Sage Journals: Discover world-class research

Abstract

Objective:

Hormesis or low-dose ionizing radiation is known to induce various biological responses, a subcategory of which is the adaptive response, which has been reported to protect against higher radiation doses via multiple mechanisms. This study investigated the role of the cell-mediated immunological component of low-dose ionizing radiation-induced adaptive response.

Methods:

Herein, male albino rats were exposed to whole-body gamma radiation, using a Cs¹³⁷ source with low-dose ionizing radiation doses of 0.25 and 0.5 Gray (Gy); 14 days later, another irradiation session at a dose level of 5 Gy was carried on. Four days post-irradiation at 5 Gy, rats were sacrificed. The low-dose ionizing radiation-induced immuno-radiological response has been assessed through the T-cell receptor (TCR) gene expression quantification. Also, the serum levels of each of interleukins-2 and -10 (IL-2, IL-10), transforming growth factor-beta (TGF-β), and 8-hydroxy-2′-deoxyguanosine (8-OHdG) were quantified.

Results:

Results indicated that priming low irradiation doses resulted in significant decrements in TCR gene expression and the serum levels of IL-2, TGF-β, and 8-OHdG with an increment in IL-10 expression compared to the irradiated group, which did not receive low priming doses.

Conclusion:

The observed low-dose ionizing radiation-induced radio-adaptive response significantly protected against high irradiation dose injuries, through immune suppression, representing a promising pre-clinical protocol that would be applied to minimize radiotherapy side effects on normal but not against the tumor cells.

Keywords

adaptive response gamma radiation immuno-modulatory radiotherapy hormesis

Introduction

Radiotherapy (RT) is a widely applied cancer management protocol; apart from its direct effect on tumor cells, it can cause local micro-environmental changes affecting both tumor and normal cells. In response to RT, tumor and non-tumor cells release soluble mediators, specific cytokines, and chemokines.^1,2 Whole-body irradiation is applied clinically to treat some types of leukemia, where significant systemic side effects are expected; thus, this investigation aimed to aid in minimizing radiotherapy’s systemic side effects on normal health tissue focusing on the role of the body’s immune response. To better understand both the beneficial and the detrimental health impacts of low-dose ionizing radiation, studies have recently focused on various radiation effects such as adaptive response, bystander or abscopal effects, radio-resistance, hypersensitivity, and genomic aberrations.³ As for the adaptive response, low priming doses of radiation were reported to initiate stress responses and mechanisms that offer cellular protection from the subsequent higher radiation doses.⁴

One proposed protocol to minimize healthy tissue injuries is the adaptive response caused by low-dose ionizing radiation, which is reported to be mediated by multiple signaling pathways.⁵ Being reported to induce an adaptive response to subsequent high-dose ionizing radiation, pre-irradiation by low-dose ionizing radiation is a valuable technique for preventing and reducing adverse effects at high-dose ionizing radiation.⁶

The diagnostic and interventional radiation medical applications are continuously updated, resulting in a growing concern about the biological effects of low-dose ionizing radiation. Studies have investigated the use of low-dose ionizing radiation as a priming dose before high-dose ionizing radiation; nevertheless, adaptive response can last for several days to months following irradiation dose levels lower than or equal to 0.5 Gy.⁷ Acute 0.5 Gy whole-body irradiation is clinically asymptomatic^8,9 in humans (UNSCEAR); however, Yonezawa et al.¹⁰ reported the occurrence of adaptive response experimentally following different priming and challenge irradiation doses and exposure durations depending on the age and strain of the animal. Hormetic effects of low-dose ionizing radiation have been reported earlier in blood-forming tissues 2 weeks after a 0.3–0.5 Gy priming dose and high-dose irradiation.^11-15 However, 0.05–0.1 Gy priming doses have been reported to induce hormesis for 2 months following exposure.¹⁶ As a result, LD can improve average cell resistance to radiation before receiving RT, reducing RT side effects and preventing the limitation of treatment protocols based on a specific dose to avoid radiation’s serious implications and avoiding RT-induced abscopal impact on normal tissues.¹⁷

