Evaluation of nephrotoxic effects of aristolochic acid on zebrafish ( Danio rerio ) larvae

Abstract

To analyze the toxic effects of aristolochic acid (AA) on developed kidneys in zebrafish larvae, zebrafish at 3 days postfertilization were treated with various concentrations of AA for 24 h before the status of kidney injury was investigated from several points of view. It was found that 21% of the larvae treated with 10 µmoL/L AA exhibited evident periocular edema. When the concentrations of AA were increased to 20 and 40 µmoL/L, defect in the cardiovascular system characterized by slow heart beat and blood flow was seen coupled with periocular edema. Creatinine in the whole larval tissue determined by liquid chromatography–mass spectrometry/mass spectrometry exhibited dramatic increase in the treated groups in a dose-dependent manner within a certain range of doses. Several evident protein bands were detected by sodium dodecyl sulfate–polyacrylamide gel electrophoresis in supernatant of the treated larvae, indicating leakage of glomerular filtration barrier. Results of quantitative polymerase chain reaction show that the messenger RNA expression of nephrin in the 20 and 40 µmoL/L AA-treated groups decreased to 0.58 ± 0.062 and 0.37 ± 0.075-folds of the control, respectively. Kidney damage was further confirmed by the histological changes in paraffin sections of treated larvae, for example, cystic glomeruli and disorganized epithelia cells of pronephric tubules. Our results revealed that AA exerted toxic effects on developed kidney of zebrafish larvae in a dose-dependent manner and podocyte dysfunction may be involved in the kidney injury and proteinuria.

Introduction

Aristolochic acid (AA) is primarily found as a natural product in the Aristolochia or Asarum. All these plants had been extensively used as herbs in medical therapies for arthritis, gout, and festering wounds. ¹ However, AA is found to be toxic to kidney because patients who have taken the herbs containing AA displayed nephropathy pathologies. As a result, all plants containing AA have been banned from being used as herb medicines. The AA exposure studies in a number of animal models also suggest that AA have toxic effects on organs. ^2,3 Among them, the renal damage is the most evident, and primary phenotypic changes were seen as a result of AA exposure.

The zebrafish is a very popular model for evaluating the toxic effect of xenobiotics on tissue development and organ function. Due to its transparency, the malformation of zebrafish embryo is easy to be observed. The generation of so many tissue-specific transgenic zebrafish lines makes it possible to study the resulting subtle changes in the tissue. Published studies have shown that AA induces teratogenicity during early embryonic nephron ⁴ and cardia ⁵ development in a zebrafish model. Ding further concluded that the kidney may be more sensitive to AA toxic injury than the heart by comparing the expression of specific genes of kidney and heart in fish. Either way, evidence suggests that AA treatment leads to defect both in kidney and in heart of developing zebrafish embryos.

Zebrafish is not only an ideal model in developmental biology research but also for the examination of organ toxicity. Although there are certain advantages with phenotypic observation methodology in zebrafish research, other analytical methodologies, for example, biochemical and molecular biological approaches are also widely used for zebrafish larvae. In AA-induced kidney damage, the change of metabolites in larvae, especially the biomarkers that are closely related to the renal function remain unidentified. In an attempt to shed light on potential clinical biomarkers for AA-induced organ toxicity, we explored the nephrotoxic effects of AA on zebrafish larvae in developed kidney in this study. We have observed that both the change of the creatinine level in zebrafish tissue and the symptom of proteinuria are specific indicators usually examined in hospital for renal disease diagnosis.

Materials and methods

Zebrafish husbandry

AB strain zebrafish were maintained at 28°C with a photoperiod of 14 h light and 10 h dark in an aquarium supplied with fresh water and aeration. Artemia is provided twice at 9:00 h and 16:00 h every day. Male and female adult zebrafish were set up in a breeding tank separated by a mesh screen the night before breeding. The next morning zebrafish lay eggs soon after the light is turned on. Normally fertilized embryos were selected and kept in standard E3 water (“egg water”; 5 mmol/L sodium chloride, 0.17 mmol/L potassium chloride, 0.33 mmol/L calcium chloride, 0.33 mmol/L magnesium chloride, and 10⁻⁵% methylene blue) ⁶ buffered with 2 mmol/L HEPES 2-[4-(2-Hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (Sigma, St Louis, Missouri, USA) until the kidney is completely developed.

