Abstract
Objective
Non-alcoholic fatty liver disease (NAFLD) is a worldwide health problem with high prevalence and morbidity associated with obesity, insulin resistance, type 2 diabetes mellitus (T2DM), and dyslipidemia. Nano-formulation of luteolin with Zn oxide in the form of Lut/ZnO NPs may improve the anti-diabetic property of each alone and ameliorate the insulin resistance thus management of NAFLD. This study aimed to measure the efficiency of Lut/ZnO NPs against insulin resistance coupled with NAFLD and T2DM.
Methods
A diabetic rat model with NAFLD was induced by a high-fat diet and streptozotocin (30 mg/kg I.P). Serum diabetogenic markers levels, lipid profile, and activity of liver enzymes were measured beside liver oxidative stress markers. Moreover, the hepatic expressions of PI3K/AKT/FoxO1/SERBP1c as well as heme oxygenase-1 were measured beside the histopathological examination.
Results
Lut/ZnO NPs treatment effectively reduced hyperglycemia, hyperinsulinemia, and ameliorated insulin resistance. Additionally, Lut/ZnO NPs improved the hepatic functions, the antioxidant system, and reduced the oxidative stress markers. Furthermore, the lipid load in the liver, as well as the circulating TG and TC, was minified via the suppression of lipogenesis and gluconeogenesis. Moreover, Lut/ZnO NPs activated the PI3K/AKT signaling pathway, hence inactivating FoxO1, therefore enhancing the hepatic cells’ insulin sensitivity.
Conclusion
Lut/ZnO NPs have a hepatoprotective effect and may relieve the progression of NAFLD by alleviating insulin resistance, ameliorating the antioxidant status, and regulating the insulin signal pathway.
Keywords
Introduction
The high prevalence (25–30%), morbidity, and mortality of the worldwide non-alcoholic fatty liver disease (NAFLD) were associated with the progression of many harmful and damaging complications in the liver tissues, including steatosis, non-alcoholic steatohepatitis, fibrosis, and cirrhosis, that ultimately develop hepatocellular carcinoma.1,2 Hassan et al. 3 found that Egyptian prevalence of NAFLD was 15.8% among both children and adolescents which increases with age from (≤20 to more than 40%) under the age of 20 years to over the age of 60 years, respectively. Additionally, it is predominant in men (31%) more than in women (16%). It is characterized by the excessive aggregation and deposition of lipid content (≥5–10%) in the hepatocytes, consequently raising oxidative stress and free fatty acids leading to augment synthesis and accumulation of triglyceride. 4 The complicated pathogenesis of NAFLD was correlated to obesity, type 2 diabetes (T2DM), dyslipidemia, insulin resistance, mitochondrial dysfunction, endoplasmic reticulum stress, inflammation, gut microbiota disorders, and dietary factors. 5
The liver is a vital organ that has an important role in many metabolic processes like glucose and lipid metabolism besides the skeletal muscle and adipose tissue. 6 The metabolic activity of the liver is regulated mainly by insulin through insulin signaling IRS/PI3K/AKT/FoxO1. 7 Besides that, it regulates the cell cycle, cell growth, and apoptosis. 8 Whereas dysregulation of the insulin signaling induces insulin resistance in which insulin lose its ability to control and regulate the hepatic metabolism of both glucose and lipid, leading to hyperglycemia (excessive glucose production) and hyperlipidemia (accelerated rates lipogenesis). 7
Based on the strong link between NAFLD and T2DM, anti-diabetic medications can be used for the treatment of NAFLD. 9 But the oral antidiabetic drugs have adverse side effects, consequently, changing the lifestyle and consuming a diet rich in natural phytonutrients are effective in the management of diabetes and also for patients with NAFLD due to their various pharmacological activities. 10 Luteolin (3′, 4′, 5, 7-tetrahydroxy flavone) is a flavonoid derived from many traditional Chinese medicinal plants. It is widely present in many edible vegetables, like pepper, celery, carrot, and spinach. 11 Luteolin is known to have multiple health benefits including antioxidant potential, 12 anti-inflammatory effects, 13 hepatoprotective roles, 14 in addition to its anticancer and neuroprotective effects. 15 The anti-diabetic potential of luteolin was reported in several studies. Luteolin ameliorated hepatic/adipose tissue insulin resistance in diet-induced obesity complications. 16 Furthermore, Sangeetha 17 revealed that luteolin retained levels of blood glucose and ameliorated the sensitivity of body cells to insulin thus confirming its anti-diabetic effect. Additionally, luteolin influenced many disorders related to glycolipid metabolism in particular insulin resistance, and diabetes. 18 Moreover, Xiong et al. 19 reported that luteolin ameliorated lipid and glucose metabolism through control of the metabolic organs (hypothalamus, liver, and adipose tissue). Lin et al. 20 confirmed its role in the regulation of lipids by enhancing β-oxidation of fatty acids and lipolysis in neurons resulting from elevated serotonin. Additionally, Bumke-Vogt et al. 21 demonstrated that luteolin alleviated hepatic steatosis via inhibition of gluconeogenesis and lipogenesis. Furthermore, luteolin activated the hippocampal insulin signaling pAkt/glycogen synthase kinase (pGSK), hence increasing the infusion of glucose along with reducing hepatic glucose production. 22