Cell-mediated immunity can be detected and quantified by assessing pro-inflammatory/regulatory cytokines and DNA aberrations markers. In response to an injurious insult, T-cell receptor (TCR) activation alters T-cells' metabolism, gene expression, and cytoskeleton structure, triggering a signaling cascade that leads to their proliferation and differentiation.¹⁸ Interleukin-2 (IL-2) is an important cytokine that modulates pro- and anti-inflammatory T-cell signaling pathways; IL-2 also activates other transduction networks, which initiate transcription and metabolic activities that influence the fate of the cells.¹⁹ On the other hand, interleukin-10 (IL-10), an essential regulatory cytokine with a long history of being recognized as a potent anti-inflammatory mediator with a broad spectrum of action,²⁰ is believed to play a role in cell-mediated immunity. Along the same line, transforming growth factor-beta (TGF-β) is an important growth factor for the conventional, regulatory, and innate T-cell-mediated immune response. Moreover, TGF-β has been reported to promote cell development, homeostasis, tolerance, and differentiation.²¹ In parallel, oxidative stress is a well-known initiator of almost all the inflammatory and immunological responses to injuries with the consequent free radicals-induced DNA aberrations that might be assessed using the oxidative marker 8-hydroxy-2′-deoxyguanosine (8-OHdG)²² as a quantifiable indicator.

In light of the information mentioned above, this work aimed to investigate the possible use of the exposure to low irradiation doses before the use of high radio-therapeutic doses through triggering cell-mediated immunological pathway(s), an experimental work that might help in future designs of tumor RT protocols’ design concerned with minimizing the radiation-induced abscopal effects.

Methods

Experimental animals

Male Wister albino rats weighing 150 ± 5 g (6 weeks) were purchased from the Egyptian National Research Centre (Giza, Egypt) animal breeding unit and used in the current study. Animals were housed at the animal house of the Egyptian Atomic Energy Authority-National Center for Radiation Research and Technology (EAEA-NCRRT) and allowed to acclimatize for 10 days before the experiment. All rats were fed standard pellets specific for rats and had free access to clean drinking water. All the animal handling procedures were approved by the NCRRT Research Ethics Committee (Approval number: 73A/21).

Experimental design

Twenty rats were randomly assorted into four experimental groups. Group I: non-irradiated rats that served as normal control; Group II: irradiated rats that received a single dose level of 5 Gy; Group III: irradiated rats that received a priming dose of 0.25 Gy followed by a challenge dose of 5 Gy; Group IV: irradiated rats that received a priming dose of 0.5 Gy followed by a challenge dose of 5 Gy. Challenge doses were 14 days apart from the corresponding priming dose. The sample size for each group was calculated using the G-power analysis software (3.1.9.4); α = 0.05, power = 0.8, effective size = 0.85, and the number of groups = 4.

Irradiation of animals

The animals were irradiated using an experimental gamma irradiator, cesium-137 gamma cell source, in an EAEA-NCRRT (Nordion Company, Toronto, Canada, model GC40); the irradiation chamber is 10 cm in height and 40 cm in diameter. Radiation doses were delivered at a 6.6 mGy/sec dose rate. At exposure time, four groups were given gamma IR doses of 0 Gy, 5 Gy, and 0.25 Gy as a priming dose and challenge with 5 Gy and 0.5 as a priming dose and challenge 5 Gy, respectively.

Samples collection and biochemical analysis

Four days following the challenge irradiation and 18 days following control or priming irradiation, rats were sacrificed by decapitation under deep urethane anesthesia. Based on pilot experiments carried out by our team and a literature survey, the time interval of 4 days following irradiation has been selected where it showed optimum cytokines' levels and stability of those levels. Blood samples were collected from the orbital vein before decapitation in non-heparinized tubes. Then, serum was separated by centrifugation of clotted blood and stored at −80°C until used for the biochemical analysis. Serum was used to assess IL-2, IL-10, TGF-β, and 8-OHdG levels using ELISA kits according to the manufacturer’s instructions (Mybiosource®, San Diego, USA). The absorbance of the ELISA substrate was measured at 450 nm using the microplate reader 2100 Stat Fax (Awareness Technology INCELISA®).

