Abstract
Perinatal parvoviral infection causes necrotizing myocarditis in puppies, which results in acute high mortality or progressive cardiac injury. While widespread vaccination has dramatically curtailed the epidemic of canine parvoviral myocarditis, we hypothesized that canine parvovirus 2 (CPV-2) myocardial infection is an underrecognized cause of myocarditis, cardiac damage, and/or repair by fibrosis in young dogs. In this retrospective study, DNA was extracted from formalin-fixed, paraffin-embedded tissues from 40 cases and 41 control dogs under 2 years of age from 2007 to 2015. Cases had a diagnosis of myocardial necrosis, inflammation, or fibrosis, while age-matched controls lacked myocardial lesions. Conventional polymerase chain reaction (PCR) and sequencing targeting the VP1 to VP2 region detected CPV-2 in 12 of 40 cases (30%; 95% confidence interval [CI], 18%–45%) and 2 of 41 controls (5%; 95% CI, 0.1%–16%). Detection of CPV-2 DNA in the myocardium was significantly associated with myocardial lesions (P = .003). Reverse transcription quantitative PCR amplifying VP2 identified viral messenger RNA in 12 of 12 PCR-positive cases and 2 of 2 controls. PCR results were confirmed by in situ hybridization, which identified parvoviral DNA in cardiomyocytes and occasionally macrophages of juvenile and young adult dogs (median age 61 days). Myocardial CPV-2 was identified in juveniles with minimal myocarditis and CPV-2 enteritis, which may indicate a longer window of cardiac susceptibility to myocarditis than previously reported. CPV-2 was also detected in dogs with severe myocardial fibrosis with in situ hybridization signal localized to cardiomyocytes, suggesting prior myocardial damage by CPV-2. Despite the frequency of vaccination, these findings suggest that CPV-2 remains an important cause of myocardial damage in dogs.
Myocarditis in dogs is associated with devastating effects, including death or permanent cardiac damage. Frustratingly, the specific cause is often unknown, but systemic viral infections or bacterial agents are often implicated. 7,10,18 Canine parvovirus (CPV) is well known as a cause of myocarditis of young puppies; however, many veterinarians assume that widespread vaccination has nearly eliminated parvovirus (PV) myocarditis in dogs. 10,14,15,18 CPV is a member of the Parvoviridae family, which causes diseases of significant concern to veterinary medicine. Viruses of this family are small (23–26 nm in diameter), nonenveloped, and icosahedral with linear, single-stranded DNA genomes.
CPV emerged in the late 1970s as a cause of pandemic diarrheal illness. One of the most pathogenic viruses for canids, CPV-2 is associated with nearly 100% morbidity and up to 10% mortality in unvaccinated adults and 91% mortality in puppies. 20 Pathologic outcomes in puppies infected between 6 weeks and 6 months of age include acute hemorrhagic enteritis, panleukopenia, and lymphoid necrosis. Myocarditis of weanling puppies was also observed early in the CPV epidemic. 1,6,8,11,18,19,23,24 When infected within 2 weeks postpartum or, less commonly, late in utero, puppies of naive dams are susceptible to infection of cardiomyocytes and subsequent necrotizing myocarditis that results in high mortality. 13,18 Myocardial infection is frequently associated with cardiac failure or sudden death at 3 to 4 weeks of age. Puppies experimentally infected with CPV-2 as neonates demonstrated a sequential progression of cardiomyocyte necrosis and loss, followed by inflammation and then fibrosis that coincided with loss of viral inclusions and antigen. 18 Death related to progressive cardiac injury and heart failure may be delayed several months after infection with variable lymphocytic myocarditis and interstitial or replacement fibrosis observed in older puppies (7–15 weeks) surviving acute infection. 18,26
We considered that CPV-2 infection continues to be a frequent cause of myocarditis and subsequent myocardial damage, inflammation, and replacement fibrosis in young dogs. 4,12 Although a previous study did not identify myocardial viral nucleic acid by polymerase chain reaction (PCR) in adult dogs with dilated cardiomyopathy or myocarditis, we evaluated the hypothesis that myocardial CPV-2 infection is underrecognized and is associated with cardiac damage in dogs less than 2 years old. 16
Materials and Methods
Case Selection
Formalin-fixed, paraffin-embedded (FFPE) tissue from the New York Animal Health Diagnostic Center (AHDC) archives was used to evaluate the prevalence of CPV-2 in young dogs with myocarditis and/or myocardial fibrosis. A search of archived cases from June 2007 to November 2015 was performed to identify young dogs of any breed or sex that were 2 years of age or younger with diagnoses of “myocardial fibrosis,” “myocarditis,” “cardiac fibrosis,” “chronic myocarditis,” “fibrosing cardiomyopathy,” “cardiac failure,” “restrictive cardiomyopathy,” or “end-stage heart.” Controls were identified from a similar age distribution and time period using the aforementioned keywords as exclusion criteria to identify ostensibly healthy hearts.
