Dual-specificity phosphatase 14 inhibits the growth of cervical cancer cells by regulating the transforming growth factor-beta-activated kinase 1 and NOD-like receptor pyrin domain containing 3 inflammatory pathways

Abstract

Objective

This study investigated the role and mechanism of dual-specificity phosphatase 14 in cervical cancer.

Methods

In this experimental study, clinical samples from five patients with cervical squamous cell carcinoma and five with chronic cervicitis were analyzed. Dual-specificity phosphatase 14 was overexpressed in HeLa and SiHa cells. Gene and protein expression levels were analyzed using real-time quantitative polymerase chain reaction and western blot analysis. Cell viability, apoptosis, and migration were assessed using cell counting kit-8, flow cytometry as well as Transwell and wound healing assays. Cytokine levels were measured using enzyme-linked immunosorbent assay.

Results

Dual-specificity phosphatase 14 expression was significantly downregulated in cervical cancer tissues and cell lines compared with that in their respective controls (p < 0.05). Dual-specificity phosphatase 14 overexpression markedly inhibited cell viability and induced apoptosis in HeLa and SiHa cells (p < 0.05). Furthermore, it significantly suppressed cell migration (p < 0.05). At the molecular level, dual-specificity phosphatase 14 upregulation decreased messenger ribonucleic acid levels of transforming growth factor-beta-activated kinase 1, NOD-like receptor pyrin domain containing 3, interleukin-1 beta, and tumor necrosis factor-alpha; reduced protein levels of phosphorylated transforming growth factor-beta-activated kinase 1 and NOD-like receptor pyrin domain containing 3; and diminished secretion of interleukin-1 beta and tumor necrosis factor-alpha cytokines (p < 0.05).

Conclusion

Dual-specificity phosphatase 14 acts as a tumor suppressor in cervical cancer by inhibiting proliferation and migration, promoting apoptosis, and suppressing the transforming growth factor-beta-activated kinase 1/NOD-like receptor pyrin domain containing 3 inflammatory pathway, highlighting its potential as a novel therapeutic target and biomarker.

Keywords

Cervical cancer dual-specificity phosphatase 14 apoptosis transforming growth factor-beta-activated kinase 1 NOD-like receptor pyrin domain containing 3

Introduction

Cervical cancer is one of the most common types of cancer responsible for morbidity and mortality in women worldwide. According to data from the World Health Organization, approximately 660,000 new cases and 350,000 deaths were reported globally in 2022’s.¹ Approximately 80% of these cases were reported in developing countries.² Therefore, early diagnosis or mitigation of cervical cancer progression is an urgent need. Understanding cervical cancer pathogenesis and developing individualized treatment strategies are essential for improving the quality of life of cervical cancer patients and reducing mortality rates.

Cervical cancer progression involves multiple molecular mechanisms, among which tumor necrosis factor-alpha (TNF-α), transforming growth factor-beta-activated kinase 1 (TAK1), and NOD-like receptor pyrin domain containing 3 (NLRP3) inflammasome play key roles in regulating tumor metastasis and invasion. TNF-α is a cytokine that performs dual functions. Under normal conditions, it exerts antitumor effects. However, when abnormally elevated, it promotes the proliferation, migration, and invasion of tumor cells and is closely related to cervical cancer progression.³ Moreover, TAK1, as an upstream regulatory factor of TNF-α, may influence the metastasis and invasion of cervical cancer by modulating TNF-α signaling.⁴ Additionally, NLRP3-mediated pyroptosis is implicated in cervical cancer progression.^5,6

Dual-specificity phosphatases (DUSPs) constitute a group of heterogeneous protein phosphatases capable of dephosphorylating tyrosine and serine/threonine residues in substrates, thereby regulating the mitogen-activated protein kinase (MAPK) signaling pathway, which regulates cell proliferation, differentiation, and immune responses.^7,8 Furthermore, it plays a significant role in the occurrence, development, and treatment resistance of tumors.⁹ Dual-specificity phosphatase 14 (DUSP14) is shown to negatively regulate TNF-α or interleukin-1 beta (IL-1β)-induced nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) activation by dephosphorylating TAK1 activated by transforming growth factor-β,¹⁰ which may inhibit the malignant progression of cervical cancer. Moreover, DUSP14 may also influence the growth and metastasis of cervical cancer by inhibiting the NLRP3/IL-1β inflammasome pathway.¹¹ However, the regulatory role and mechanism of DUSP14 in cervical cancer remain unclear.

Therefore, we designed this study to investigate the regulatory effects of DUSP14 on cell proliferation, apoptosis, and migration of cervical cancer and explore the underlying mechanisms. Our findings may provide new strategies for the treatment of cervical cancer.

Methods

Human tissue collection

Cervical tissue samples were collected from five patients diagnosed with cervical squamous cell carcinoma and five patients with chronic cervicitis. The patients with cervical squamous cell carcinoma were admitted between November 2023 and January 2024 for surgical treatment of cervical cancer. The average age of the patients was 47 years. Tissue samples were collected intraoperatively. All 5 patients with cervical squamous cell carcinoma were confirmed to be positive for high-risk human papillomavirus (HPV, 16/18) via clinical pathology testing, while the 5 patients with chronic cervicitis were HPV-negative. This study was performed in accordance with the Declaration of Helsinki of 1975, as revised in 2024. The study protocol was reviewed and approved by the Ethics Committee of the Affiliated Tumor Hospital of Xinjiang Medical University (Xinjiang, China) (Approval No.: G-2023022; date: 7 March 2022). Written informed consent was obtained from each patient.