As for the normalized serum TCR mRNA level assessment. RNA extraction : Using Qiagen® tissue extraction kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions, the total RNA was extracted from serum samples and isolated. Agarose gel (1%) electrophoresis and ethidium bromide staining techniques were used to confirm the separated RNA integrity. The purity (A260/A280 ratio) and the concentration of RNA were determined using a dual-wavelength spectrophotometer (Beckman Spectrophotometer, USA). RNA integrity/purity was determined according to the kit manufacturer’s instructions based on the manufacturer’s pre-set calculations. cDNA synthesis: First-strand complementary DNA (cDNA) synthesis was carried out using a high-capacity cDNA reverse transcription kit (Fermentas, USA) using total RNA (0.5–2 μg) as the template. The total volume of the synthesis master mix was 19 μL for each sample. This was added to an aliquot of 31 μL RNA-primer mixture resulting in 50 μL cDNA. Real-time qPCR: TR-qPCR amplification and analysis were performed using Sequence Detection Program (PE Biosystems, CA, USA); software version 3.1 (StepOne™, USA) and a thermal cycler stage one plus (Applied Biosystems, USA); the forward and reverse primers total concentration in the reaction mix was 8%. The qPCR assay with the primer sets was optimized at the annealing temperature for the reverse and forward primers: 60°C and 72°C, respectively. The qPCR temperature control was set at 50°C. The used primers' sequences are listed in Table 1. Calculations: A standard analysis curve (a standardized curve based on a previous analysis) was constructed using the reference gene; GAPDH amplified in the PCR experiment to calculate the relative gene expression. Following the normalization of data, the relative normalized serum TCR mRNA level was calculated using the comparative delta Ct method described by Livak and Schmittgen.²³

Table 1.

Sequences of the primers of TCR and GAPDH used for RT-qPCR.

Gene	Primer sequence
TCR	Forward primer, 5′- CCAGGGTTTTCCCAGTCACGAC -3′ Reverse primer 5′- 5′-AGGCCAGGATGTTACTCCTTT-3′
GAPDH	Forward primer, 5′-CAACGAATTTGGCTACAGCA-3′ Reverse primer 5′-5′-AGGGGTCTA CATGGCAACTG-3′.-3′

Statistical analysis

R software, version 4.1.0, was used for the statistical analysis of the data recorded in our experiment. The Kolmogorov–Smirnov²⁴ and Shapiro–Wilk normality tests²⁵ were used to verify that the data obtained in all the experimental groups were normally distributed. The primary difference in means among the groups was determined using a one-way analysis of variance (ANOVA) followed by Tukey Honest²⁶ Significant Differences as a post-hoc test.²⁷ Statistical significance was set at α = 0.05 (p < 0.05). The Pearson correlation coefficient²⁸ was used to fine-tune the relationship between the variables studied. The data are presented as means ± the Standard Error of the Mean (SEM).

Results

Effect of LD pre-irradiation on normalized serum TCR mRNA level of HD irradiated rats

In the current study, whole-body γ-irradiation at 5 Gy significantly increased normalized serum TCR mRNA level compared to the control non-irradiated group. This increment in gene expression was corrected considerably by the pre-irradiation at the dose level of 0.25 Gy and not 0.5 Gy (Figure 1), as compared to Group II.

Figure 1.

Level of the T-cell receptor (TCR) mRNA in serum 4 days after whole-body exposure of rats to gamma radiation. The GAPDH reference gene was used for relative comparison. Group-I: control rats, Group II: rats irradiated at 5 Gray, Groups III and IV: rats irradiated with 5 Gray 14 days following priming doses of 0.25 or 0.5 Gray, respectively. Data represented as a Mean ± SEM. Significant difference at α = 0.05 (p < 0.05). Average values marked with the same letters are insignificant at α = 0.05 (p ≥ 0.05).

ANOVA revealed a significant effect in the gamma-irradiated groups (II to IV) compared to the non-irradiated group (I), that is, TCR gene expression at F _{(cv, 3, 16)} = 11 at α = 0.05 (p < 0.0001). The Pearson correlation coefficient was used to discover a link between radiation dose and normalized serum TCR mRNA level r = +0.942 (p < 0.01).

Effect of Low dose (LD)pre-irradiation on serum levels of IL-2 and -10 in High dose (HD) irradiated rats

Results demonstrated in Figure 2 indicated that HD resulted in a significant increment in serum level of IL-2 as compared to Group I. However, both priming irradiation doses, 0.25 Gy and 0.5 Gy, effectively inhibited this rise compared to rats irradiated at 5 Gy without prior irradiation. Our results also indicated a remarkable decrease in IL-10 serum levels following high-dose irradiation compared to Group I. Interestingly, 0.25 Gy and 0.5 Gy priming irradiation doses were able to normalize the serum levels of IL-10 compared to 5 Gy irradiated rats (Figure 3).