Preparation and treatment of chemicals

Aristolochic acid I (AA; Sigma, C₁₇H₁₁NO₇, molecular weight 341.27 g/mol) was dissolved in dimethyl sulfoxide (DMSO) at an appropriate concentration. The zebrafish larvae at 3 days postfertilization (dpf) were collected, randomly divided into several groups, before exposed to water with AA at desired concentrations or water with DMSO only (mock-treated control). All larvae were incubated in six-well cell culture plates (30 larvae/cell in 6 mL of solution) at 28°C for 24 h. For each concentration group, at least three parallel replicates were performed. Phenotype of all larvae was examined with light microscopy, and percentage of malformed larvae was calculated. Larvae were then collected and subjected to the following experiments after the exposure treatments.

Metabolite extraction

The protocol for metabolite extraction was adapted from the work of Wu et al. ⁷ Equal number of alive larvae from each group were collected, washed for approximately 3 to 5 times with double-distilled water, and snap-frozen in liquid nitrogen after as much liquid medium as possible was drawn off. Before homogenization, 400 µL of biotech-grade cold methanol, 1 µL of cimetidine stock solution (3 µg/mL) and 124 µL of cold double-distilled water were added to form a methanol/water ratio of 3.2:1. These were homogenized in tube for 2 min after 15 ceramic beads were added. The homogenates were then transferred to glass vials, and the rest of the extraction procedure were proceeded as illustrated by Wu et al. Upper polar layer was carefully removed into a clean tube and dried down with a concentrator by blowing nitrogen gas into the tube at 55°C. The dried down extracts were then stored at −70°C until ready for liquid chromatography–mass spectrometry/mass spectrometry (LC-MS/MS) analysis.

LC-MS/MS analysis

The dried down extracts were resuspended in pure water (100 µL/50 larvae) and diluted 10 times before LC-MS/MS analysis. All samples were analyzed using a Thermo Accela liquid chromatograph (Thermo Fisher Scientific, Waltham, Massachusetts, USA), coupled with a Thermo TSQ Vantage triple quadruple mass spectrometer equipped with a TurboIonSpray electrospray ionization (ESI) source. ESI was operated in a positive mode with the following settings: spray voltage 3 kV and source temperature 350°C. Gas used was nitrogen. Scan mode was single reaction monitoring (SRM). The SRM transitions monitored were m/z 114→44 and m/z 114→79 for creatinine and m/z 253→95 and m/z 253→117 for cimetidine. Column integrity and resolution were maintained by including a wash step of 100% methanol for 1 h after every 20 samples and at the end of sample analysis.

We used a VP-ODS column (Shimadzu, Japan; 250 × 4.6 mm², 5.0 µm particle size), with a flow rate of 1 mL/min at ambient temperature. Gradient elution was performed with different ratio of methanol (solvent A) and water (solvent B) as mobile phase. Before use, the solvents were filtered through 0.45 µm pore size filters and degassed by sonication. Aliquots of the extraction samples were injected into LC-MS/MS system. Instrument was interfaced to a computer running Applied Biosystems Analyst Software (version 1.5).

Detection of proteinuria in zebrafish larvae

The protocol from Mao et al. ⁸ was used to assess the amount of proteinuria in zebrafish larvae. Larvae after treatment in control and AA group were collected and kept in wells with 6 mL of medium water for 24 h at 28.5°C. At 5 dpf, 4 mL of medium water were harvested and mixed gently with 1 mL of 100% trichloroacetic acid solution and kept at 4°C for 1 h. The samples were then centrifuged at 13,000 r/min at 4°C for 5 min and supernatant was removed. The pellets were washed with cold acetone and centrifuged at 13,000 r/min at 4°C for 5 min twice. After drying the pellets at room temperature, 2 µL of distilled water and 8 µL of 5× loading buffer were added and bathed in boiled water for 5 min. For sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), the samples were applied to 6% Bis-Tris (Beyotime, Shanghai, CN) divided gels. Then the gels were stained with Coomassie brilliant blue (CBB) protein staining solution and examined for the presence of protein by mass spectrum.

Histological analysis of the zebrafish kidney

For paraffin kidney section, the larvae after exposure were fixed in Bouin’s solution for a night and then pre-embedded in 1.5% agar. The paraffin-embedded larvae in agar were prepared according to the conventional methods of paraffin section and sectioned into a 5 µm thickness. Specimens were mounted on superfrost glass slides and stained with hematoxylin and eosin. Histopathology was conducted by an Olympus BX40 and an Olympus DP25 camera system (Japan).