Nanoformulation of numerous nutraceutical compounds and even drugs overcome many limitations including solubility, bioavailability, and delivery of these compounds to their active site. Abd-Allah et al. 23 reported that nanoformulation of nicotinamide or ascorbic acid in chitosan nanoparticles improved their hepatoprotective effect and alleviated the NAFLD via modulation of the insulin resistant, oxidative stress status besides amelioration of hepatic function and lipid content. Moreover, Li et al. 24 indicated that encapsulation of modified glycogen polymer with resveratrol improved NAFLD by targeting the redox status and reducing fat accumulation in the liver tissues as well as liver injury. The bioavailability and therapeutic efficiency of Celastrol against NAFLD were enhanced via its incorporation with biodegradable albumin-based nanoparticles. 25
Like many nutraceutical compounds, the low solubility of luteolin in water makes its intravenous or intraperitoneal administration very difficult and thus minified its bioavailability and efficiency. 18 Therefore, nano-formulation of luteolin as one of the phytochemicals improved its solubility, bioavailability, biodistribution, and potentiate its anti-diabetic effect. 26 Zinc (Zn) is a suitable choice because it is a trace element metal involved in glucose metabolism by improving the insulin signaling pathway and hepatic glycogenesis. 27 Moreover, zinc oxide nanoparticles (ZnO NPs) regulated blood glucose in diabetic rats due to their potent anti-diabetic effect by modulation of the glycemic parameters along with reducing the production of free radicals. Conclusively, nano-formulation of luteolin with Zn in the form of Lut/ZnO NPs may improve efficacy/bioavailability and enhance its delivery and thus augment the anti-diabetic effect.
Therefore, this study is designed to evaluate the effectiveness of Lut/ZnO NPs in ameliorating hyperlipidemia and diabetes-associated NAFLD and insulin resistance, particularly through its impact on PI3K/AKT/FoxO1 signaling pathway.
Materials and methods
Materials
Luteolin, Streptozotocin (STZ), and all chemicals used in this study were obtained from Sigma–Aldrich® (St Louis, Missouri, USA).
High-fat diet (HFD) was obtained from El-Nasr Co. (Cairo, Egypt), consisting of 45% carbohydrate, 20% protein, and 35% fat.
Luteolin/ZnO nano-dispersions preparation (Lut/ZnO NPs)
Luteolin/ZnO nano-dispersions was prepared first as a stock. A 0.5 g of luteolin was dissolved in 200 mL distilled water under heating for nearly 1 h. Then the obtained luteolin solution was left to settle and the supernatant was taken and stored for the next step. After that, 100 mL of luteolin solution was added to 100 mL of zinc acetate (1000 ppm) under vigorous stirring using a magnetic stirrer and heated at 80 o C. Next, 200 mL of NaOH (0.5 M) was added drop by drop wisely and slowly until the reaction is complete. Then, the solution was left to settle and washed several times with distilled water by decantation and the final solution reached 100 mL, then exposed to a dose of 10 KGy and placed in a clean bottle and sealed carefully until further use. The concentration of ZnO/Luteolin nanodispersions was calculated to be 0.006 g/mL.
Characterization of luteolin/ZnO nanodispersions
The morphology and size of the luteolin/ZnO nanodispersion (Lut/ZnO NPs) were analyzed by Transmission Electron Microscopy (TEM). The luteolin/ZnO nanodispersion was dried and placed on an ultra-thin carbon-supported Cu grid and examined by TEM (JEOL; model JEM100CS, Japan). Additionally, dynamic light scattering (DLS) was used to determine the particle size distribution via fluctuation of scattered light intensity by the particles in Brownian motion using the Zeta sizer. Moreover, the X-ray diffraction (XRD) spectrum was obtained using the XD-DI Series, and the Scherer equation was used to calculate the particle size of Lut/ZnO NPs. Additionally, the UV/Vis spectrum of luteolin and Lut/ZnO NPs samples of both were detected by Ultraviolet-Visible spectroscopy (T60 UV-Vis spectrophotometer) (PG instruments) at 190–1100 nm.