Figure 2.

Interleukin-2 (IL-2) levels in serum after 4 days whole-body exposure of rats to gamma radiation. Group-I: control rats, Group II: rats irradiated at 5 Gray, Groups III and IV: rats irradiated with 5 Gray 14 days following priming doses of 0.25 or 0.5 Gray, respectively. Data represented as a Mean ± SEM. Significant difference at α = 0.05 (p < 0.05). Average values marked with the same letters are insignificant at α = 0.05 (p ≥ 0.05).

Figure 3.

Interleukin-10 (IL-10) levels in serum 4 days after whole-body exposure of rats to gamma radiation. Group-I: control rats, Group II: rats irradiated at 5 Gray, Groups III and IV: rats irradiated with 5 Gray 14 days following priming doses of 0.25 or 0.5 Gray, respectively. Data represented as a Mean ± SEM. Significant difference at α = 0.05 (p < 0.05). Average values marked with the same letters are insignificant at α = 0.05 (p ≥ 0.05).

A one-way ANOVA revealed a significant effect in the gamma-irradiated groups compared to the non-irradiated groups, notably IL-2 and IL-10 at F _{(cv, 3, 16)} = 262 and 33, respectively, at α = 0.05 (p < 0.0001). The Pearson correlation coefficient was used between radiation dose and IL-2 and IL-10 r = +0.515 (p ˂ 0.05) and r = −0.396 (p ≥ 0.05), respectively.

Effect of LD pre-irradiation on serum levels of TGF-β and 8-OHdG in HD irradiated rats

In the present work, the high-dose ionizing radiation induced an abrupt rise in rat serum level of TGF-β; when applied alone with no priming doses, compared to the control non-irradiated group. Compared to Group II, pretreatment with 0.25 Gy and 0.5 Gy significantly reduced this increase (Figure 4). As for the serum level of 8-OHdG, a remarkable rise has been observed following irradiation at 5 Gy, compared to Group I. This rise was significantly attenuated by each of the two low priming doses in Group II, but only the 0.25 Gy showed normalization of the 8-OHdG serum level (Figure 5). One-way ANOVA revealed a significant effect in the gamma-irradiated groups (II to IV) compared to the non-irradiated group (I). TGF- β and 8-OHdG at F _{(cv, 3, 16)} = 24 and 25, respectively, at α = 0.05 (p < 0.0001). Pearson correlation coefficient between radiation dose and TGFβ and 8-OHdG are r = +0.780 and r = +0.689 (p < 0.01), respectively

Figure 4.

Transforming growth factor-beta (TGF-β) levels in serum 4 days after whole-body exposure of male rats to gamma radiation. Group-I: control rats, Group II: rats irradiated at 5 Gray, Groups III and IV: rats irradiated with 5 Gray 14 days following priming doses of 0.25 or 0.5 Gray, respectively. Data represented as a Mean ± SEM. Significant difference at α = 0.05 (p < 0.05). Average values marked with the same letters are insignificant at α = 0.05 (p ≥ 0.05).

Figure 5.

8-hydroxydeoxyguanosine (8-OHdG) levels in serum 4 days after whole-body exposure of male rats to gamma radiation. Group-I: control rats, Group II: rats irradiated at 5 Gray, Groups III and IV: rats irradiated with 5 Gray 14 days following priming doses of 0.25 or 0.5 Gray, respectively. Data represented as a Mean ± SEM. Significant difference at α = 0.05 (p < 0.05). Average values marked with the same letters are insignificant at α = 0.05 (p ≥ 0.05).

Discussion

IR therapeutic and diagnostic uses are invaluable un-replaceable medical tools. Considering the growing need to investigate how a low priming dose can mitigate the effects of a high-dose whole-body exposure, we herein investigate one of the proposed protection protocols, the adaptive response or IR hormesis, caused by pre-exposure to low-dose ionizing radiation. Low-dose ionizing radiation, known as the “priming dose,” before exposure to radio-therapeutic high-dose has been reported to minimize the side effects of high-dose irradiation, known as the “challenging dose.”²⁹ Also, an earlier in-vivo adaptive response study found that prolonged or repeated low-dose priming radiation effectively inhibits IR-induced carcinogenesis.²⁹ Herein, we observed and reported that exposure to the priming gamma irradiation doses of 0.25 or 0.5 Gy altered the immune-radiological response and significantly reduced DNA damage when applied before high-dose ionizing radiation of 5 Gy.