Quantitative reverse transcription polymerase chain reaction

Thirty larvae after treated with either medium water or AA solution were subjected to total RNA extraction with TRIZOL reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. Three independent experiments were conducted. Around 1 µg of the total RNA were used to generate complementary DNAs with SuperScriptTM III Reverse Transcriptase (Invitrogen, Carlsbad, CA). The real-time polymerase chain reaction (PCR) were performed under the following conditions: 30 s at 95°C and 40 cycles of 5 s at 95°C, 40 s at 60°C (fluorescence acquisition) using 2× Power SYBR Green PCR Master Mix (Superarray) in 20 µL reaction volume and 200 nm of the following primer sets:

Nephrin: F: 5′ GACCAGACCTCCGTTACTC 3′, R: 5′ AGGATCACCACCACATAGAC 3′

β-actin: F: 5′ TCCCCTTGTTCACAATAACC 3′, R: 5′ TCTGTGGCTTTGGGATTC A 3′

β-Actin was used as reference gene. The geometric mean of C_q value from β-actin was deducted from the corresponding C_q value of the target gene as ΔC_q. The ΔΔC_q value was calculated based on C_q(treatment) − C_q(control). The value of 2^−C_q was used to represent the relative gene expression.

Statistical analysis

An independent samples t-test with a significance level of 0.05 was employed to identify significant changes between the treatment and control samples (in studies testing the creatinine level in larvae by LC-MS/MS and studies employing the comparative C_q method for nephrin genes). Mortality of the treatment groups and the control were compared by χ² test.

Results

Effects of AA on the morphology and viability of zebrafish larvae

Zebrafish larvae has provided a useful model for study on nephrotoxicity of compounds because the pronephros with functional maturation has been formed as early as 3 dpf stage. In this study, zebrafish larvae at the stage of 3 dpf were exposed to various concentrations of AA for 24 h, and then the morphology and viability were examined under microscope. As shown in Figure 1(b), 21% of larvae exposed to 10 µmol/L AA for 24 h exhibited evident periocular edema without other malformed phenotypes being found. As AA concentration increased to 20 and 40 µmol/L, a larger number of larvae displayed defective phenotypes in cardiovascular system coupled with periocular edema, characterized by slow heart beat and blood flow (Figure 1(c)). Not surprisingly, in some severe cases, we observed heart failure, slow blood flow, and blockage in trunk arterial and small vessels in the tail and body internodes. At 24 h, the difference in mortality between the mock control and each AA-treated group was not significant.

Figure 1.

(a) Morphology of control larvae (4 dpf). (b) Morphology of larvae showed periocular edema after treatment with 10 μmol/L AA for 24 h. The arrow indicates periocular edema. **: P < 0.05.

To further investigate the developmental pattern of nephrotoxicity along with time, one half of the larvae were treated for 48 h continuously, and the other half were transferred to water medium for another 24 h after 24 h of AA treatment and the survival rate were calculated. As shown in Figure 1(d), a large number of AA-treated larvae died when the exposure time was extended to 48 h and the mortality was significantly higher than that treated for 24 h. Notably, the death of larvae after 24 h of treatment cannot be completely prevented even after they were transferred to blank medium. The mortality of the group after 24 h exposure plus 24 h fresh medium was significantly higher than that treated for 24 h only but significantly lower than the group treated for 48 h continuously.

LC-MS/MS analysis of creatinine in larvae tissue

The dried extraction sample was resolved with water, and 5 µL of solution was injected into the LC-MS/MS system. Figure 1(a) shows that the retention time of creatinine and cimetidine was 3.53 min and 7.09 min, respectively. No significant interfering peaks were observed at the retention time (Figure 2(a)). As the original volume of cimetidine added was identical, the ratio of the creatinine peak area in the chromatograms to that of cimetidine was calculated as the relative content of creatinine. The ratio displayed an upward tendency as the AA concentration rose from 10 to 20 µmol/L and the increase was significant compared with the control group. However, in those larvae exposed to 40 µmoL/L AA for 24 h, the peak area ratio of creatinine to cimetidine did not increase further. It instead exhibited a slightly lower value in comparison with that of larvae exposed to 20 µmol/L AA nevertheless, still significantly higher than the control group (Figure 2(b)).

Figure 2.

(a) Chromatogram of creatinine and cimetidine in extraction sample. (b) The relative content of creatinine based on the ratio of the creatinine peak area in chromatograms to that of cimetidine was compared in histogram. *:P < 0.05 and **:P < 0.01, compared with control group.

Proteinuria in zebrafish larvae caused by AA exposure

To further examine the AA-induced damage on kidney, we assayed the glomerular filtration barrier function by comparing the proteins contained in the supernatant of incubation medium for the AA-treated larvae and control. The proteins in the supernatant were examined with SDS-PAGE electrophoresis and CBB staining. In contrast to the absence of any evident proteins in the incubation supernatant of the control, a thick and evident protein band with molecular weight close to bovine serum albumin (77 kDa) was seen in the incubation supernatant of 20 µmol/L and 40 µmol/L AA-treated larvae. In addition, another slightly lighter protein band with larger molecular weights approximately between 100 and 130 kDa and a weak protein band with smaller molecular weights approximately between 55 and 77 kDa were also present in the gel. In the incubation supernatant of 10 µmol/L AA-treated larvae, a very light protein band may just be visible with a molecular weight of approximately 77 kDa (Figure 3). The obtained result confirmed the existence of proteinuria in zebrafish larvae exposed to AA.