Cell lines and culture

Human primary cervical epithelial cells (#HUM-iCell-f016), C-33A cells (#iCell-h031, RRID: CVCL_1094), HT-3 cells (#iCell-h519, RRID: CVCL_1293), HeLa cells (#iCell-h088, RRID: CVCL_0030), and SiHa cells (#iCell-h188, RRID: CVCL_0032) were obtained from iCell Bioscience Inc. (Shanghai, China). All cell lines were authenticated by the provider and used within 15 passages after resuscitation. No further authentication was performed by the authors. The C-33A cell culture medium consisted of minimum essential medium (MEM) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. The culture medium for HT-3 cells was McCoy’s 5 A, containing 10% fetal bovine serum and 1% penicillin-streptomycin. HeLa and SiHa cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. The human primary cervical epithelial cells were maintained in a specialized culture medium (#iCell-f016-002h; iCell). The culture conditions were set at 37°C and 5% CO₂.

Cell transfection

DUSP14 overexpression plasmid (pcDNA3.1-DUSP14-3xFlag-C) and negative control plasmid (pcDNA3.1-3xFlag-C) were obtained from Jiangsu Saisuofei Biotechnology (Wuxi, China). Cell transfection was performed using jetPRIME transfection reagents (#PT-114-75, Polyplus, Illkirch, France). Briefly, 200 µL of jetPRIME buffer was mixed with 2 µg of plasmids. Subsequently, 4 µL of jetPRIME reagent was added, mixed well, and incubated at room temperature for 10 min. Then, the mixture was added to the culture medium of the HeLa and SiHa cells, and after 4–6 h, the fresh medium was replaced under conditions of 5% CO₂ and 37°C.

Cell counting kit-8 (CCK-8) assay

After transfection, cells were seeded in a 96-well plate and cultured for 24, 48, and 72 h. Then, cell viability was detected using the CCK-8 assay with a CCK-8 detection kit (Dojindo Laboratories, Kumamoto, Japan, #CK04). Briefly, 10 µL of CCK-8 solution was added to each well, and the culture plate was incubated at 37°C in a 5% CO₂ atmosphere for 3 h. Subsequently, the optical density of each well was measured at 450 nm using an EnVision® Xcite 2105 multimode plate reader (Perkin Elmer, Waltham, MA, USA). Cell viability (%) was calculated using the formula: (experimental group absorbance − blank group absorbance)/(control group absorbance – blank group absorbance) × 100%. The assay was performed using three independent biological replicates.

Flow cytometry detection of apoptosis

Cell apoptosis was detected using the Annexin V conjugated with fluorescein isothiocyanate (Annexin V-FITC)/propidium iodide (PI) Apoptosis Detection Kit (#40302ES60, Yeason, Shanghai, China; Lot no. A1213528). Specifically, after 48 h of transfection, the cells were collected, washed twice with precooled phosphate-buffered saline (PBS), and centrifuged at 200 g for 5 min at 4°C each time. After centrifugation, the cells were resuspended in 100 μL of 1× binding buffer. Subsequently, 5 μL of Annexin FITC and 10 μL of PI were added, mixed gently, and incubated in the dark at room temperature for 15 min. Finally, 400 μL of 1 × binding buffer was added, mixed again, and the samples were analyzed using a flow cytometer (CytoFLEX-S, Beckman Coulter, Brea, CA, USA) within 1 h. For data analyses, cells were categorized as follows: viable cells (Annexin V− PI−), early apoptotic cells (Annexin V+ PI−), late apoptotic/necrotic cells (Annexin V+ PI+), and necrotic cells (Annexin V− PI+). The total apoptosis rate was defined as the sum of early and late apoptotic cells (Annexin V+ cells). Each experiment was performed in triplicate (technical replicates) and repeated in three independent biological replicates.

Cell scratch assay

Cells were collected 48 h post-transfection and seeded in 6-well plates. After 24 h of culture, a 10-μL pipette tip was used to create vertical scratches in the cell layer on the well plate, ensuring that the width of the scratches was consistent. To facilitate subsequent localization, horizontal lines were marked on the back of the 6-well plate before cell seeding. Following scratching, the culture medium in the wells was aspirated, and the wells were washed thrice with PBS to remove cell debris. Serum-free medium was then added. The culture plate was placed in an incubator, and photographs were taken at 0, 24, and 48 h. Finally, the relative migration rate (%) was calculated as follows: (initial scratch width−scratch width after 24/48 h)/initial scratch width ×100%. The assay was performed using three independent biological replicates.

Transwell migration assay

After transfection for 48 h, the cells were collected and resuspended in a serum-free medium. The density of HeLa cells was set to 1.5 × 10⁵/mL, while the density of SiHa cells was 5 × 10⁵/mL. Then, 200 µL of the cell suspension was added to the upper chamber of the Transwell insert, and 600 µL of medium containing 10% fetal bovine serum was added to the lower chamber of a 24-well plate. After incubation at 37°C for 24 h, the Transwell chamber was removed, and the cells were fixed with 4% paraformaldehyde for 10 min, followed by two washes with PBS. Subsequently, staining with crystal violet was performed for 10 min, and then the cells were washed twice with PBS, while the cells from the upper chamber were removed using a cotton swab. Finally, the migrated cells at the bottom of the chamber were observed under a microscope. Three fields of view were randomly selected for photography and cell counting. The assay was performed using three independent biological replicates.

Enzyme-linked immunosorbent assay (ELISA)

Cell culture supernatant was collected at 48 h after transfection. The levels of IL-1β and TNF-α were assessed according to the instructions in the Human IL-1β ELISA Kit (Elabscience, Wuhan, China, #E-EL-H0109) and Human TNF-α ELISA Kit (Elabscience, #E-EL-H0149). The assay was performed using three independent biological replicates.