High-dose ionizing radiation is known to induce DNA damage both directly and indirectly, affecting the phenotypic structure of tumor cells (target effects). As for the bystander/abscopal healthy tissues, numerous studies have shown that IR affects cells that are not a part of the primary tumor.³⁰ Since the 1950s, it has been established that tissues outside the irradiation zone respond as if irradiated, but the cause has remained unexplained. Over the last decade, it has been proposed that the effects of local irradiation on cancers are immune-mediated, with distant products, including T-cells, inducing what is known as radiation “abscopal effect,” a term that refers to the influence of radiation on the non-irradiated tissues outside of the targeted zone.² In the same context, a detailed study has reported the existence of adaptive response under different experimental conditions, varying combinations of priming/challenge irradiation doses, different time intervals between priming and challenge doses, and along a wide range of ages/strains of experimental animals,¹⁰ naming it the “Yonezawa Effect.”

Normalized serum TCR mRNA level increased in the 5 Gy group compared to the non-irradiated group in this study, which positively correlated to variables studied in the experimental groups, implying TCR pro-inflammatory and immune-suppressive roles (Figure 6). On the molecular level, the TCR recognizes the antigen fragments bound to major histocompatibility molecules on the antigen-presenting cell surface. The antigen binds to the TCR on the surface of T-cells, and together with cytokines and co-stimulatory molecules, it causes naive CD4+/CD8 + T-cells to proliferate and differentiate.³¹ However, the negative TCR signaling also plays an important immunological role by inhibiting the over-activation of the immune reaction. Similarly, an earlier study supported this idea by reporting that TCR-mediated signaling regulates T-cell activation, homeostasis, and tolerance,³² attenuating the proposed abscopal effects of the immune-stimulatory insult.

Figure 6.

Correlation matrix of the variables analyzed in the experimental groups. Data represented as a Mean ± SEM. Significant difference at α = 0.05 (p < 0.05). Average values marked with the same letters are insignificant at α = 0.05 (p ≥ 0.05).

Herein, we observed a significant increase in serum IL-2 level in the HD irradiated group compared to non-irradiated control rats; however, both 0.25 Gy and 0.5 Gy were able to counteract this rise. In a similar context, other researchers reported an IR-induced reduction in IL-2 and proposed that low-dose ionizing radiation would enhance the increase of IL-2.³³ Also, an earlier study has reported that single irradiation induces cytokines profile dysregulation, resulting in a transition to the T-helper cell 2 (Th2) form³⁴ and affecting the Th1/Th2 balance.³⁵ Another study hypothesized that IR might affect the Th1 cell response to Th2 signaling following moderate and high doses of radiation.³⁶ Furthermore, as a Th2 cytokine, IL-10 possesses anti-inflammatory properties. However, it typically protects against the action of Th1 cytokines. It plays a critical and highly complex role in regulating immune reactions,³⁷ confirmed in this study by significantly increased IL-10 levels in Group II compared to Group I.

TGF-β significantly increased after high-dose irradiation, while 0.25 Gy and 0.5 Gy priming doses could attenuate this change seriously. TGF-β is a multifunctional cytokine that regulates the immune cell functions and the immunosuppressive mediator’s signaling pathways.³⁸ It has also been reported to be highly expressed by tumor cells, which promotes cell proliferation despite having a more complicated role in the cellular injury. However, inhibiting TGF-β signaling during radiotherapy can reduce the detrimental radiation-induced effects on normal tissues.²

IR-induced DNA fragmentation is directly or indirectly induced through various radiolytic reactive moieties; that is, free radicals either directly attack and react with DNA or produce intermediates that also attack the DNA molecule.³⁹ In this study, the serum levels of 8-OHdG, one of the degradation products of DNA, were elevated significantly in Group II due to the high irradiation dose compared to Group I. Again, irradiation priming doses effectively corrected this elevation. A proposed mechanism of this correction has been introduced in the study of Coleman et al.,⁴⁰ who attributed it to the induction of cellular defense enzymes' synthesis by the priming irradiation dose, resulting in thorough free radical detoxification, cell protection, and DNA repair mechanisms. At low doses, irradiation has been reported to induce protective mechanisms, such as increased antioxidant and double-strand break repair capacity, reducing direct and indirect DNA damage in an in vivo mice model.⁴¹ They suggested that adaptive response is likely to involve the transcription of multiple genes and the activation of numerous protective signaling pathways (Table 2).