Histopathology was evaluated by a veterinary pathologist (K.K.) blinded to disease status. Cardiac tissue from 40 dogs that were younger than 2 years old with evidence of myocarditis or fibrosis was scored histologically and compared to cardiac tissue from 41 controls. The severity of necrosis, inflammation, and fibrosis was scored on a scale of 0 to 3 (0 = absent, 1 = mild [up to 10%], 2 = moderate [10%–25%], and 3 = severe [over 25%], with percentages reflecting affected area of total tissue).
PCR
Nucleic acid was extracted from two 10-μm-thick FFPE tissue sections using the QIAamp DNA FFPE Tissue kit (QIAGEN, Valencia, CA). Conventional PCR was performed using housekeeping gene RPS19 primers and parvoviral VP1 to VP2 primers as previously described. 3,17 For all PCR experiments, negative and positive controls included “no-template” reaction and canine intestinal tissue with CPV-2 infection (confirmed by virus isolation). Amplicon sequencing was performed by the Cornell University Biotechnology Resource Center and analyzed using a Basic Local Alignment Search Tool (BLAST) search of GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Reverse transcription quantitative PCR (RT-qPCR) was performed using primers and probe to amplify the VP2 gene designed using Primer Express (Applied Biosystems, Foster City, CA) with specificity determined by BLAST alignment of the amplified sequence to available GenBank sequences. The probe was conjugated to a minor groove binder. Sequences of the primers and probe are CPV-992F, TGAGACCAGCTGAGGTTGGTT; CPV-1077R, TGCTGCAATAGGTGTTTTAAATGG; and CPV-P1014F, 6-FAM-TAGTGCACCATATTATTCT-MGB (numbering based on nucleotide position in VP2). The practical limit of detection was measured as 10 copies through serial dilution of a quantified CPV-2 VP2 amplicon generated using primers CPV-940F, CGTGGTGTAACTCAAATGGGAAA, and PV-1617R, GGATTCCAAGTATGAGAGGCTCTT.
RT-qPCR Reactions were performed using a StepOnePlus system (Applied Biosystems) with the PATH-ID Multiplex One-Step RT-PCR Kit (Applied Biosystems) and conditions of 48°C for 10 minutes followed by 95°C for 10 minutes, as well as 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. The reaction consisted of 200 μg of purified nucleic acid, 400 nM of each primer, and 120 nM of probe in a final volume of 25 μl. A no-template reaction served as negative control.
Immunohistochemistry
Immunohistochemistry (IHC) using rabbit antiserum against parvovirus (provided by C. Parrish) was performed on those cases and controls that were PV sequence positive. 5 Sections of myocardium (5 μm) were deparaffinized, rehydrated, and blocked for endogenous peroxidase (3% H2O2). Antigen retrieval consisted of microwaving slides in Antigen Unmasking Solution (Vector Laboratories, Burlingame, CA) for 20 minutes. Sections were incubated in Avidin, Biotin, and Protein block (Dako, Carpinteria, CA) before incubation with a 1:10 000 dilution of antiserum at 4°C. Sections were incubated with 1:200 biotinylated horse anti-rabbit secondary antibody (Vector Laboratories) for 30 minutes at room temperature. Sections were incubated with Vectastain ABC Elite reagent (Vector Laboratories) for 30 minutes at room temperature followed by DAB chromogen (Dako) and Mayer’s hematoxylin counterstain. Canine intestinal tissue with parvoviral enteritis (confirmed by IHC and virus isolation) and sections incubated without primary antibody served as controls.