Real-time quantitative polymerase chain reaction (RT-qPCR)

Cells were collected from each group at 48 h after transfection. Total ribonucleic acids (RNAs) were extracted from cells and tissues. The reaction system (10 μL) for removing genomic DNA was composed of 1 μg RNA, 2 μL 5x gDNA Remover mix (TSINGKE), and 7 μL RNase-free water. The reaction was performed at 42°C for 2 min and then at 60°C for 1 min. For the reverse transcription reaction, 4 μL of 5× SynScript^TM RT SuperMix (TSINGKE) and RNase-free water were added to a final volume of 20 μL. The reaction was conducted at 50°C for 15 min and at 85°C for 5 s. The primers for RT-qPCR of DUSP14, TAK1, TNF-α, NLRP3, and IL-1β are listed in Table 1. The composition for the RT-qPCR reaction was as follows: 0.4 µL of forward primer (10 µM), 0.4 µL of reverse primer (10 µM), 10 µL of ArtiCanATM SYBR qPCR Mix (TSINGKE), 1 µL of cDNA template, and 0.4 µL of 50×ROX Reference Dye I/II (TSINGKE) to make up a final volume of 20 μL using RNase-free water. The RT-qPCR was conducted on the Viia7 1.0 Real-Time PCR system (ABI, Foster City, CA, USA) under the following conditions: 95°C for 1 min and 40 cycles of 95°C for 10 s, 60°C for 20 s, and 72°C for 15 s. Gene-level quantification was performed using the 2^−ΔΔCt method. Each RT-qPCR reaction was run in duplicate (technical replicates), and experiments were repeated for three independent biological replicates.

Table 1.

Primer sequences.

Name		Nucleotide sequence (5ʹ-3ʹ)	Size, bp
GAPDH	Forward	TCAAGAAGGTGGTGAAGCAGG	115
GAPDH	Reverse	TCAAAGGTGGAGGAGTGGGT	115
TAK1	Forward	ATAACAAGGGGAGTGCTGCT	239
TAK1	Reverse	CCAACAACGAGTCATCAGGC	239
TNF-α	Forward	CTCTTCTGCCTGCTGCACTTTG	135
TNF-α	Reverse	ATGGGCTACAGGCTTGTCACTC	135
NLRP3	Forward	GTTTGACCCCGATGATGAGC	244
NLRP3	Reverse	CTTGTGGATGGGTGGGTTTG	244
IL-1β	Forward	CTGTACCTGTCCTGCGTGTT	155
IL-1β	Reverse	GGGAACTGGGCAGACTCAAA	155
Human DUSP14	Forward	GAGGGAGACATAGGAGGCAT	157
Human DUSP14	Reverse	ACTCAAATTGGGGCCAGTTG	157

GAPDH: glyceraldehyde-3-phosphate dehydrogenase; TAK1: transforming growth factor-beta-activated kinase 1; TNF-α: tumor necrosis factor-alpha; NLRP3: NOD-like receptor pyrin domain containing 3; IL-1β: interleukin-1 beta; DUSP14: Dual-specificity phosphatase 14.

Western blot analysis

At 48 h after transfection, cells were collected from different groups. Following tissue/cell lysis and protein extraction, protein concentrations were quantified using the bicinchoninic acid (BCA) method. The proteins were then subjected to electrophoresis and transferred to a membrane. Subsequently, the membrane was incubated in a 5% tris-buffered saline with Tween 20 (TBST) blocking solution on a shaking platform at room temperature for 1 h. Primary antibodies were added, including anti-DUSP14 (Rabbit monoclonal, Abclonal, Wuhan, China, #A10287, Lot no. 5500004955, 1:1000 dilution), anti-TAK1 (Rabbit polyclonal, Proteintech, #12330-2-AP, Lot no. 00170301, 1:500 dilution, RRID: AB_2140101), anti-phosphorylated TAK1 (p-TAK1) (Rabbit polyclonal, Proteintech, #28958-1-AP, Lot no. 00042072, 1:2000 dilution, RRID: AB_2918222), anti-NLRP3 (Rabbit monoclonal, Proteintech, #19771-1-AP, Lot no. 00010715, 1:500 dilution, RRID: AB_1064648), and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Mouse monoclonal, Proteintech, #60004-1-Ig, Clone: 1E6D9, Lot no. 10049290, 1:5000 dilution, RRID: AB_2107436). The incubation proceeded overnight at 4°C. The anti-rabbit secondary antibody (1:10,000; Jackson ImmunoResearch, West Grove, PA, USA, #111-035-003, Lot no. 170094, RRID: AB_2313567) was added for incubation for 1 h. Pierce™ ECL western blot substrate (Thermo, #32106) was used for color development, with results subsequently observed using a gel imaging system. Following development, western blot images were analyzed using ImageJ software (Version 1.53, National Institutes of Health, USA). The integrated optical density (IOD) of each target protein band and its corresponding GAPDH band was measured. The relative expression level of the target protein was calculated as the ratio of its IOD to the IOD of GAPDH from the same sample. All western blot experiments were conducted using three independent biological replicates.

Bioinformatics analysis of public immunohistochemistry data

To validate the protein expression pattern of DUSP14 in a broader clinical context, bioinformatics analysis was performed using publicly available data from The Human Protein Atlas database (https://www.proteinatlas.org). The immunohistochemistry staining results for the DUSP14 protein in human cervical squamous cell carcinoma tissue and normal cervical tissue were retrieved. The staining intensity and patterns in tumor tissues were visually compared with those in normal tissues by the authors to assess the differential expression.