Table 2.

Correlation matrix of the variables analyzed in the experimental groups. [T-cell receptor (TCR), interleukin-2/10 (IL-2/IL-10), transforming growth factor-beta (TGF-β), and 8-hydroxy-2′-deoxyguanosine (8-OHdG)].

Variable	TCR	IL-2	IL-10	TGF-β	8-OHdG
TCR	—	0.659^**	−0.716^***	0.503^*	0.740^***
IL-2	0.659^**	—	−0.885^***	0.738^***	0.813^***
IL-10	−0.716^***	−0.885^***	—	−0.614^**	−0.792^***
TGF-β	0.503^*	0.738^***	−0.614^**	—	0.821^***
8-OHdG	0.740^***	0.813^***	−0.792^***	0.821^***	—

*, **and *** significant at α = 0.05 (p < 0.05), (p < 0.01) and (p < 0.001) respectively.

Although the priming dose attenuates the high-dose immunopathological effect on healthy tissue, the authors chose to conduct this study without a tumor because we wanted to examine the effects of radiation without being distracted by tumor cell responses to irradiation. Radiotherapy in benign diseases such as immunological disorders has a promising future clinically^42-44; therefore, it is crucial to understand the effect of the radiotherapy dose on healthy non-tumor tissues. However, the limitation is ensuring that tumor cells effectively contribute to the radiotherapy’s side effects on healthy tissue. The authors recommend repeating the study in an experimental tumor model to examine the immune-radiological impact on both tumor and healthy tissue to determine whether the lowering in side effects on healthy tissue will affect the radiotherapy process and how the tumor will react to such a change.

Conclusion

To summarize, the results of the current study are almost consistent with those of earlier work which recommended radiation-induced biological defense mechanisms as an effective countermeasure against the damage caused by challenging/high doses applied in radio-therapeutic protocols.

Footnotes

Acknowledgments

Authors are grateful to Prof. Layla A. Rashed, Medical Biochemistry and Molecular Biology Unit, Faculty of Medicine, Cairo University, for her generous assistance in carrying out some experimental work in her laboratories.

Author’s contribution

The first author designed the study protocol, implemented the practical experimental procedures, analyzed the resulting data, and constructed the first manuscript draft. The second author integrated the aim of the work, interpreted the result with the first author, and formatted, edited, and finalized the manuscript before submission.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Ethical approval

The procedures used in the experiment were approved by the NCRRT Research Ethics Committee; Approval number: 73A/21.

ORCID iDs

Soha M Hussien

Engy R Rashed

References

Jahns

Anderegg

Saalbach

, et al. Influence of low dose irradiation on differentiation, maturation and T-cell activation of human dendritic cells. Mutation research 2011; 709–710: 32–39.

Sologuren

Rodríguez-Gallego

Lara

. Immune effects of high dose radiation treatment: implications of ionizing radiation on the development of bystander and abscopal effects. Transl Cancer Res Vol 3, No 1 (February 2014) Transl Cancer Res (Intraoperative Radiother I) 2014. http://tcr.amegroups.com/article/view/2091

Lau

Chew

Alqahtani

Jones

Hill

Nisbet

Bradley

(2021) Low Dose Ionising Radiation-Induced Hormesis: Therapeutic Implications to Human Health. Applied Sciences 11(19):8909. Dubitzky W, Wolkenhauer O, Yokota H, Cho, K-H, (eds.) Encyclopedia of systems biology. Springer, 2367 p. https://doi.org/10.3390/app11198909

Khan

MGM

Wang

. Advances in the current understanding of how low-dose radiation affects the cell cycle. Cells 2022; 11: 356.

Zhao

Cui

J-W

J-H

, et al. Effects of low-dose radiation on adaptive response in colon cancer stem cells. Clinical & translational oncology: Official Publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico 2017; 19: 907–914.