In Situ Hybridization
In situ hybridization (ISH) was performed on CPV sequence-positive cases and controls using a commercially available kit (ACD RNAscope, Hayward, CA) and >20 double “Z” oligo pair probes designed to hybridize with nucleotides 2379 to 3712 of CPV-2/FPV spanning VP1 and VP2 DNA as previously described. 17,27 Appropriate controls were present in every run, including canine intestinal tissue with parvoviral enteritis (confirmed by IHC and virus isolation) and canine myocardial tissue probed with a Negative Control Probe-DapB (ACD RNAscope).
Slide images were scanned using a ScanScope CS0 or CS2 scanner (Aperio, Sausalito, CA) and ISH signal determined by Aperio Imagescope positive pixel algorithm.
Statistical Analysis
A 2-sided Fisher exact test was performed comparing cases and controls using a 95% confidence interval (CI) for CPV-2 (α = 5%). The association between myocardial necrosis and myocardial parvoviral DNA was similarly compared and described with the same procedures and α = 5%. The lesion prevalences in subsets of animals were described using Wilson score CIs. Correlation between CPV-2 quantity (by RT-qPCR) and ISH signal was compared using Spearman rank analysis. GraphPad Prism version 6.00 for Windows (GraphPad Software, La Jolla, CA) was used for statistical analysis.
Results
Case Demographics
A search of the New York State AHDC Archives identified 1911 canine cases from the search period with 106 cases identified using the database search terms (5.5%; 95% CI, 4.6%–6.7%). These cases of myocarditis represented 17.8% (95% CI, 15%–21.2%) of all cases having a cardiac morphologic diagnosis (106/593). Forty cases with available tissue were identified using search criteria (Suppl. Table S1).
The median age (minimum, maximum) of myocarditis/myocardial fibrosis cases was 84 (4, 730) days. There were 1 castrated male, 21 intact males, 2 spayed females, 15 intact females, and 1 of unknown sex. Breeds included mixed breed (7), Golden Retriever (4), Labrador Retriever (4), Beagle (3), Rottweiler (3), Wheaten Terrier (2), German Shepherd (2), Chihuahua (2), and 1 each of Vizsla, American Pit Bull Terrier, Belgian Malinois, Bull Mastiff, Dachshund, English Bulldog, English Springer Spaniel, Miniature Pinscher, Plott Hound, St. Bernard, Siberian Husky, Staffordshire Bull Terrier, and unknown.
Forty-one control cases were identified (Suppl. Table S1). The median age (minimum, maximum) of controls was 84 (2, 730) days. There were 2 castrated males, 16 intact males, 5 spayed females, 17 intact females, and 1 of unknown sex. Breeds included mixed breed (5), Golden Retriever (2), Labrador Retriever (3), Chihuahua (4), English Bulldog (2), Cane Corso (2), Pomeranian (2), and 1 each of Rhodesian Ridgeback, Scottish Deerhound, Shi Tzu, Toy Poodle, Siberian Husky, Staffordshire Bull Terrier, Dachshund, Pembroke Welsh Corgi, Coton de Tulear, French Bulldog, Jack Russell Terrier, Maltese, Newfoundland, Old English Sheepdog, Beagle, Vizsla, German Shepherd, Akita, and unknown breed.
A review of the pathology reports indicated that myocarditis was of sufficient severity to be considered the cause of death or a major contributor to demise in 26 of 40 (65%; 95% CI, 50%–78%) cases. Roughly half of the cases (21/40) were suspected to have an infectious etiology and further testing (IHC or virus isolation) was pursued in 47% (10/21). A cause was identified in only 2 cases, with PV antigen detected by IHC.
PCR
Conventional PCR using VP1/VP2 PV primers resulted in amplification of the expected 186-bp product in 12 of the 40 cases and 2 of the 41 controls. An amplicon <186 bp was present in 2 additional cases. The median age (minimum, maximum) of PCR-positive cases was 84 (21, 365) days. The median age (minimum, maximum) of PCR-negative cases was 80 (4, 730) days. PCR amplicon sequences were compared to those in GenBank using BLAST, and 12 of 14 cases and 2 controls matched banked CPV-2 sequences with high identity (Table 1, Suppl. Table S3). There was a statistically significant relationship (P = .003, Fisher exact test) between the presence or absence of myocardial lesions (ie, cases vs controls) and detection of CPV-2 DNA sequences.