Statistical analyses

Data analyses were performed using Statistical Package for Social Sciences (SPSS) software (version 25.0), and all data were expressed as mean ± SD. For the comparison of measurement data, t-test or one-way analysis of variance (ANOVA) followed by pairwise comparisons using the least significant difference (LSD) method was used as appropriate. The significance level was set at α = 0.05, indicating that a p-value <0.05 represents statistical significance, while a p-value <0.01 indicates high statistical significance.

Results

Reduced DUSP14 level in cervical cancer tissues

Five samples each of cervical tissue were collected from patients with cervical squamous cell carcinoma and chronic cervicitis. The messenger ribonucleic acid (mRNA) and protein expression levels of DUSP14 in cervical tissues were detected using RT-qPCR and western blot analysis. The mRNA level of DUSP14 was significantly lower in cancer tissues (Figure 1(a)). This downregulation was confirmed at the protein level, with quantitative analysis showing a significant decrease in DUSP14 protein expression compared with that in controls (p < 0.05, Figure 1(b)). Representative blots are depicted in Figure 1(c). To further validate this finding in a larger, independent clinical context, we analyzed publicly available immunohistochemistry data from The Human Protein Atlas database. Visual assessment confirmed that DUSP14 protein expression was markedly lower in cervical squamous cell carcinoma tissues than in normal cervical tissues (Supplementary Figure S1). Together, these results from both our experimental cohort and a public clinical database indicate that DUSP14 expression is downregulated in cervical cancer tissues.

Figure 1.

Expression levels of DUSP14 in cervical tissues. (a) RT-qPCR analysis of DUSP14 mRNA levels in normal control cervical and cervical cancer tissues. (b) Quantitative analysis of DUSP14 protein expression. Bar graph shows the relative protein levels (mean ± SD, normalized to GAPDH) from five tissue samples per group. *p < 0.05 vs. chronic cervicitis group. (c) Representative western blot images. RT-qPCR: real-time quantitative polymerase chain reaction; DUSP14: dual-specificity phosphatase 14; mRNA: messenger ribonucleic acid; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

Reduced DUSP14 expression in cervical cancer cells

To verify the DUSP14 expression in cervical cancer tissues, we examined its expression in vitro. RT-qPCR analysis confirmed that DUSP14 mRNA levels were significantly lower in cervical cancer cell lines (HeLa, SiHa, HT-3) than in normal cervical epithelial cells (Figure 2(a), p < 0.05). This reduction was further corroborated at the protein level. Quantitative analysis of western blots demonstrated a significant decrease in DUSP14 protein expression in all three cancer cell lines (p < 0.05, Figure 2(b)). Representative blot images are presented in Figure 2(c).

Figure 2.

Reduced DUSP14 expression in cervical cancer cells. (a) RT-qPCR analysis of DUSP14 mRNA level in each cell line. (b) Quantitative analysis of DUSP14 protein in each cell line. Bar graph shows the relative protein levels (mean ± SD, normalized to GAPDH) in three independent experiments. *p < 0.05 vs. normal cervical epithelial cells. (c) Representative western blot images. DUSP14: dual-specificity phosphatase 14; RT-qPCR: real-time quantitative polymerase chain reaction; mRNA: messenger ribonucleic acid; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

Verification of DUSP14 overexpression in cervical cancer cells

The efficacy of DUSP14 overexpression in HeLa cells was verified at both transcriptional and translational levels. RT-qPCR confirmed a significant increase in DUSP14 mRNA in the overexpression group compared with both control and negative control (NC) groups (Figure 3(a), p < 0.05). Critically, densitometric quantification of western blots revealed a corresponding and significant elevation of DUSP14 protein (p < 0.05, Figure 3(b)), confirming successful transfection. Representative blot images are presented in Figure 3(c).

Figure 3.

Verification of DUSP14 overexpression. (a) RT-qPCR analysis of DUSP14 mRNA level in each group. (b) Quantitative analysis of DUSP14 protein in each group. Bar graph shows the relative protein levels (mean ± SD, normalized to GAPDH) in three independent experiments. *p < 0.05 vs. Control group; ^#p < 0.05 vs. the NC group. (c) Representative western blot images. DUSP14: dual-specificity phosphatase 14; RT-qPCR: real-time quantitative polymerase chain reaction; mRNA: messenger ribonucleic acid; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; NC: negative control.

DUSP14 overexpression inhibits viability and induces apoptosis of cervical cancer cells

After DUSP14 overexpression in HeLa and SiHa cells, cell viability and apoptosis were assessed using CCK-8 and flow cytometry. In HeLa cells, viability in the DUSP14 overexpression group was significantly lower than that in the control group (p < 0.05) and decreased continuously over time (Figure 4(a)). Moreover, DUSP14 overexpression significantly induced apoptosis. Representative flow cytometry scatter plots are depicted in Figure 4(b). Quantitative analysis confirmed a significant increase in the percentages of total apoptotic, early apoptotic, and late apoptotic/necrotic cells compared with the control groups (p < 0.05, Figure 4(c)).

Figure 4.