Determination of LD50 of Lut/ZnO NPs
In order to determine the optimal dose with no observed adverse effects, female rats were used to calculate the LD50 value of Lut/ZnO NPs according to the method of Reed and Muench
28
and Bass et al.
29
The median lethal dose (LD50) of Lut/ZnO NPs was determined using a dose range from 1.2 to 120 mg/kg body weight. After 24°h, mortality was observed, and LD50 was calculated from the following equation:
Experimental animals
Sixty male Wistar rats (12-month-old) weighing approximately 240–250 g were brought from the Egyptian National Authority for Drug Research and Control, Cairo, Egypt. During the experimental period, all rats had free access to food and water and were placed in identical laboratory conditions with a light/dark cycle of 12°h, humidity of 50 ± 15%, and temperature of 22 ± 2°C. The use of experimental animals has been handled under the standards and guidelines of the National Research Center Ethics Committee published by the U.S. National Health Institutes (NIH publication No. 85–23, 1996) and the National Research Center Ethics Committee. Additionally, it was approved by the Institutional Animal Care and Use Committee (Vet CU 2305 2022463)
Experimental groups
After the accommodation period, the rats were randomly classified into six groups (n = 10) as follows: 1. Normal control group: where the rats were fed with a normal rat diet and were injected with saline intraperitoneally. 2. Lut/ZnO NPs group: the rats were fed with a normal rat diet and were injected with Lut/ZnO NPs intraperitoneally at a dose of 12 mg/kg/body weight three times/week for 3 weeks. 3. HFD group: the rats fed on HFD for 12°weeks and did not receive any treatment 4. HFD+ Lut/ZnO NPs group: the rats were fed with HFD and treated with Lut/ZnO NPs as in group 2. 5. 5HFD+ STZ group: the rats received a single dose of STZ intraperitoneally (35 mg/kg body weight) dissolved in citrate buffer (pH 4.5).
30
6. HFD+STZ+ Lut/ZnO NPs group: where the rats were injected with STZ, like group (5) and treated with Lut/ZnO NPs, like group (2).
After 3 days of the injection with STZ, an ACCU-CHEK glucometer was used to measure Fasting Blood Glucose (FBG) levels to assure the induction of T2DM. The rats with FBG levels greater than or equal to 11.1 mmol/L (288 mg/dl) were counted as diabetics and were used to complete the experiment.
After the experimental period, all rats were sacrificed under diethyl ether anesthesia and the blood samples were gathered via cardiac puncture and divided into two tubes. One for plasma to measure the glucose levels, and the other one to obtain serum for further biochemical estimates. Liver tissues were separated immediately, washed with 0.9% physiological saline, and divided into two parts. The first part was used for the histological examinations, while the second one was stored at −80°C for further analysis.
Serum biochemical estimations
The FBG levels were measured with an ACCU-CHEK glucometer. A commercial ELISA kit (My Biosource Inc., San Diego California, USA) was used to quantify insulin levels in the serum. The homeostasis model assessment of insulin resistance (HOMA-IR) index is an indicator of insulin resistance. It was determined for each rat as follows: HOMA-IR = [fasting insulin (μU/ml) x fasting glucose (mmol/l)]/22.5. 31
Molecular estimations (Reverse transcription-quantitative PCR (RT-qPCR)
Total RNA was extracted from liver tissues using TRIzol reagent (Life Technologies, USA). The synthesis of the complementary DNA (cDNA) was done with reverse transcriptase. According to the manufacturer’s protocol of SYBR Green PCR Master Mix (Applied Biosystems TM), the reaction reagents were added, the conditions were adjusted, and gene amplification was performed by PCR. The primer sequences were as follows: PDK1, F: 5′-AAGGGTACGGGCCTCTCAAA-3′ and R: 5′-CCCACGTGATGGACTCAAAGA-3′; G6pase, F: 5′-CGTCACCTGTGAGACTGGAC-3′ and R: 5′-ACGACATTCAAGCACCGGAA-3′; HO-1, F: 5′-CGACAGCATGTCCCAGGATT-3′ and R: 5′-TCGCTCTATCTCCTCTTCCAGG-3′ β-actin, F: 5′ CCAGGCTGGATTGCAGTT3′ and R: 5′GATCACGAGGTCAGGAGATG3. At the end of the reaction, the relative expression of the gene of interest was normalized to β-actin using the 2 −ΔΔCt method. 41
Histopathological examination of liver tissues
Liver tissues were fixed in a 10% buffered formalin solution and were embedded in paraffin by conventional methods. The tissues were cut into 3 μm sections and were stained with hematoxylin-eosin (H&E) stain. The stained sections were examined under a Light Microscope. According to the scale of Plaa et al., 43 the severity of lesions in the hepatic tissues were classified into grade 0: Normal structure (no injury), grade I: Swelling of hepatocytes, grade II: Ballooning of hepatocytes, grade III: Lipid droplets in hepatocytes, and grade IV: Apoptosis and Necrosis of hepatocytes.