Myocardial Histologic Characteristics of Canine Myocarditis Cases and Controls According to Detection of CPV VP1/2 by Polymerase Chain Reaction and Sequencing.a
CI, confidence interval; CPV, canine parvovirus.
aCases were dogs <2 years of age with a diagnosis of myocardial necrosis, inflammation, or fibrosis, and controls were dogs of similar age without these diagnoses.
RT-qPCR data matched with these conventional PCR and sequencing results. CPV-2 VP2 messenger RNA (mRNA) was amplified by RT-qPCR in 12 of the 12 cases and 2 controls having amplicon sequences matching banked CPV-2 (Table 2) with a reaction amplification efficiency of 97.9%. The 2 cases having an equivocal unsequenceable VP1/VP2 amplicon by conventional PCR were at or below the threshold of detection for the assay. The median quantity (minimum, maximum) of PCR-positive cases was 8.77 × 104 (2.23 × 101, 2.10 × 107) copies while both controls had comparatively low copy numbers (Table 2). CPV-2 mRNA was most abundant in younger dogs but was detected in older cases with severe myocardial fibrosis.
Demographics and Detection of Parvovirus in Myocarditis Cases and Controls With Myocardial CPV VP1/2 by PCR and Sequencing.a
D, days; CI, confidence interval; CPV, canine parvovirus; IHC, immunohistochemistry; INIBs, intranuclear inclusion bodies; ISH, in situ hybridization; RT-PCR, reverse transcription polymerase chain reaction; +, occasional signal; ++, moderate signal, +++, abundant signal; –, not detected.
aCases were dogs <2 years of age with a diagnosis of myocardial necrosis, inflammation, or fibrosis, and controls were dogs of similar age without these diagnoses.
Histopathologic Findings
Histopathologic findings are summarized in Table 1 and detailed in Supplemental Table S2. Of the 40 cases, 32 had some evidence of cardiomyocyte necrosis, 30 had inflammation, and 21 had some degree of myocardial fibrosis (Fig. 3). Inflammatory infiltrates included macrophages, lymphocytes, plasma cells, and neutrophils (Fig. 5). Of the 40 cases, 15 (38%; 95% CI, 24%–53%) had a combination of necrosis, inflammation, and fibrosis; 10 (25%) cases had predominantly necrosis; and 6 (15%) had predominantly fibrosis. Parvoviral intranuclear inclusions were identified in only 1 case (Fig. 1). One control had mild fibrosis.
The prevalence of cardiomyocyte necrosis, myocarditis, and myocardial fibrosis was compared in the 12 CPV-positive cases vs the 28 CPV-negative cases (Table 1). Cardiomyocyte necrosis was less frequent in CPV-positive vs CPV-negative cases (7/12 [58%] vs 25/28 [79%] cases; P = .003, Fisher exact test). CPV-positive and CPV-negative cases had a similar prevalence of myocardial inflammation (8/12 [67%] vs 22/28 [79%]) and myocardial fibrosis (7/12 [58%] vs 14/28 [50%]) (Table 1). Of the 12 CPV-positive cases (Figs. 3, 4), the predominant lesion was cardiomyocyte necrosis in 3 (21%), neutrophilic-histiocytic myocarditis in 2 (21%), lymphohistiocytic myocarditis in 2 (21%), myocardial fibrosis in 3 (21%), and mixed pattern in 2 (21%). In comparison, of the 28 cases lacking detectable CPV, the predominant lesion was cardiomyocyte necrosis in 11 (39%), myocarditis in 11 (39%), fibrosis in 2 (7%), and a mixed pattern in 5 (18%). Seven of the CPV-positive (58%) cases and 11 of the 28 (39%) cases without detectable CPV had a combination of necrosis, inflammation, and fibrosis. Myocardial perivasculitis/vasculitis (4/28) and myocardial inflammation with prominent neutrophils and/or macrophages (7/28) were histologic features unique to cases with undetectable CPV.