Effect of DUSP14 overexpression on cell viability and apoptosis. (a) CCK-8 analysis of HeLa cell viability over time. (b) Representative flow cytometry scatter plots of HeLa cells. Apoptosis was assessed using Annexin V-FITC and PI staining. Quadrants indicate viable (Annexin V−/PI−), early apoptotic (Annexin V+/PI−), late apoptotic/necrotic (Annexin V+/PI+), and necrotic (Annexin V−/PI+) cells. (c) Quantitative analysis of apoptosis in HeLa cells. Bar graphs show the percentages of total apoptotic (Annexin V+), early apoptotic (Annexin V+ PI−), and late apoptotic/necrotic (Annexin V+ PI+) cells. Data are presented as mean ± SD values obtained from three independent experiments. (d) CCK-8 analysis of SiHa cell viability over time. (e) Representative flow cytometry scatter plots of SiHa cells (stained as in B). (f) Quantitative analysis of apoptosis in SiHa cells. Bar graphs show the percentages of total, early, and late apoptotic/necrotic cells. *p < 0.05 vs. the NC group. DUSP14: dual-specificity phosphatase 14; CCK-8: cell counting kit-8; Annexin V-FITC: Annexin V conjugated with fluorescein isothiocyanate; PI: propidium iodide; NC: negative control.

Similarly, in SiHa cells, viability in the DUSP14 overexpression group decreased continuously over time and was significantly lower than that in the control group (p < 0.05, Figure 4(d)). DUSP14 overexpression also significantly promoted apoptosis, as shown in representative scatter plots (Figure 4(e)). Corresponding quantitative analysis demonstrated a significant elevation in the total, early, and late apoptotic/necrotic cell populations (p < 0.05, Figure 4(f)).

DUSP14 overexpression inhibits the mRNA expression levels of TAK1, NLRP3, IL-1β, and TNF-α in cervical cancer cells

To determine the effect of DUSP overexpression on the mRNA expression levels of TAK1, NLRP3, IL-1β, and TNF-α in HeLa and SiHa cells, RT-qPCR was performed. As shown in Figure 5, the relative mRNA expression levels of these genes in the DUSP14 overexpression group were significantly lower than those in the control group (p < 0.05).

Figure 5.

Effect of DUSP14 overexpression on the mRNA expression levels of TAK1, NLRP3, IL-1β, and TNF-α. The mRNA level of each gene in HeLa and SiHa cells was measured using RT-qPCR. Data are presented as mean ± SD values obtained from three independent experiments (n = 3). *p < 0.05 vs. the NC group. DUSP14: dual-specificity phosphatase 14; mRNA: messenger ribonucleic acid; TAK1: transforming growth factor-beta-activated kinase 1; NLRP3: NOD-like receptor pyrin domain containing 3; IL-1β: interleukin-1 beta; TNF-α: tumor necrosis factor-alpha; NC: negative control.

DUSP14 overexpression inhibits the cytokine levels of IL-1β and TNF-α and protein expression levels of p-TAK1 and NLRP3

To detect the changes in the cytokine levels of IL-1β and TNF-α following DUSP14 overexpression, we performed ELISA. The results demonstrated that compared with the control group, IL-1β and TNF-α levels in HeLa and SiHa cells were significantly decreased in the DUSP14 overexpression group (p < 0.05) (Figure 6(a)). Additionally, the expression levels of TAK1, p-TAK1, and NLRP3 proteins were assessed using western blot; representative blots are depicted in Figure 6(b). Densitometric quantification revealed that DUSP14 overexpression significantly inhibited the levels of p-TAK1 and NLRP3 (p < 0.05, Figure 6(b)), while total TAK1 protein levels remained unchanged.

Figure 6.

Effect of DUSP14 overexpression on cytokine levels of IL-1β and TNF-α and protein levels of p-TAK1 and NLRP3. (a) Levels of IL-1β and TNF-α cytokines in HeLa and SiHa cells detected using ELISA. (b) Quantitative analysis and representative blots of TAK1 pathway proteins in HeLa and SiHa cells. Bar graphs show the relative protein levels (mean ± SD, normalized to GAPDH) in three independent experiments. *p < 0.05 vs. NC. Representative western blot images for the indicated proteins in HeLa and SiHa cells are also presented. DUSP14: dual-specificity phosphatase 14; IL-1β: interleukin-1 beta; TNF-α: tumor necrosis factor-alpha; p-TAK1: anti-phosphorylated transforming growth factor-beta-activated kinase 1; NLRP3: NOD-like receptor pyrin domain containing 3; ELISA: enzyme-linked immunosorbent assay; TAK1: transforming growth factor-beta-activated kinase 1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; NC: negative control.

DUSP14 overexpression inhibits cell migration

The changes in the migratory capacity of HeLa and SiHa cells after DUSP14 overexpression were assessed using Transwell and cell scratch assays. The cell scratch assay indicated that at both 24-and 48-h time points, the relative migration rate of HeLa and SiHa cells in the DUSP14 overexpression group was significantly lower than that in the control group (p < 0.05) (Figure 7(a)). Similarly, the Transwell assay showed that the DUSP14 overexpression group had a significantly reduced number of migrated cells than the control group (p < 0.05) (Figure 7(b)).

Figure 7.

Effect of DUSP14 overexpression on cell migration. (a) Cell migration assessed using scratch wound healing assay. Representative phase-contrast microscope images of HeLa and SiHa cell monolayers at 0, 24, and 48 h after scratching (scale bar = 200 μm). The graph shows the quantification of the relative migration rate. (b) Cell migration assessed using Transwell assay. Representative images of migrated HeLa and SiHa cells on the lower membrane surface, stained with 0.1% crystal violet (scale bar = 100 μm). The graph shows the quantification of the number of migrated cells per field. Data are presented as mean ± SD values obtained from three independent experiments (n = 3). *p < 0.05 vs. the NC group. DUSP14: dual-specificity phosphatase 14; NC: negative control.