Statistical analysis
All data are expressed as the mean± SE. Using the statistical package SPSS software version 20, a one-way analysis of variance (ANOVA) followed by post-hoc multiple comparisons (LSD test) was used to evaluate the difference between groups at P-value <0.05 which is statistically significant. The charts were graphed via GraphPad Prism 8 (GraphPad, CA, USA).
Results
Using nanotechnology, luteolin which is hydrophobic was loaded on ZnO NPs to boost the bioavailability and solubility of luteolin as well as enhance its delivery and potentiate the therapeutic efficiency.
Characterization of Lut/ZnO NPs
As illustrated in Figure 1, the properties of Lut/ZnO nanodispersions were characterized by TEM, DLS, and XRD to give the size of each preparation. The size and morphology of the obtained Lut/ZnONPs were further confirmed by TEM studies. As shown in Figure 1(a), the TEM analysis of Lut/ZnONPs confirms that the particles reported here were almost hexagonal with particle sizes of approximately 17 nm. DLS analysis displayed that the mean size of the nanoparticles was about 172.6 nm as shown in Figure 1(b). XRD is used to confirm the formation and presence of ZnO nanoparticles, also to measure the particle size of the formed nanoparticles. Moreover, the XRD pattern of ZnO is shown in Figure 1(c) and the strong Bragg Reflection peaks at (2θ = 32.6°, 35.5°, 37.2°, 48.2°, 57.3°, 63.5°, 68.8°, and 70.1°), matched by their Miller indices ((100), (002), (101), (102), (110), (103), (112), and (004)), were obtained from a standard wurtzite ZnO structure (JCPDS Card No. 36–1451) Therefore, hexagonally structured ZnO was identified as a single crystalline phase in the Lut/ZnO nanoparticles with a mean particle size of 174.7 nm in agreement with the results obtained from the DLS particle size distribution of Lut/ZnO nanodispersion. UV-vis spectroscopic analysis of both ZnO NPs and Lut/ZnO nanodispersion showed the absorbance maxima from the phenyl rings of luteolin at about 340 and 390 nm (Figure 1(d). Characterization of Lut/ZnO NPs. (a): TEM, (b): DLS analysis of Lut/ZnO NPs size distribution, (c): XRD pattern of Lut/ZnO nanoparticles and (d): UV spectra of pure luteolin and ZnO/Luteolin nanodispersion.
LD50 of Lut/ZnO NPs
The results of the LD50 of the prepared Lut/ZnO NPs showed that the safe dose for the intraperitoneal (ip) injection was 12 mg/kg b wt, indicating the safety and absence of harmful effects of the Lut/ZnO NPs.
Effects of Lut/ZnO NPS on the blood glucose, insulin levels, and insulin resistance
Results in Figure 2 illustrated that the 12 weeks of the HFD feeding and injection with STZ resulted in a significant increase in FBG, fasting blood insulin, as well as HOMA-IR index (p < 0.05), which confirmed the induction of diabetes and insulin resistance in rats. However, the levels of FBG, insulin, and HOMA-IR were remarkably reduced upon treatment with Lut/ZnO NPs. These results suggest that Lut/ZnO NPs effectively ameliorated the glucose tolerance and insulin sensitivity in HFD-induced obesity and HFD+STZ-induced T2DM in rats, thus confirming the antidiabetic potential of the Lut/ZnO NPs. Effect of Lut/ZnO NPs on diabetic parameters: FBG (a), insulin (b), and HOMA-IR (c). Values were expressed as Means ± SE (n = 6). a: denote significant change versus control, b: denote significant change versus Lut/ZnO NPs, c: denote significant change versus HFD and d: denote significant change versus HFD+STZ at p < 0.05.