IHC
Parvoviral immunoreactivity was present in 7 of 12 of the CPV sequence-positive cases and 0 of 2 of the CPV sequence-positive control dogs (Table 2). The median (minimum, maximum) age was 56 (21, 152) days for PV IHC-positive dogs and 202 (126, 365) days for IHC-negative dogs. PV immunoreactivity was most abundant in younger dogs and was not detected in dogs older than 152 days.
ISH
Parvoviral ISH signal localized to the cytoplasm and/or nuclei of elongate strap-like cardiomyocytes and interstitial macrophages in areas of inflammation (Fig. 2). Parvoviral ISH signal was far more abundant in comparison to IHC (Figs. 6, 7; Table 2). Detectable hybridization signal was present in 9 of 12 of the CPV sequence-positive dogs with myocardial lesions; 2 of these dogs had multifocal cardiomyocyte necrosis, 2 had myocarditis, 2 had chronic lymphocytic-histiocytic myocarditis with fibrosis, and 3 had severe myocardial fibrosis (Figs. 3, 4). The median age (minimum, maximum) was 61 (21, 243) days for ISH-positive dogs and 263 (161, 365) days for ISH-negative dogs. As with IHC, ISH signal was most abundant in younger dogs; however, PV DNA was detected by ISH in cardiomyocyte nuclei in dogs up to 243 days old (Fig. 4) having severe myocardial fibrosis. Detectable hybridization was not present in CPV-2 sequence-positive control dogs (0/2).
Four cases not previously recognized to have CPV myocarditis were identified via ISH: 3 of these had PV enteritis, and 1 had myocarditis of previously unknown etiology that was negative by virus isolation.
There was good agreement between ISH detection (by visual detection) and levels of myocardial CPV-2 (by RT-qPCR, Table 2). There was a statistically significant correlation (r = 0.77; 95% CI, 0.41–0.92; P = .001; Suppl. Fig. S1) between myocardial ISH signal (by image analysis) and virus quantity (by RT-qPCR); however, comparison of quantified ISH signal and myocardial virus levels also indicates limitations to the sensitivity of ISH detection, particularly by image analysis.
Discussion
Our results from the 2007 to 2015 pathology archives support the hypothesis that CPV-2 infection is frequently associated with myocarditis and myocardial fibrosis in dogs younger than 2 years. Although it is reported that PV myocarditis is infrequent or eliminated in canine populations due to widespread vaccination, our data suggest that CPV-2 myocardial infection is a current underrecognized cause of cardiac damage in dogs. 15 In this recent cohort of dogs (2007–2015 archives), there was a statistically significant relationship between the presence of myocardial lesions and CPV-2 DNA.
Our ISH probes offer improved detection and diagnosis of parvovirus compared with current tissue-based methods of diagnosis that may be insensitive in the later stages of disease. 18 ISH also provides valuable contextual information about cellular localization, which is an advantage over other molecular techniques. We confirmed our PCR findings by ISH in the majority of our CPV-2 sequence-positive dogs. In these cases, ISH signal localized to cardiomyocytes and, less frequently, macrophages in areas of inflammation. Based on information in the pathology reports, roughly half of cases were suspected to have an infectious cause which, often was unconfirmed via initial ancillary testing. Using PCR and ISH, we identified PV DNA in several cases that previously did not have an identified cause. We demonstrated more frequent signal detection with ISH compared to IHC. Enhanced detection of PV in tissues via ISH is likely related to persistence of nucleic acid beyond the temporally limited inclusion bodies pathognomonic for CPV-2; detection of viral antigen by IHC undergoes dissipation similar to inclusions, also limiting its diagnostic utility. 18 In some cases in our retrospective study, there were discrepancies in the detection of viral targets by tissue-based visualization techniques compared to PCR. Our study reiterates the limitations of the tissue-based diagnostic tests in the identification of infectious agents, including CPV-2. The vast majority of the myocarditis cases with CPV-2 lacked characteristic intranuclear inclusions. While ISH is more sensitive than IHC, our data demonstrate PCR as a sensitive test for the detection of parvoviruses in the heart and suggest that PCR-based detection of CPV-2 in the myocardium of a young dog with myocarditis is a reliable, inexpensive, and rapid method to presumptively identify parvoviral myocarditis. In myocarditis/fibrosis cases, detection of myocardial CPV-2 DNA was associated with viable virus (detected by RT-qPCR and IHC).