Discussion

Studies have demonstrated abnormal expressions of DUSP family proteins in cancers such as pancreatic cancer, melanoma, and glioblastoma.^12,13 Currently, more than 40 types of DUSPs have been identified.¹⁴ High DUSP9 expression has been observed in hepatocellular carcinoma and breast cancer, correlating with patient prognosis.^15,16 In contrast, dual-specificity phosphatase 2 (DUSP2) downregulation has been noted in bladder, colorectal, and serous ovarian cancers, significantly relating to poor clinical outcomes and distant metastasis.^17–19 DUSP14 is a member of the atypical DUSP subgroup, initially reported to lack kinase interaction motifs. However, subsequent studies have revealed that although DUSP14 does not contain kinase interaction sequences made up of basic amino acids, it can regulate the activity of cell cycle-related kinases, such as MAPK, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK).^20,21

In this study, we found that the mRNA and protein expression levels of DUSP14 were significantly lower in the cervical cancer group than in the chronic cervicitis group. Similarly, DUSP14 levels in the cervical cancer cell lines, HeLa, SiHa, and HT3, were significantly lower than those in normal cervical epithelial cells. Our finding of reduced DUSP14 in cervical cancer is further supported by bioinformatics analysis of clinical immunohistochemistry data from The Human Protein Atlas, which shows lower DUSP14 protein levels in cervical carcinoma samples than in normal tissues. This is consistent with the findings reported by Kia et al., according to which, the DUSP14 downregulation in breast cancer promotes tumor growth and metastasis.²² However, other studies have indicated high DUSP14 expression in pancreatic cancer and non-small cell lung cancer.^23,24 This discrepancy suggests that DUSP14 performs different functions and acts via varying mechanisms in different cancers. Further analysis in this study revealed that upregulating DUSP14 expression significantly reduced the cell viability of cervical cancer cells while significantly increasing the apoptosis rate, particularly in HeLa and SiHa cells. In terms of migration capabilities, both cell scratch and Transwell assays showed significant reduction in the migration of cervical cancer cells in the group with DUSP14 overexpression. These results indicate that high DUSP14 expression may inhibit the malignant progression of cervical cancer cells by suppressing cell proliferation, reducing cell migration, and promoting apoptosis.

The transcription factor, NF-κB, plays a critical role in the inflammatory response, a process central to cancer progression. TAK1 is a pivotal upstream regulator of NF-κB activation induced by proinflammatory cytokines such as TNF-α and IL-1β.⁴ Our study, consistent with previous reports,^10,25 identified DUSP14 as a negative regulator of this axis in cervical cancer. Specifically, DUSP14 overexpression led to a reduction in p-TAK1 (the active form), aligning with established evidence that DUSP14 directly dephosphorylates TAK1 at its critical Thr-187 activation site.^25,26 This inhibition of TAK1 likely serves as the primary trigger for the observed antitumor effects. The downstream consequences of TAK1 inhibition are two-fold, explaining the coordinated suppression of multiple inflammatory mediators observed in our study. First, inactivated TAK1 fails to fully activate the NF-κB and MAPK pathways, leading to decreased transcriptional output. This directly accounts for the downregulation of classic NF-κB target genes, including TNF-α and IL-1β. Second, and crucially, the dampened NF-κB activity reduces the transcriptional “priming” of key components of the NLRP3 inflammasome, such as NLRP3 itself and pro-IL-1β.²⁷ This provides a mechanistic link between TAK1 inhibition and the observed reduction in NLRP3 expression. Consequently, diminished NLRP3 inflammasome assembly results in reduced caspase-1-mediated processing and secretion of mature IL-1β,¹¹ completing a coherent inflammatory suppression cascade. Therefore, we believe that DUSP14 exerts its tumor-suppressive function in cervical cancer through a central mechanism: dephosphorylation and inactivation of TAK1. This initial event subsequently attenuates both NF-κB/MAPK signaling axis and NLRP3 inflammasome pathway. The resultant downregulation of a network of proinflammatory and prosurvival factors (e.g. TNF-α and IL-1β) collectively remodels the tumor microenvironment, ultimately manifesting as inhibited cell proliferation and migration along with promoted apoptosis. Although our data strongly support this model, future studies employing co-immunoprecipitation to confirm the DUSP14–TAK1 interaction in cervical cancer cells and rescue experiments by reactivating TAK1 or NF-κB will be valuable to definitively establish the causal relationships within this pathway.

An important question arising from our findings concerns the relationship between DUSP14 downregulation and HPV infection, the primary cause of cervical cancer. Although we did not experimentally manipulate HPV to test this directly, several plausible connections can be inferred. The HPV oncoproteins E6 and E7 are master regulators that dysregulate host signaling pathways to promote carcinogenesis, including those governing inflammation and cell survival.^28,29 Intriguingly, these pathways intersect with the TAK1/NLRP3 axis identified here as a target of DUSP14. For instance, HPV E6/E7 can modulate NF-κB activity,³⁰ and viral infections are known to influence inflammasome signaling.³¹ Therefore, it is possible that HPV infection contributes to the suppression of DUSP14 expression as a strategy to dampen the host antiviral inflammatory responses or to sustain a prosurvival state favorable for viral persistence and oncogenesis. Conversely, the loss of DUSP14-mediated control over inflammatory signaling could potentially exacerbate the oncogenic processes driven by HPV. Future investigations should directly examine the following: (a) whether HPV oncoproteins transcriptionally or post-translationally regulate DUSP14 expression; (b) how DUSP14 levels correlate with specific HPV genotypes and viral load in clinical samples; and (c) if DUSP14 plays a role in the host defense against HPV or in the transition from persistent infection to malignancy. Clarifying this relationship is crucial to determine whether DUSP14 deficiency is a passenger event or an active facilitator in HPV-driven cervical carcinogenesis. As a direct and essential follow-up to the present work, future investigations should determine the effect of DUSP14 overexpression or knockdown on the expression levels of the key HPV oncoproteins E6 and E7 in HPV-positive cervical cancer cells. This will help establish if the tumor-suppressive activity of DUSP14 involves the downregulation of these primary viral oncogenic drivers or if it operates primarily through modulating downstream host pathways such as TAK1/NLRP3.

