Sage Journals: Discover world-class research

Abstract

Objective

To investigate the levels of microRNA-210 (miR-210) in the serum of patients with nonsmall-cell lung cancer (NSCLC) and to determine whether there was a correlation with the prognosis of NSCLC patients following cisplatin-based chemotherapy.

Methods

Quantitative real-time reverse transcription–polymerase chain reaction was used to measure the serum levels of miR-210 in patients with NSCLC and healthy age-matched control subjects. Correlations between serum miR-210 levels and clinicopathological factors and prognosis were investigated.

Results

Serum miR-210 was significantly upregulated in 60 patients with NSCLC compared with 30 healthy control subjects. Higher serum miR-210 levels were significantly correlated with the clinical stage and the presence of regional lymph node metastasis in patients with NSCLC. Serum miR-210 levels in patients that achieved a partial response following cisplatin-based chemotherapy were significantly lower than in patients with stable or progressive disease, and were similar to those in healthy control subjects.

Conclusions

These findings suggest that serum miR-210 levels might be a novel diagnostic and prognostic marker of NSCLC.

Keywords

Nonsmall cell lung cancer serum microRNA microRNA-210 prognostic significance

Introduction

Lung cancer is the leading cause of cancer-related death in both men and women worldwide.¹ In the United States in 2011, there were about 215000 new cases of lung cancer resulting in more than 156900 deaths.¹ Approximately 85% of all lung cancers are nonsmall-cell lung cancers (NSCLC), a heterogeneous group that is comprised of mostly squamous cell carcinomas and adenocarcinomas.² The lack of early diagnosis and effective treatment methods are the main causes of high mortality in patients with NSCLC, with the 5-year survival rate being 15–20%.² The development of novel biomarkers for the early detection of NSCLC is urgently needed to help improve the survival of patients with NSCLC.

MicroRNAs (miRNAs) are single-stranded RNA molecules of approximately 21–23 nucleotides in length, which negatively regulate the translation of coding mRNAs in a sequence-specific manner.³ The role of miRNAs in the pathogenesis of cancer and the fact that their levels are associated with disease states underscores their value as molecular biomarkers.⁴ Furthermore, it has been shown that miRNAs are present in human serum or plasma in a remarkably stable form that is protected from endogenous RNase activity, which highlights the potential of circulating miRNAs to act as stable blood-based markers for the detection of cancer or other human diseases.^5–11

MicroRNA-210 (miR-210) is an important member of the miRNA family and it has been reported to be upregulated in various tumour types.^12,13 However, there are few reports on the role played by miR-210 in NSCLC.^14,15 In the present study, serum levels of miR-210 were investigated in patients with NSCLC and the feasibility of using serum miR-210 as a noninvasive diagnostic biomarker for NSCLC was evaluated.

Patients and methods

Study population

This study retrospectively enrolled patients who had previously undergone lung resections for primary NSCLC between July 2009 and July 2012. The patients were identified from a search of the archival surgical pathology files of the Department of Thoracic Surgery, The First Bethune Hospital, Jilin University, Changchun, Jilin Province, China. There were no other inclusion or exclusion criteria for this study.

Tumours were staged according to the tumour-node-metastasis (TNM) staging system of the American Joint Committee on Cancer.¹⁶ Control subjects were recruited from among individuals who sought a routine health check-up at the Physical Health Examination Centre of Jilin University, who had not previously been diagnosed with cancer.

A 5-ml sample of peripheral venous blood was drawn from all study participants after an overnight fast and kept at room temperature for 60 min. Then the blood samples were centrifuged at 1000 g for 10 min at 4℃ in a Sigma 3k15 centrifuge (SIGMA Laborzentrifugen, Osterode am Harz, Germany). The serum was immediately separated, frozen and stored at −80℃ until it was used for analyses. Repeated freeze–thawing was avoided during storage to ensure the quality of the samples.

This study was approved by the Ethics Committee of Jilin University and written informed consent was obtained from all study participants.

Chemotherapy regimen and the evaluation of therapeutic efficacy

A proportion of the patients with NSCLC underwent cisplatin-based chemotherapy and the remaining patients had tumours that were fully resectable during surgery. The patients that underwent chemotherapy received 30 mg/m² cisplatin intravenously once daily for 3–4 weeks. After two to three cycles of treatment, an objective evaluation was made according to the Response Evaluation Criteria In Solid Tumors (RECIST) guidelines recommended by the World Health Organization:¹⁷ each patient’s response was defined as complete remission (CR), partial remission (PR), stable disease (SD) or progressive disease (PD).