Figure 3.

Proteinuria in condensed incubation medium of zebrafish larvae after various concentrations of AA treatment. BSA: bovine serum albumin.

Histological examination of zebrafish larvae kidney

To validate the kidney structural damage caused by AA treatment, we further examined the histology of kidney phenotype. In the paraffin sections stained with hematoxylin/eosin solutions under the microscope, we could see that the pronephros of control group larvae were composed of glomeruli with well-organized and compact structure and pronephric tubules circled by a single layer of epithelial cells. However, the larvae treated with 20 µmol/L of AA apparently displayed cystic glomeruli and disorganized pronephric tubules (Figure 4). The obtained result indicated the presence of the structural damage of nephros caused by AA treatment.

Figure 4.

Transverse histological sections of wild-type AB larvae at 4 dpf (a) and zebrafish larvae treated with various concentrations of AA (b and c). Transverse paraffin sections (5 μm) were obtained from 4 dpf zebrafish larvae and further stained with hematoxylin and eosin. Enlarged figures of glomeruli area (d, e, and f) and pronephric tubules (j, h, and i) are derived from (a, b, and c). Arrows indicate the location of cyst. Scale bar are 25 μm and 12 μm in (a to c) and (d to i), respectively.

Quantitative reverse transcription PCR

To further investigate the molecular mechanisms of severe proteinuria caused by AA in zebrafish larvae, we examined the expression level of nephrin transcript, which is known to play an important role in the maintenance of glomerular filtration barrier function, in AA-treated zebrafish larvae with quantitative real-time PCR (qPCR). The results showed that the expression level of nephrin messenger RNA (mRNA) in AA-treated larvae decreased by 0.58 ± 0.062 and 0.37 ± 0.075-folds in 20 and 40 µmol/L AA-treated larvae, respectively, compared with that in the mock control (Figure 5). These results suggest that AA-induced nephrotoxicity may be associated with defective podocyte function.

Figure 5.

Quantitative real-time polymerase chain reaction (qPCR) analysis for the expression levels of nephrin between mock-control and AA-treated larvae. Values were expressed as means ± SEM from the three independent experiments. In each experiment 30 larvae at 3 days postfertilization were used for every treatment group. **:P < 0.01, compared with control group.

Discussion

In the course of vertebrate evolution, three distinct kidneys with increasing complexity have generated: the pronephros, mesonephros, and metanephros. ⁹ The pronephros is the first kidney to form during embryogenesis. For zebrafish, the pronephros is the functional kidney of early larval life and will be replaced by a mesonephro later in juvenile stage and adult fish. ¹⁰ Despite some differences in organ morphology and structure between the pronephros and mesonephros, many common elements at cellular and molecular level exist in the three kinds of kidneys. ¹¹ The pronephros have possessed some complex biological functions that are similar with mesonephros and metanephros. ¹² Furthermore, zebrafish often show similar physiological and pathological response to the effect of toxic compounds and many viewpoints summarized from the experiments based on zebrafish model could be applied to the human. The zebrafish pronephros has proved to be a useful model in the research of nephron development, glomerular function, and the interaction of cardiovascular system and kidney.

At 12 hours postfertilization (hpf) zebrafish nephrogenesis begins with the specification of the mesodermal cells to the nephric lineage, ¹³ and the glomerular filtration has been observed as early as 48 hpf. ¹⁴ The nephrogenesis can be completed at 72 hpf when zebrafish larvae hatched from chorion in the water. ¹⁵ During the first week of development, zebrafish larvae mainly rely on their kidneys to clear surplus fluid and metabolic waste products from their bodies, as the gills are not yet fully developed. ¹⁶ It is of unique advantage to study the toxic effects of compound on kidney function using 3 dpf larvae.

As our results showed, zebrafish larvae at 3 dpf exhibited evident periocular edema after treatment with 10 µmol/L of AA for24 h. It is well established that edema is one of the common symptoms of kidney disease. As the concentration of AA was increased, not only periocular edema but also cardiovascular abnormalities appeared, characterized by slow heart beat and blood flow. Previous studies have shown that AA treatment led to the malformation of heart and kidney in embryonic zebrafish. ^12,17 On the other hand, we also know that the kidney and heart, two most important organs in body, are tightly linked in function and can interact in pathologic course. Heart failure can play an important role in inducing kidney damage and vice versa. So far, it is still puzzling whether the cardiovascular symptoms were the direct result of the toxic effect of AA or following after the functional defect of the kidney. It is necessary to distinguish the mode of action of AA at various concentrations using appropriate approaches.