The identification of DUSP14 as a tumor suppressor in cervical cancer leads to the question of how its function can be therapeutically restored. Several strategies can be envisioned. First, direct gene therapy using viral or nonviral vectors to deliver the DUSP14 gene into tumor cells represents a potential but technically challenging approach. More feasibly, pharmacological activation of DUSP14 is an attractive avenue. This could involve screening for small molecules that either upregulate DUSP14 transcription or act as allosteric activators of its phosphatase activity. Alternatively, considering that we found that DUSP14 acts via the inhibition of TAK1 and NLRP3, a combination therapy approach could be highly effective. For instance, agents that target the downstream pathways (e.g. TAK1 inhibitors such as 5Z-7-oxozeaenol⁴ and NLRP3 inflammasome inhibitors) might synergize with strategies that partially restore DUSP14 function, offering a multi-pronged attack on the protumorigenic inflammatory axis. Furthermore, since DUSP14 expression is downregulated, investigating the role of epigenetic modulation (e.g. by demethylating agents or specific miRNA antagonists) could reveal reversible mechanisms to re-express DUSP14. Future research focused on these therapeutic strategies will be crucial for enabling the translation of the biological role of DUSP14 into tangible benefits for cervical cancer patients.

This study has certain limitations. First, the sample size of clinical tissues was relatively small. Second, although our RT-qPCR and western blot findings were supported by bioinformatics analysis of public immunohistochemistry data, we were unable to perform immunohistochemistry on our own cohort to visualize the spatial expression and precise subcellular localization of DUSP14 within the tumor microenvironment. Third, although functional assays conclusively demonstrated the effects of DUSP14 on cell proliferation, apoptosis, and migration, we did not assess the expression changes of associated molecular markers (e.g. Cyclin D1/B-cell lymphoma 2 (Bcl-2)-associated X protein (Bax), Bcl-2/matrix metalloproteinases (MMPs)), which could have provided a more detailed mechanistic link to the observed phenotypes. Future studies employing immunohistochemistry on a larger, independent cohort of paraffin-embedded tissues, along with analysis of such phenotypic markers, are warranted to validate and extend our findings.

Conclusion

Taken together, our findings demonstrate that DUSP14 is downregulated in cervical cancer. Functional experiments indicate that DUSP14 overexpression inhibits cell proliferation and migration and promotes apoptosis. Mechanistically, these effects are associated with the suppression of the TAK1/NLRP3 inflammatory pathway. Therefore, DUSP14 represents a potential therapeutic target for cervical cancer.

Supplemental Material

sj-pdf-1-imr-10.1177_03000605261441200 - Supplemental material for Dual-specificity phosphatase 14 inhibits the growth of cervical cancer cells by regulating the transforming growth factor-beta-activated kinase 1 and NOD-like receptor pyrin domain containing 3 inflammatory pathways

Supplemental material, sj-pdf-1-imr-10.1177_03000605261441200 for Dual-specificity phosphatase 14 inhibits the growth of cervical cancer cells by regulating the transforming growth factor-beta-activated kinase 1 and NOD-like receptor pyrin domain containing 3 inflammatory pathways by Yuanyuan Zhang, Qian Zhuo, Shaliya Abuduwufu and Aerziguli Wushouer in Journal of International Medical Research

Footnotes

Acknowledgments

Not applicable.

Author contributions statement

Yuanyuan Zhan designed the research study; Yuanyuan Zhan, Qian Zhuo, Shaliya Abuduwufu, and Aerziguli Wushouer performed the research and collected the data; YZ and QZ analyzed the data. Yuanyuan Zhan wrote the manuscript. All authors contributed to the editorial changes in the manuscript. All authors have read and approved the final manuscript.

Data availability statement

The datasets generated and/or analyzed during the current study are available in the Jianguoyun repository, .

Declaration of conflicting interests

The authors have no conflicts of interest to declare.

Funding

This study was supported by the “Tianshan Talents” High-Level Talent Training Program in Medicine and Health of Xinjiang Uygur Autonomous Region (grant No. TSYC202301B076).

ORCID iD

Yuanyuan Zhang

Supplemental material

Supplemental material for this article is available online.

References

Bray

Laversanne

Sung

, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024; 74: 229–263.

Arbyn

Weiderpass

Bruni

, et al. Estimates of incidence and mortality of cervical cancer in 2018: a worldwide analysis. Lancet Glob Health 2020; 8: e191–e203.

Wang

Jia

Wang

, et al. Scutellaria barbata inhibits epithelial-mesenchymal transformation through PI3K/AKT and MDM2 thus inhibiting the proliferation, migration and promoting apoptosis of cervical cancer cells. PLoS One 2025; 20: e0321556.

Guan

Zhao

, et al. TAK1 inhibitor 5Z-7-oxozeaenol sensitizes cervical cancer to doxorubicin-induced apoptosis. Oncotarget 2017; 8: 33666–33675.