Not surprisingly, most of our cases with myocardial CPV-2 DNA had lesions consistent with CPV-2 myocarditis. In addition, we identified parvoviral signal in cardiomyocytes in those dogs with CPV-2 enteritis that did not have a previously recognized myocardial infection. Intestinal and myocardial infection is not usually recognized concurrently in naturally or experimentally infected animals or litters, although virus isolated from myocardial tissues can cause enteritis experimentally. 10,18,24 Our data may indicate that subclinical myocardial PV infection (relative to enteric disease) may damage the myocardium and contribute to development of cardiac disease.
The age of CPV-2–positive dogs in our study suggests an expanded window of cardiac susceptibility to CPV-2. Parvoviruses require the machinery of mitotically active S-phase cells for viral replication; thus, cardiac susceptibility to CPV may be related to an initial high frequency of cardiomyocyte DNA synthesis in newborn animals and subsequent age-related decline in postnatal life. 2,21,22,25 Viral VP2 mRNA and ISH signal was most abundant in younger dogs (21–56 days), but myocardial viral mRNA was abundant in some older puppies with colocalization of the ISH signal to cardiomyocytes in dogs up to 84 days of age. Growth studies of the canine myocardium have suggested conditions favoring CPV-2 replication throughout the neonatal period until weaning. However, there is considerable variability in the growth of different dogs, depending on breed and other factors, which may affect cardiac development and susceptibility to PV myocarditis. 2,9
We also identified dogs with severe myocardial fibrosis and both viable virus (by detection of viral mRNA) and rare parvoviral DNA detectable by ISH, suggesting myocardial damage and replacement fibrosis related to previous PV infection. This association between PV detection and severe fibrotic cardiac disease adds to our current understanding of CPV pathogenesis.
Our data contrast with previous research that did not identify viral nucleic acid (CPV, adenovirus types 1 and 2, and herpesvirus) via PCR testing of FFPE samples of myocardium from 9 dogs with myocarditis or 18 dogs with an antemortem diagnosis of dilated cardiomyopathy. 16 Differences in detection of viral agents may be related to sample size and the age of the dogs in the study group.
While our data demonstrate high prevalence of myocardial CPV-2 DNA in young dogs with myocarditis/fibrosis, the cause of myocarditis remains unknown in most of our cases. Necrosis, consistent with a viral cause, was a frequent lesion in cases having undetectable myocardial parvoviral DNA. Myocardial perivasculitis/vasculitis and myocarditis with prominent neutrophils and/or macrophages were histologic features of cases lacking detectible PV DNA; these features suggest a variety of causes other than CPV-2, including bacterial agents.
Our study is limited as detection of an agent by PCR does not necessarily indicate causation. This study was limited to the detection of a single agent, and results do not exclude the involvement of other causes. This retrospective study was limited to dogs under 2 years of age; thus, the relevance of these findings to myocardial necrosis/inflammation/fibrosis of older dogs is unknown.
Our contemporary case-control retrospective study demonstrated that myocarditis and myocardial fibrosis in young dogs are frequently associated with PV infection. This finding suggests that PV infection of the myocardium is a current, underrecognized cause of cardiac damage in dogs. Furthermore, our data suggest an expanded window of cardiac susceptibility to PV myocarditis. ISH provides an alternative for the diagnosis of PV given the temporal limitations of antigen-based testing. While there are contextual limitations of PCR, it is a sensitive test for the detection of parvoviral myocarditis.
Footnotes
Acknowledgements
We thank Andrew Allison and the Colin Parrish lab for primer assistance, Dr. Hollis Erb for study design consultation, Melissa Laverack for expert technical assistance, Edward Dubovi for manuscript review, and the New York State Animal Health Diagnostic Center Histology Laboratory staff for technical support.
Declaration of Conflicting Interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: Student financial support was provided by the National Institutes of Health Training Grant T35OD010941 and the AVMA-AVMF 2nd Opportunity Research Scholarship.
Supplementary material for this article is available online.
References
Supplementary Material
Please find the following supplemental material available below.
For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.
For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.