Our data also show that the toxic effect of AA on larvae phenotype is dose dependent. While the mortality between of the AA-treated group and control were not significantly different at 24 h of exposure, a massive larvae death was observed after 48 h exposure to AA. The death momentum could not be reversed even after larvae have been transferred to blank medium for another 24 h. Based on this observation, we can conclude that exposure time is one of important factors affecting the mortality of larvae and the injury in kidney caused by AA is irreversible. Exposure for 24 h is sufficient to trigger the damage, although it takes longer to observe the toxic end point. This is consistent with the pathogenic pattern of AA-induced kidney disease in clinic.

Recently, zebrafish embryo has been widely adopted as a valuable vertebrate model system for kidney research, including the study of developmental nephrotoxicity and podocyte biology. Some methodologies, for example, phenotypic and histological examination, and molecular biology have been used for investigating kidney injury and evaluating kidney function. Glomerular filtration rate, a direct indicator of kidney function, was evaluated by injecting high-molecular-weight fluorescein isothiocyanate dextran into blood circulation to monitor Glomerular filtration barrier leakage in zebrafish. However, this method is labor-intensive if applied to high-throughput screening because it involves microinjection and imaging. Although tremendous progress has been made over the past in nephrotic study, the dynamics of the metabolites in larvae zebrafish, especially some specific biomarkers closely related to kidney function remain unclear. Creatinine, a metabolite of phosphocreatine in muscle movement and excreted completely through kidney, is usually examined in hospital as a renal specific biomarker in renal disease diagnosis. However, it is almost impracticable to obtain enough blood or urine for detection of creatinine in zebrafish larvae. To confirm the kidney injury, creatinine level in the whole larval tissue after AA treatment was determined by LC-MS/MS. Here, we used cimetidine, a histamine H2 receptor antagonist as an internal standard material to calculate the creatinine content. ¹⁸ The results demonstrate that the content of creatinine in larval tissue increased after exposure to AA for 24 h. The creatinine elevation is dose dependent within a certain dosage range (10 and 20 µmol/L). The dose-dependent pattern was not observed at those larvae exposed to high concentration of AA (40 µmol/L). The high-dose AA may already cause severe toxic effects toward multiple target organs including kidney and heart, which in turn impacted upon fish movement and caused reduced metabolism. In support of this interpretation, we have seen the larvae exposed to high dose exhibited weak heart beating and almost blocked blood circulation. Our results support that the increase of creatinine level in larvae was the result of the kidney damage caused by AA.

The primary barrier for ultrafiltration of plasma in renal glomeruli is composed of three layers: glomerular endothelial cells, glomerular basement membranes (GBM), and podocyte foot processes covering the GBM. ¹⁹ Normally, the renal glomeruli produce an ultrafiltrate of plasma that is remarkably free of proteins continuously every day. Proteinuria has been recognized as a hallmark of renal disease. It is now acknowledged that the abnormalities of the glomerular podocyte are major factors in the development of proteinuria. The continuous structure that span the filtration slits between the interdigitating foot processes of adjacent podocytes, called slit-diaphragms, plays a crucial role in preventing the loss of circulating macromolecules into the urine. Most current evidence indicates that proteinuria, particularly albuminuria, is a result of loss of integrity of the slit diaphragm. Studies have demonstrated that nephrin, encoded by NPHS1 gene, is a functionally important component of the podocyte slit-diaphragm and appears to be a major structural component of the slit-diaphragm, either alone or by interaction with other proteins. ²⁰ Reduced expression of nephrin at both the mRNA and protein level has been observed in acquired proteinuric diseases, such as experimental diabetic nephropathy ²¹ and puromycin aminonucleoside nephrosis (PAN) model in the rat. ²² The results from these glomerular disease models showed that a progressive loss of nephrin from foot process at the onset of podocyte injury accompanied by disruption or displacement of slit-diaphragms gave rise to proteinuria. As shown in our study, several thick bands of proteins with different molecular weights were detected in the medium for maintaining larvae that were exposed to AA .Development of the proteinuria suggests an impaired glomerular filtration barrier in larvae renal. Dysfunction of podocyte may be involved in the development of the proteinuria as the expression level of nephrin greatly decreased in the AA-treated larvae compared with the mock control.