Assadi

Zabihi

Khosravifarsani

, et al. Radioadaptive response in human lymphocyte cells. International journal of molecular and cellular medicine 2014; 3: 57–60.

Feinendegen

. Evidence for beneficial low-level radiation effects and radiation hormesis. The British journal of radiology 2005; 78: 3–7.

UNSCEAR . Biological mechanisms of radiation actions at low doses. United Nations 2012; 1–45.

UNSCEAR . Sources and Effects of Ionizing Radiation United Nations Scientific Committee on the Effects of Atomic Radiation. 2010.

10.

Yonezawa

. Induction of radio-resistance by low dose X-irradiation. Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan 2006; 126: 833–840.

11.

Horie

Kubo

Yonezawa

. p53 Dependency of Radio-adaptive Responses in Endogenous Spleen Colonies and Peripheral Blood-cell Counts in C57BL Mice. Journal of radiation research 2002; 43: 353–360.

12.

Wang

Tanaka

Ninomiya

Maruyama

Varès

Eguchi-Kasai

, et al. Relieved residual damage in the hematopoietic system of mice rescued by radiation-induced adaptive Response (Yonezawa Effect). Journal of radiation research 2013; 54: 45–51.

13.

Liu

Hirakawa

Tanaka

, et al. Reduction of Delayed Homologous Recombination by Induction of Radioadaptive Response in RaDR-GFP Mice (Yonezawa Effect): An Old Player With a New Role. Dose-response : A Publication of International Hormesis Society 2019; 17: 1559325819833840.

14.

Gao

Wang

, et al. Serum 8-Hydroxy-2′-Deoxyguanosine Level as a Potential Biomarker of Oxidative DNA Damage Induced by Ionizing Radiation in Human Peripheral Blood. Dose-response : A Publication of International Hormesis Society 2019; 17: 1559325818820649.

15.

Wang

Tanaka

Katsube

, et al. Reduced High-Dose Radiation-Induced Residual Genotoxic Damage by Induction of Radioadaptive Response and Prophylactic Mild Dietary Restriction in Mice. Dose-response: A Publication of International Hormesis Society 2021; 19: 1559325820982166.

16.

Charles

Grimwood

. Health effects of low dose radiation (challenges of the 21st century) A Review of the Current Basis of Neutron Radiation Risks and Future Trends British Nuclear Energy Society.

17.

Yang

Jiang

, et al. Low‐dose radiation may be a novel approach to enhance the effectiveness of cancer therapeutics. International journal of cancer 2016; 139: 2157–2168.

18.

Conley

Gallagher

Berg

. T Cells and gene regulation: the switching on and turning up of genes after T Cell receptor stimulation in CD8 T Cells. Frontiers in Immunology 2016; 7: 76.

19.

Ross

Cantrell

. Signaling and function of interleukin-2 in T lymphocytes. Annual review of immunology 2018; 36: 411–433.

20.

Mosser

Zhang

. Interleukin-10: new perspectives on an old cytokine. Immunological reviews 2008; 226: 205–218.

21.

Sanjabi

. Regulation of the immune Response by TGF-β: From conception to autoimmunity and infection. Cold Spring Harbor perspectives in biology 2017; 9: 10222366–33.

22.

Huang

M-C

Lai

Y-C

Lin

S-K

, et al. Increased blood 8-hydroxy-2-deoxyguanosine levels in methamphetamine users during early abstinence. The American journal of drug and alcohol abuse 2018; 44: 395-402.

23.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: 402–408.

24.

Lopes

RHC

. Kolmogorov-Smirnov Test BT - International Encyclopedia of Statistical Science. In: Lovric

(ed). Berlin, Heidelberg: Springer Berlin Heidelberg, pp. 718–720.

25.

Shapiro

Wilk

. An Analysis of Variance Test for Normality (Complete Samples). Biometrika 1965; 52: 591–611.

26.

Haynes

. Tukey's Test BT - Encyclopedia of Systems Biology. In: Dubitzky

Wolkenhauer

Cho

K-H

, et al. (eds). New York, NY: Springer, pp. 2303–2304.

27.

Stoll

. The SAGE Encyclopedia of communication research methods. Epub ahead of print 2017. DOI: 10.4135/9781483381411

28.

