, -8, and -9, LC3B, Beclin, Noxa, and the p53 protein. Finally, our results suggest that the experimental drugs, resveratrol and MG132, are similarly effective as the antineoplastic drugs, cisplatin and etoposide.

Footnotes

Acknowledgements

The D54 cell line was kindly donated by Dr Alfonso Dueñas of the Instituto de Investigaciones Biomédicas, UNAM. The authors thank the Red Temática Farmoquímicos (CONACYT, #294727) for their support in the English editing of this manuscript.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported in part by grants from CONACyT (168896) and FOSISS (261875) to JD-C.

ORCID iD

A Lagunas-Martínez

References

Stavrovskaya

Shushanov

Rybalkina

. Problems of glioblastoma multiforme drug resistance. Biochemistry (Mosc) 2016; 81: 91–100.

Polivka

Holubec

, et al. Advances in experimental targeted therapy and immunotherapy for patients with glioblastoma multiforme. Anticancer Res 2017; 37: 21–33.

Kulkarni

Cantó

. The molecular targets of resveratrol. Biochim Biophys Acta 2015; 1852: 1114–1123.

Zanotto-Filho

Braganhol

Battastini

, et al. Proteasome inhibitor MG132 induces selective apoptosis in glioblastoma cells through inhibition of PI3K/Akt and NFkappa B pathways, mitochondrial dysfunction, and activation of p38-JNK1/2 signaling. Invest New Drugs 2012; 30: 2252–2262.

Shu

Wang

, et al. Diffusion efficiency and bioavailability of resveratrol ddministered to rat Brain by different routes: therapeutic implications. Neurotherapeutics 2015; 12: 491–501.

Zeng

Zhang

Fan

, et al. p62/SQSTM1 is involved in caspase-8 associated cell death induced by proteasome inhibitor MG132 in U87MG cells. Cell Biol Int 2014; 38: 1221–1226.

Filippi-Chiela

Thomé

Bueno e Silva

, et al. Resveratrol abrogates the temozolomide-induced G2 arrest leading to mitotic catastrophe and reinforces the temozolomide-induced senescence in glioma cells. BMC Cancer 2013; 13: 147.

Filippi-Chiela

Villodre

Zamin

, et al. Autophagy interplay with apoptosis and cell cycle regulation in the growth inhibiting effect of resveratrol in glioma cells. PLoS One 2011; 6: e20849.

Lin

Xiong

Zhang

, et al. Notch-1 activation-dependent p53 restoration contributes to resveratrol-induced apoptosis in glioblastoma cells. Oncol Rep 2011; 26: 925–930.

10.

Zanotto-Filho

Braganhol

Battastini

11.

Zanotto-Filho

Braganhol

Schröder

, et al. NFκB inhibitors induce cell death in glioblastomas. Biochem Pharmacol 2011; 81: 412–424.

12.

Min

, et al. Molecular dynamic simulation insights into the normal state and restoration of p53 function. Int J Mol Sci 2012; 13: 9709–9740.

13.

Liu

Jiao

, et al. Resveratrol sensitizes glioblastoma-initiating cells to temozolomide by inducing cell apoptosis and promoting differentiation. Oncol Rep 2016; 35: 343–351.

14.

Sato

Okada

Shibuya

, et al. Resveratrol promotes proteasome-dependent degradation of Nanog via p53 activation and induces differentiation of glioma stem cells. Stem Cell Res 2013; 11: 601–610.

15.

Dasari

Tchounwou

. Cisplatin in cancer therapy: molecular mechanisms of action. Eur J Pharmacol 2014; 740: 364–378.

16.

Najar

Johri

. Pharmaceutical and pharmacological approaches for bioavailability enhancement of etoposide. J Biosci 2014; 39: 139–144.

17.

Carminati

Donaires

Marques

, et al. Cisplatin associated with LY294002 increases cytotoxicity and induces changes in transcript profiles of glioblastoma cells. Mol Biol Rep 2014; 41: 165–177.

18.

Biasoli

Kahn

Cornélio

, et al. Retinoblastoma protein regulates the crosstalk between autophagy and apoptosis, and favors glioblastoma resistance to etoposide. Cell Death Dis 2013; 4: e767.

19.

Chen

Sun

Yang

, et al. Cisplatin enhanced sensitivity of glioblastoma multiforme U251 cells to adenovirus-delivered TRAIL in vitro. Tumour Biol 2010; 31: 613–622.

20.

Taghavi

Akbarzadeh

Mahdian

, et al. Cisplatin downregulates BCL2L12, a novel apoptosis-related gene, in glioblastoma cells. In Vitro Cell Dev Biol Anim 2013; 49: 465–472.

21.

Liu

, et al. Synergistic suppression of noscapine and conventional chemotherapeutics on human glioblastoma cell growth. Acta Pharmacol Sin 2013; 34: 930–938.

22.

Jin

Zhao

Guo

, et al. Influence of etoposide on anti-apoptotic and multidrug resistance-associated protein genes in CD133 positive U251 glioblastoma stem-like cells. Brain Res 2010; 1336: 103–111.

23.

Park

Kwak

, et al. Induction of p53-mediated apoptosis and recovery of chemosensitivity through p53 transduction in human glioblastoma cells by cisplatin. Int J Oncol 2006; 28: 119–125.

24.

Contreras-Ochoa

Lagunas-Martínez

Belkind-Gerson

, et al. Toxoplasma gondii invasion and replication within neonate mouse astrocytes and changes in apoptosis related molecules. Exp Parasitol 2013; 134: 256–265.

25.

Scherz-Shouval

Weidberg

Gonen

, et al. p53-dependent regulation of autophagy protein LC3 supports cancer cell survival under prolonged starvation. Proc Natl Acad Sci USA 2010; 107: 18511–18516.