Effect of Lut/ZnO NPs on the insulin signaling pathway
To evaluate whether Lut/ZnO NPs reduced the blood glucose and improved insulin resistance through PI3K/AKT pathway, the expressions of IRS, PI3K, AKT, andFoxO1 in liver tissues were detected by western blot. Whereas the PCR was used to detect the expression of PDK1 and G6Pase in liver tissue. The current results reported that the expressions of IRS, PI3K/PDK1, and AKT levels were significantly downregulated along with the upregulation of FoxO1 (activate dephosphorylated form) and its downstream G6Pase in both obese and T2DM groups relative to the control group. In contrast, Lut/ZnO NPs treatment efficiently triggered the insulin signaling pathway via upregulating the expression of IRS, PI3K, and AKT) when compared to the obese and T2DM groups. Furthermore, the upregulated expressions of both FoxO1 and G6Pase were notably reversed upon treatment with Lut/ZnO NPs as shown in Figure 3. Effects of Lut/ZnO NPs on IRS, PI3K, PDK1, AKT, FoxO1 and G6Pase expression in hepatic tissues of NAFLD rat model. Quantitative western blotting analysis of IRS (a), PI3K (b), AKT (d), FoxO1 (e), and β-actin protein level. Western blotting of IRS, PI3K, AKT, FoxO1, and β-actin (f). Moreover, the gene expression of PDK1 (c) and G6Pase (g) was represented. Values were expressed as Means ± SE (n = 6). a: denote significant change versus control, b: denote significant change versus Lut/ZnO NPs, c: denote significant change versus HFD and d: denote significant change versus HFD+STZ at p < 0.05.
Effect of Lut/ZnO NPs on lipogenesis (SREBP1c)
Sterol regulatory element-binding protein 1c (SREBP1c) is the master regulator of lipid and cholesterol metabolism. Both HFD and HFD+STZ elevated the expression of SREBP1c protein as compared to the control group. In contrast, treatment with Lut/ZnO NPs showed an opposite effect through downregulating the SREBP1c expression as shown in Figure 4. Effects of Lut/ZnO NPs on SREBP1c protein expression in hepatic tissues of NAFLD rat model. Values were expressed as Means ± SE (n = 6). a: denote significant change versus control, b: denote significant change versus Lut/ZnO NPs, c: denote significant change versus HFD and d: denote significant change versus HFD+STZ at p < 0.05.
Effect of Lut/ZnO NPs on serum lipid profile
Effect of Lut/ZnO NPs on serum lipid parameters.
Triglycerides (TG) in serum (TGs) and liver tissue (TGt), total cholesterol (TC) and high-density lipoprotein cholesterol (HDL-C) contents. Values were expressed as Means ± SE (n = 6).
adenote significant change versus Lut/ZnO NPs.
bdenote significant change versus HFD.
cdenote significant change versus HFD+STZ at p < 0.05.
ddenote significant change versus control.
Effect of Lut/ZnO NPs on hepatic oxidative stress
Effect of Lut/ZnO NPs on hepatic oxidative stress status.
Values were expressed as Means ± SE (n = 6).
adenote significant change versus Lut/ZnO NPs.
bdenote significant change versus HFD.
cdenote significant change versus HFD+STZ at p < 0.05.
ddenote significant change versus control.

Effects of Lut/ZnO NPs on rat liver mRNA expression of HO-1 genes. Values were expressed as Means ± SE (n = 6). a: denote significant change versus control, b: denote significant change versus Lut/ZnO NPs, c: denote significant change versus HFD and d: denote significant change versus HFD+STZ at p < 0.05.
Effect of Lut/ZnO NPs on hepatic dysfunction
As shown in Figure 6, both HFD and HFD+STZ groups revealed dramatical increase in the ALT and AST activities compared with the control group. This indicated hepatic damage. However, treatment with Lut/ZnO NPs significantly reversed the deterioration in the activities of the hepatic enzymes, suggesting that Lut/ZnO NPs may have a hepatoprotective role. Effects of Lut/ZnO NPs on the liver enzymes, ALT (a) and AST (b). Values were expressed as Means ± SEM (n = 6). a: denote significant change versus control, b: denote significant change versus Lut/ZnO NPs, c: denote significant change versus HFD, and d: denote significant change versus HFD+STZ at p < 0.05.