Shi

Zhu

Study on the mechanism by which GDF11 regulates the NLRP3-mediated pyroptosis to inhibit the proliferation and metastasis of cervical cancer. J Sex Med 2023; 32: 69–73.Chinese

Liu

Xie

, et al. KIF23 promotes cervical cancer progression via inhibiting NLRP3-mediated pyroptosis. FASEB J 2024; 38: e23685.

Chen

Chuang

Yeh

, et al. Dual-specificity phosphatases 22-deficient T cells contribute to the pathogenesis of ankylosing spondylitis. BMC Med 2023; 21: 46.

Sanders

Yamamoto

McMellen

, et al. Targeting DUSP activity as a treatment for high-grade serous ovarian carcinoma. Mol Cancer Ther 2022; 21: 1285–1295.

Zandi

Kashani

Alishahi

, et al. Dual-specificity phosphatases: therapeutic targets in cancer therapy resistance. J Cancer Res Clin Oncol 2022; 148: 57–70.

10.

Wang

Mao

Fang

, et al. Dusp14 protects against hepatic ischaemia-reperfusion injury via Tak1 suppression. J Hepatol 2018; 68: 118–129.

11.

Fernandes

Cambui

RAG

Soares

, et al. Cervical carcinoma induces NLRP3 inflammasome activation and IL-1ß release in human peripheral blood monocytes affecting patients’ overall survival. Clin Transl Oncol 2023; 25: 3277–3286.

12.

Singh

Altameemi

Lares

, et al. Role of dual specificity phosphatases (DUSPs) in melanoma cellular plasticity and drug resistance. Sci Rep 2022; 12: 14395.

13.

Park

Wollmann

Urbiola

, et al. Sprouty2 enhances the tumorigenic potential of glioblastoma cells. Neuro Oncol 2018; 20: 1044–1054.

14.

Quintanal-Villalonga

Chan

, et al. Lineage plasticity in cancer: a shared pathway of therapeutic resistance. Nat Rev Clin Oncol 2020; 17: 360–371.

15.

Chen

Gorgen

Ding

, et al. Dual-specificity phosphatase 9 regulates cellular proliferation and predicts recurrence after surgery in hepatocellular carcinoma. Hepatol Commun 2021; 5: 1310–1328.

16.

Jimenez

Barrios

Tucker

, et al. DUSP9-mediated reduction of pERK1/2 supports cancer stem cell-like traits and promotes triple negative breast cancer. Am J Cancer Res 2020; 10: 3487–3506.

17.

Dong

Pei

, et al. Differential expression of DUSP2 in left- and right-sided colon cancer is associated with poor prognosis in colorectal cancer. Oncol Lett 2018; 15: 4207–4214.

18.

Yin

, et al. Loss of DUSP2 predicts a poor prognosis in patients with bladder cancer. Hum Pathol 2019; 85: 152–161.

19.

Liu

Tian

Ding

, et al. Expression of dual-specificity phosphatase 2 (DUSP2) in patients with serous ovarian carcinoma and in SKOV3 and OVCAR3 cells in vitro. Med Sci Monit 2019; 25: 10180–10189.

20.

Chuang

Tan

TH.

MAP4K family kinases and DUSP family phosphatases in T-cell signaling and systemic lupus erythematosus. Cells 2019; 8: 1433.

21.

Yang

Chiu

Tan

TH.

TRAF2-mediated Lys63-linked ubiquitination of DUSP14/MKP6 is essential for its phosphatase activity. Cell Signal 2016; 28: 145–151.

22.

Kia

Paryan

Mortazavi

, et al. Evaluation of exosomal miR-9 and miR-155 targeting PTEN and DUSP14 in highly metastatic breast cancer and their effect on low metastatic cells. J Cell Biochem 2019; 120: 5666–5676.

23.

Wei

Wang

, et al. Upregulation of DUSP14 affects proliferation, invasion and metastasis, potentially via epithelial-mesenchymal transition and is associated with poor prognosis in pancreatic cancer. Cancer Manag Res 2020; 12: 2097–2108.

24.

Zheng

Yang

Xie

, et al. miR-199a-5p targets DUSP14 to regulate cell proliferation, invasion and stemness in non-small cell lung cancer. Heliyon 2024; 10: e29102.

25.

Zheng

Chen

, et al. The dual-specificity phosphatase DUSP14 negatively regulates tumor necrosis factor- and interleukin-1-induced nuclear factor-κB activation by dephosphorylating the protein kinase TAK1. J Biol Chem 2013; 288: 819–825.

26.

Singhirunnusorn

Suzuki

Kawasaki

, et al. Critical roles of threonine 187 phosphorylation in cellular stress-induced rapid and transient activation of transforming growth factor-beta-activated kinase 1 (TAK1) in a signaling complex containing TAK1-binding protein TAB1 and TAB2. J Biol Chem 2005; 280: 7359–7368.

27.

Bauernfeind

Horvath

Stutz

, et al. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J Immunol 2009; 183: 787–791.

28.

zur Hausen

Papillomaviruses and cancer: from basic studies to clinical application. Nat Rev Cancer 2002; 2: 342–350.

29.

Moody

Laimins

LA.

Human papillomavirus oncoproteins: pathways to transformation. Nat Rev Cancer 2010; 10: 550–560.

30.

Pannone

Santoro

Papagerakis

, et al. The role of human papillomavirus in the pathogenesis of head & neck squamous cell carcinoma: an overview. Infect Agent Cancer 2011; 6: 4.

31.

Lamkanfi

Dixit

Mechanisms and functions of inflammasomes. Cell 2014; 157: 1013–1022.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.75 MB