26.

Schmittgen

Livak

. Analyzing real-time PCR data by the comparative C (T) method. Nat Protocol 2008; 3: 1101–1108.

27.

Chaitanya

Steven

Babu

. PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration. Cell Commun Signal 2010; 8: 31.

28.

Ruan

, et al. Resveratrol differentially modulates inflammatory responses of microglia and astrocytes. J Neuroinflammation 2010; 7: 1–14.

29.

Rubiolo

López-Alonso

Martín-Vázquez

, et al. Resveratrol inhibits proliferation of primary rat hepatocytes in G0/G1 by inhibiting DNA synthesis. Folia Biol (Praha) 2012; 58: 166–172.

30.

Ganten

Koschny

Haas

, et al. Proteasome inhibition sensitizes hepatocellular carcinoma cells, but not human hepatocytes, to TRAIL. Hepatology 2005; 42: 588–597.

31.

Coluccia

Figueiredo

, et al. Enhancing glioblastoma treatment using cisplatin-gold-nanoparticle conjugates and targeted delivery with magnetic resonance-guided focused ultrasound. Nanomedicine 2018; 14: 1137–1148.

32.

Zhang

Yang

, et al. Angelica polysaccharides inhibit the growth and promote the apoptosis of U251 glioma cells in vitro and in vivo. Phytomedicine 2017; 33: 21–27.

33.

Redjal

Zhu

Shah

. Combination of systemic chemotherapy with local stem cell delivered S-TRAIL in resected brain tumors. Stem Cells 2015; 33: 101–110.

34.

Bello

Carrabba

Giussani

, et al. Low-dose chemotherapy combined with an antiangiogenic drug reduces human glioma growth in vivo. Cancer Res 2001; 61: 7501–7506.

35.

Cheema

Kanai

Kim

, et al. Enhanced antitumor efficacy of low dose etoposide with oncolytic herpes simplex virus in human glioblastoma stem cell xenografts. Clin Cancer Res 2011; 17: 7383–7393.

36.

Smith

Rahman

Clarke

, et al. Surgical delivery of drug releasing poly (lactic-co-glycolic acid)/poly(ethylene glycol) paste with in vivo effects against glioblastoma. Ann R Coll Surg Eng 2014; 96: 495–501.

37.

Clark

Bhattacharya

Elmayan

, et al. Resveratrol targeting of AKT and p53 in glioblastoma and glioblastoma stem-like cells to suppress growth and infiltration. J Neurosurg 2017; 126: 1448–1460.

38.

Shu

Wang

, et al. Diffusion efficiency and bioavailability of resveratrol administered to rat brain by different routes: therapeutic implications. Neurotherapeutics 2015; 12: 491–501.

39.

Guo

Jia

, et al. Transferrin modified PEG-PLA-resveratrol conjugates: in vitro and in vivo studies for glioma. Eur J Pharmacol 2013; 718: 41–47.

40.

Goldbaum

Vollmer

Richter-Landsberg

. Proteasome inhibition by MG-132 induces apoptotic cell death and mitochondrial dysfunction in cultured rat brain oligodendrocytes but not in astrocytes. Glia 2006; 53: 891–901.

41.

Soldani

Scovassi

. Poly (ADP-ribose) polymerase-1 cleavage during apoptosis: an update. Apoptosis 2002; 7: 321–328.

42.

Germain

Affar

D’Amours

, et al. Cleavage of auto modified poly (ADP-ribose) polymerase during apoptosis. Evidence for involvement of caspase-7. J Biol Chem 1999; 274: 28379–28384.

43.

Zanotto-Filho

Braganhol

Klafke

, et al. Autophagy inhibition improves the efficacy of curcumin/temozolomide combination therapy in glioblastomas. Cancer Lett 2015; 358: 220–231.

44.

Liu

Sun

Wang

, et al. Knockdown of retinoblastoma protein may sensitize glioma cells to cisplatin through inhibition of autophagy. Neurosci Lett 2016; 620: 137–142.

45.

Xue

Xiao-Hong

Lin

, et al. Lumbar puncture-administered resveratrol inhibits STAT3 activation, enhancing autophagy and apoptosis in orthotopic rat glioblastomas. Oncotarget 2016; 7: 75790–75799.

46.

Kim

Blake

Baek

, et al. Inhibition of histone deacetylase increases cytotoxicity to anticancer drugs targeting DNA. Cancer Res 2003; 63: 7291–7300.

47.

Meley

Spiller

White

, et al. p53-mediated delayed NF-κB activity enhances etoposide-induced cell death in medulloblastoma. Cell Death Dis 2010; 1: e41.

Molecular mechanisms of cell death induced in glioblastoma by experimental and antineoplastic drugs: New and old drugs induce apoptosis in glioblastoma

Abstract

Keywords

Introduction

Materials and methods

Reagents

Cell culture

Cytotoxic effect of experimental and anti-neoplastic drugs

Detection of caspase-3/7, -8, and -9 activity

Lysosome integrity assessment

Real-time polymerase chain reaction

Western blot

Statistical analysis

Results

Experimental and antineoplastic drugs have similar cytotoxic effects on D54 cells and PCMAs

Resveratrol, MG132 and antineoplastic drugs induce apoptotic cell death through intrinsic and extrinsic pathways

Experimental and antineoplastic drugs induced autophagy in D54 cells and PCMAs

Differential expression of apoptosis- and autophagy-related genes induced by experimental or antineoplastic drugs in D54 cells and PCMAs

P53 activation by experimental and antineoplastic drugs in D54 cells

Discussion

Conclusions

Footnotes

Acknowledgements

Declaration of conflicting interests

Funding

ORCID iD

References