Histopathological examination
The photomicroscopic image of both the control and Lut/ZnO NPs groups’ hepatic tissue section showed normal histological architecture of the liver (grade 0) (Figure 7 (a) and (b)). Meanwhile, the histopathological examination of hepatic tissues of the animals fed on HFD showed abundant fatty deposition in the hepatocytes forming signet ring cells that appeared as clusters scatter all over the hepatic lobules. Centrilobular coagulative necrosis of hepatocytes besides the hepatic cords mess and hyperplasia of Kupffer cells were found (grade IV) (Figure 7(c)). Similarly, the hepatic section of the HFD+STZ group showed severe damage to the hepatic lobules and fatty degeneration of hepatocytes, especially in the peripheral zone. Moreover, the hepatic parenchyma exhibited the perturbation of the hepatic cords and hyperplasia of Kupffer cells along with hepatocytes necrosis and dilatation of hepatic sinusoids (grade IV) (Figure 7(e)). On contrary, treatment of HFD with Lut/ZnO NPs resulted in restoring the regular arrangement of hepatic cords with some dilatation of hepatic sinusoids, binucleated cells, and hyperplasia of Kupffer cells (grade I) (Figure 7(d)). Additionally, the diabetic rats treated with Lut/ZnO NPs showed amelioration of the hepatic damage with the presence of a lower number of intracellular micro-vesicular steatosis, hyperplasia of Kupffer cells, and dilation of hepatic sinusoids (grade III) (Figure 7(f)). Photomicrograph of the hepatic tissue section. Figures (a and b) representing control and Lut/ZnO NPs showed a normal histological structure of the liver. However, Figure (c) (HFD) showed centrilobular coagulative necrosis of hepatocytes arrow. Figure (d) (HFD+ STZ) showed disorganization of hepatic cords, fatty degeneration, and necrosis of hepatocytes arrow. Lut/ZnO NPs treatment exhibited moderate hepatocytes swelling arrow (Figure (e)) and few numbers of intracellular microvesicular steatosis arrow (Figure (f)) representing the HFD+ Lut/ZnO NPs and HFD+ STZ+ Lut/ZnO NPs respectively (H&Ex200).
Discussion
Glucotoxicity or hyperglycemia associated with T2DM led to insulin resistance which is involved in the NAFLD pathogenesis. 44 It promoted the progression of NAFLD by increasing the contents of fatty acids in the liver, triggering hepatocellular dysfunction, inflammation, oxidative stress, and impaired the insulin signaling pathway. Moreover, it deranged insulin inhibition of hepatic glucose production and affected insulin sensitivity in muscle and adipose tissue.9,45
Consequently, the obtained results revealed that feeding rats with HFD and injection with STZ impaired glucose homeostasis, lipid metabolism, and tissue insulin sensitivity. This was evident via the higher levels of blood glucose (hyperglycemia) and insulin (hyperinsulinemia), and the increased value of HOMA-IR confirming the insulin resistance status in both HFD (obese) and HFD/STZ (diabetic) rats. These results are parallel to that of Mahmoud et al. 46 It was reported that Vornoli et al. 47 established a NAFLD model in rats using both HFD and low-dose STZ.
Consistently, the previous studies confirmed the strong connection between obesity, diabetes, and NAFLD in addition to insulin resistance, where the higher incidence of NAFLD was in both obese and diabetic. 48 Moreover, any defect in the insulin pathways and metabolism leads to insulin resistance and T2DM coupled with a higher risk of NAFLD progression. 49 Thus, hyperinsulinemia in NAFLD is related to the defective clearance but not to secretion of insulin, 50 whereas hyperglycemia resulted as a consequence of the impaired insulin signaling pathway and IR.
In this respect, our results showed a remarkable defect in the insulin signaling pathway manifested by the downregulated expression of IRS, PI3K, PDK1, and AKT with a concomitant upregulated expression of the nuclear FoxO1 which in turn activated the G6Pase a downstream target that promoted gluconeogenesis. These results agree with that of both Dwivedi et al. 30 and Lopes et al. 51 who reported that the status of insulin resistance is accompanied with the inhibition of the PI3K/AKT through FOXO1 activation promoting gluconeogenesis and thus hyperglycemia. Furthermore, Li et al. 8 reported that the protein levels of PI3K and Akt in the liver of NAFLD were decreased while their activation would promote liver regeneration and suppress the progression of NAFLD.
Conversely, following the treatment with Lut/ZnO NPs, the IRS/PI3K/AKT/FoxO1 was activated via upregulation of the phosphorylated levels of IRS, PI3K, and AKT in addition to increasing the PDK1 gene expression. This activation stimulated the phosphorylation of FoxO1, inhibiting its nuclear translocation and transcriptional function which subsequently diminished gluconeogenesis via downregulating the gene expression of the G6Pase. Supporting these results, Metallo et al., 52 Guo, 53 and Gu et al. 54 all reported that the activation of the PI3K/AKT signaling pathway inactivated FoxO1 and inhibits G6Pase expression and increased hepatic glucose uptake, therefore improving the glucose tolerance and the responsiveness of both hepatic and adipose tissue to the insulin action as well as the protection of tissue from damage and failure.
According to the previous results, luteolin mediated its anti-diabetic effect by regulating the glucose levels in the blood and enhancing the insulin sensitivity and responsiveness of the tissues via the modulation of the insulin signaling pathway (IRS/AKT) and amelioration of the insulin sensitivity.17,55 Additionally, Umrani and Paknikar 27 declared that the hypoglycemic effect of ZnO NPs was via suppression of gluconeogenesis, hence increasing the hepatic uptake and storage of glucose. Abdulmalek et al. 56 revealed that ZnO NPs significantly upregulated the phosphorylation of the IRS1/PI3K/AKT proteins. Therefore, based on the above-mentioned data, treatment with the Lut/ZnO NPs have a higher anti-diabetic efficiency due to the synergistic effect of luteolin and ZnO NPs.