Kirch

(ed). Pearson's Correlation Coefficient BT - Encyclopedia of Public Health. Dordrecht: Springer Netherlands, pp. 1090–1091.

29.

Nenoi

Wang

Vares

. In vivo radio adaptive response: a review of studies relevant to radiation-induced cancer risk. Human & experimental toxicology 2015; 34: 272–283.

30.

Wang

Qian

. Biological effects of radiation on cancer cells. Military Medical Research 2018; 5: 20.

31.

Lee

Shin

Kang

. T-cell biology in aging, with a focus on lung disease. The journals of gerontology. Series A, Biological sciences and medical sciences 2012; 67: 254–263.

32.

Arndt

Krieger

Kalinski

, et al. The transmembrane adaptor protein SIT inhibits TCR-mediated signaling. PLoS One 2011; 6: e23761, Epub ahead of print 21 September 2011. DOI: 10.1371/journal.pone.0023761

33.

Sohn

E-H

. 2013, Effects of Low Dose Gamma Irradiation on the Inflammatory Response in Spleen Cells. KSBB Journal; 28. 415, 422, Epub ahead of print 30 December 2013. DOI: 10.7841/ksbbj.2013.28.6.415

34.

Manda

Glasow

Paape

, et al. Effects of ionizing radiation on the immune system with special emphasis on the interaction of dendritic and T cells. Frontiers in oncology 2012; 2: 102.

35.

Ghazy

Abu El-Nazar

Ghoneim

, et al. Effect of murine exposure to gamma rays on the interplay between Th1 and Th2 lymphocytes. Frontiers in pharmacology 2015; 6: 74.

36.

Bahreyni Toossi

Dehkordi

Sankian

, et al. Effects of adaptive Response induced by low-dose ionizing radiation on immune system in spleen lymphocytes of BALB/C mice. Physica Medica 2016; 32: 244.

37.

Zhou

Streutker

Borojevic

, et al. IL-10 modulates intestinal damage and epithelial cell apoptosis in T cell-mediated enteropathy. American journal of physiology. Gastrointestinal and liver physiology 2004; 287: G599–G604.

38.

Batlle

Massagué

. Transforming growth factor-β signaling in immunity and cancer. Immunity 2019; 50: 924–940.

39.

Marnett

Riggins

West

. Endogenous generation of reactive oxidants and electrophiles and their reactions with DNA and protein. The Journal of clinical investigation 2003; 111: 583–593.

40.

Coleman

Yin

Peterson

, et al. Low-dose irradiation alters the transcript profiles of human lymphoblastoid cells including genes associated with cytogenetic radioadaptive response. Radiation research 2005; 164: 369–382.

41.

Otsuka

Koana

Tauchi

, et al. Activation of antioxidative enzymes induced by low-dose-rate whole‐body γ irradiation: adaptive response in terms of initial DNA damage. Radiation research 2006; 166: 474–478.

42.

Kirkby

Mackenzie

. Is low dose radiation therapy a potential treatment for COVID-19 pneumonia? Radiotherapy and oncology: Journal of the European Society for Therapeutic Radiology and Oncology 2020; 147: 221.

43.

Rödel

Keilholz

Herrmann

, et al. Radiobiological mechanisms in inflammatory diseases of low-dose radiation therapy. International journal of radiation biology 2007; 83: 357–366.

44.

Rödel

Frey

Manda

, et al. Immunomodulatory properties and molecular effects in inflammatory diseases of low-dose x-irradiation. Frontiers in oncology 2012; 2: 120.

Immune system modulation by low-dose ionizing radiation-induced adaptive response

Abstract

Objective:

Methods:

Results:

Conclusion:

Keywords

Introduction

Methods

Experimental animals

Experimental design

Irradiation of animals

Samples collection and biochemical analysis

Statistical analysis

Results

Effect of LD pre-irradiation on normalized serum TCR mRNA level of HD irradiated rats

Effect of Low dose (LD)pre-irradiation on serum levels of IL-2 and -10 in High dose (HD) irradiated rats

Effect of LD pre-irradiation on serum levels of TGF-β and 8-OHdG in HD irradiated rats

Discussion

Conclusion

Footnotes

Acknowledgments

Author’s contribution

Declaration of conflicting interests

Funding

Ethical approval

ORCID iDs

References