Despite hyperinsulinemia, the insulin fails to control the hepatic metabolism, stimulating the excessive hepatic production of glucose (gluconeogenesis) via IRS/PI3K/PKB/FoxO1 even with the continuous lipid synthesis (lipogenesis) via SREBP1c leading to hyperglycemia and hyperlipidemia. This condition is known as selective hepatic insulin resistance. 7 Hardy et al. 57 showed that NAFLD was linked to dyslipidemia (dysregulated lipid metabolism) together with extreme deposition of different types of lipids, especially triglycerides.
Herein, there is a notable upregulation in the expression of SREBP-1c protein in the hepatic tissues of the HFD and HFD/STZ rats (both obese and diabetic rats). Additionally, it was found that hyperglycemia activated lipogenesis via carbohydrate responsive element-binding protein (ChREBP), a transcriptional factor that enhanced both lipogenesis and glycolysis lipogenesis along with hyperinsulinemia via SREBP1c which activated downstream lipogenic enzymes involved in hepatic lipogenesis. 58 Parallel to these results, Sanders et al. 59 indicated that insulin signaling increased the levels of SREBP1c in NAFLD.
Furthermore, Li et al. 60 confirmed that the higher SREBP-1c enhanced the synthesis and deposition of fatty acid and TG in the hepatic cells. Moreover, the obtained data showed remarkably increased levels of both TG and TC coupled with a decreased level of HDL-cholesterol. Consistent with the current results, Poulsen et al. 61 and Sun et al. 62 reported an elevation of the TG, VLDL-C, TC, LDL-C, and decreased HDL-C in dyslipidemia and NAFLD. Berlanga et al. 63 showed that the elevated levels of TG and TC were due to the insulin resistance status which enhanced the lipolysis of the peripheral adipose tissue and elevated the circulating free fatty acid flux to more than 59% which becomes the major origin of lipid delivered to the liver leading to the steatosis. Moreover, about 15% were derived from the ingestion of a fatty diet and 30% of the TG arose from de novo lipogenesis through the dysregulation in SREBP-1c- and FoxO-mediated hepatic insulin signaling.64,65
On contrary, Lut/ZnO NPs mitigated dyslipidemia in our result. Herein, Lut/ZnO NPs suppressed lipogenesis through the downregulation of SREBP1c which consequently reduced the levels of triacylglycerol and total cholesterol levels and enhanced that of the high-density lipoprotein cholesterol. Such results agreed with that of Liu et al. 66 and Zang et al. 67 who indicated that luteolin diminished the lipid accumulation in hepatocytes via the suppression of SREBP-1c and lipogenesis. Additionally, suppressing gluconeogenesis and restoring the insulin sensitivity of the body cells by luteolin prevented peripheral lipolysis decreasing the circulating levels of triglyceride and total cholesterol levels, thus reducing lipid delivery to the liver and alleviating hepatic steatosis.16,17
Previous studies reported the hypolipidemic effect of Zn and its synthesized ZnO NPs. Zinc regulated cellular physiology via modulation of the energetic metabolism (lipid and carbohydrate metabolism). 68 Wei et al. 69 showed that Zn supplementation reduced the lipid content in the hepatocytes by activating the oxidation of the free fatty acids and inhibiting lipogenesis. Moreover, it was found that Zn as well as ZnO NPs effectively reduced the levels of TC, TG, and LDL and increased the HDL in diabetic patients 70 and rats with HCC. 71 Notably, John et al. 72 confirmed the hypolipidemic potential of the ZnO nanoparticles, which may be attributed to behaving like insulin in the affected tissues, especially the pancreas 56 or its incorporation with the metalloenzymes that are responsible for lipid metabolism, thus inhibiting lipid biosynthesis. 73 Additionally, it was reported that ZnO NPs ameliorated the hepatic steatosis accompanied with insulin resistance by holding the SREBP-1c in the cytosol and preventing its nuclear translocation, thus hindering lipogenesis. 74 Collectively, ZnO nanoparticles hampered lipid accumulation in the hepatocytes by regulating pathways involved in lipid metabolism.
Considering hyperglycemia and dyslipidemia, the current data showed impairment in hepatic function and redox status. The hepatic lipotoxicity was coupled with a remarkable raise in the activity of the hepatic enzymes (ALT and AST) confirmed by the histopathological changes in the liver tissue. The nonalcoholic fatty liver is represented by disorganization of the liver architecture, hepatocyte injury, excessive fat deposition, and steatosis. These results coincide with that of Cheraghpour et al. 75 who pointed out that the hepatic injury and altered hepatic enzymes were attributed to dyslipidemia. Moreover, Raza et al. 76 and ALTamimi et al. 77 indicated that lipotoxicity induced mitochondrial β-oxidation, oxidative stress, and release of ROS that provoke liver damage. Similar to this, a marked increment in the lipid peroxidation and oxidized glutathione coupled with a sharp drop of the GSH content, and the activity of paraoxonase 1 (PON1) and hemeoxygenase-1 (HO-1) expression, were noticed in the current study. Moreover, Ağgül et al. 78 confirmed the depletion of the antioxidant content and excessive production of ROS in the diabetic model. Paraoxonase 1 (PON1) is a high-density lipoprotein (HDL) an associated enzyme involved in the protection of low-density lipoprotein and HDLs against lipid peroxidation. 79 However, the decreased activity of the PON1 in a diabetic model resulting from the impaired redox status is associated with plasma membrane injury and dysfunctional HDL. 80
Conversely, Lut/ZnO NPs with their hypoglycemic efficiency and suppressive effect on lipogenesis alleviated the hepatic lipotoxicity and damage, and attenuated liver functions by hindering the activities of the hepatic enzymes together with ameliorating the histology of the liver manifested by restoring the normal architecture. Regarding the potential antioxidant effect of ZnO NPs and luteolin, the synergetic effect of both the form of Lut/ZnO NPs controlled the impaired redox status and replenished the depleted antioxidant contents in the hepatic tissues. As shown in the results, upon treatment with Lut/ZnO NPs, the levels of lipid peroxidation and the oxidized glutathione declined together with the enhancement in the antioxidant status (GSH, HO-1, and PON1).
The previous results revealed that luteolin with its lipid-lowering effect besides its potent antioxidant effect reduced hepatic damage and dysfunction due to stabilization of plasma membrane and repairing the damaged hepatic tissue. 81 Additionally, Sangeetha 17 indicated that luteolin diminished ROS production via scavenging and suppression of the ROS-generating enzymes and pathways together with restoring the antioxidant content. Moreover, it alleviated diabetic nephropathy via increasing the HO-1 and AKT expressions. Similarly, the antioxidant efficiency of ZnO NPs was indicated in numerous studies, by their ability to scavenge free radicals and reduce ROS generation, 82 they can prevent oxidative cell damage and death induced by H2O2, hence alleviating the structural damage of the hepatic cells and improving hepatic function. 56 Moreover, ZnO NPs maintained the activity of paraoxonase in plasma. 83 Consequently, ZnO NPs alleviated the oxidative stress via their antioxidant, hypoglycemic, and hypolipidemic effects. Unfortunately, one of the limitations of this study is the absence of the sample size calculation in addition to the unavailability to perform histopathological analysis with the oil red staining for the liver tissue, which confirms the development of the NAFLD.
Conclusion
In conclusion, our results showed that the Lut/ZnO NPs substantially alleviated the hepatic injury and reduced the oxidative stress markers. Furthermore, the lipid load in the liver was diminished by lowering the levels of TG and TC besides suppressing lipogenesis and gluconeogenesis. Moreover, Lut/ZnO NPs activated the PI3K/AKT/FoxO1 signaling pathway, therefore improving the hepatic cells' insulin sensitivity. Consequently, Lut/ZnO NPs have a therapeutic effect on NAFLD and reduce its progression through their antioxidant, anti-diabetic, and lipid-lowering effects, besides regulating the insulin signal pathway in HFD/STZ-induced NAFLD in rats. However, further clinical estimations are needed to determine the potential mechanisms against liver disease.
Footnotes
Acknowledgments
For our assistance in the Luteolin/ZnO Nano-dispersions preparation, we thank associated professor Dr. Faten Ismail Abou El Fadl, Polymer Chemistry Department, National Center for Radiation Research and Technology (NCRRT), Egyptian Atomic Energy Authority.
We thank Prof. Dr. Ahmed Osman (professor of Pathology, Faculty of Veterinary Medicine, Cairo University) for his assistance in the histopathological assessment.
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) received no financial support for the research, authorship, and/or publication of this article.
Ethics approval
The use of experimental animals has been handled under the standards and guidelines of the National Research Center Ethics Committee published by the U.S. National Health Institutes (NIH publication No. 85–23, 1996) and the National Research Center Ethics Committee. Additionally, it was approved by the Institutional Animal Care and Use Committee (Vet CU 2305 2022463).
Animal welfare
The present study followed international, national, and/or institutional guidelines for animal treatment and complied with relevant legislation
Availability of data and materials
All data obtained from this study are included in the current manuscript.