RNA extraction and quantitative RT–PCR analysis of miR-210

Total RNA, including miRNAs, was extracted from 200 µl of serum using the QIAGEN miRNeasy Mini Kit (catalogue no. 217004; QIAGEN, Hilden, Germany) according to the manufacturer's instructions. The purity and concentration of RNA were determined using a dual-beam ultraviolet spectrophotometer (Eppendorf, Hamburg, Germany).

The concentration of miR-210 in serum was measured using quantitative real-time reverse transcription–polymerase chain reaction (RT–PCR). To synthesize cDNA, 20 µl of reverse transcription reaction mixture containing 40 ng of total RNA, 5 × reverse transcription buffer (QIAGEN), 10 mM of each deoxynucleotide triphosphate (Takara Biotechnology, Dalian, China), 5 U/ml of RNase inhibitor (Takara Biotechnology), 0.25 µl of antisense looped primer for miR-210 (5′-GTCGTATCCAG TGCAGGGTCCGAGGTATTCGCACT GGATACGACGAAACCCA-3′; QIAGEN) and 5 U/ml Avian Myeloblastosis Virus Reverse Transcriptase (1 µl; Takara Biotechnology) was incubated at 16℃ for 15 min, followed by 42℃ for 60 min and at 85℃ for 5 min, then stored at −20℃ until it was used.

Real-time quantification was performed using the QuantiTect™ SYBR® Green PCR Kit (QIAGEN) and the Applied Biosystems® 7900 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) according to the manufacturers’ instructions. miR-16 was selected as the internal normalization control (miR-16 sequence: 5′-UAGCAGCACGUAAAUAUUGGCG-3′; Takara Biotechnology).^18–20 The cycle threshold (C_t), which was defined as the number of PCR cycles required for the fluorescent signal to be higher than a threshold indicating baseline variability, was recorded. Relative changes of gene expression were represented by 2^−ΔΔC^t, the difference between the original copy number of miR-210 in the NSCLC group and that in the control group, where ΔΔC_t = (C_t_miR-210 − C_t_miR-16) of the NSCLC group − (C_t_miR-210 − C_t_miR-16) of the control group.

Statistical analyses

Statistical analyses were undertaken using GraphPad Prism version 4.03 (GraphPad Software, San Diego, CA, USA) and the SPSS® statistical package, version 16.0 (SPSS Inc., Chicago, IL, USA) for Windows®. Data are expressed as the mean ± SD. Student's t-test was used to analyse the differences in miR-210 serum concentrations between patients with NSCLC and control subjects, and between patients with NSCLC stratified according to clinicopathological features. Receiver operating characteristics (ROC) analysis was undertaken to determine the ability of the serum miR-210 level to discriminate between patients with NSCLC and healthy control subjects. The association between miR-210 serum concentrations and overall survival was analysed using the Spearman’s correlation coefficient. A P-value <0.05 was considered statistically significant.

Results

A total of 60 patients (42 male, 18 female; mean ± SD age 53.9 ± 4.6 years) who had undergone lung resections for primary NSCLC were included in the study. Of these, 36 patients with NSCLC were stage IV and 24 were stage I–II. Of the stage IV patients with NSCLC, 19 were diagnosed with squamous cell carcinoma and 17 with adenocarcinoma. Of the stage I–II patients with NSCLC, 11 were diagnosed with squamous cell carcinoma and 13 with adenocarcinoma. Of the 60 patients with NSCLC, 25 had lymph node metastasis and 35 did not have lymph node metastasis. The control group (n = 30) was composed of 15 male and 15 female subjects (mean ± SD age 57.0 ± 3.8 years). There was no significant difference in age and sex distribution between the patients with NSCLC and the control subjects. Of the 60 patients with NSCLC, 36 underwent cisplatin-based chemotherapy and the remaining 24 patients had tumours that were fully resectable during surgery.

The serum level of miR-210 was significantly upregulated in patients with NSCLC compared with healthy control subjects (4.846 ± 0.818 versus 3.846 ± 0.694, respectively; P < 0.005). Furthermore, ROC curve analysis revealed that serum miR-210 was a valuable biomarker for differentiating NSCLC patients from healthy control subjects with an area under the curve (AUC) of 0.775 (95% confidence interval 0.690, 0.872) (Figure 1).

Figure 1.

Receiver operating characteristics curve analysis of the ability of serum microRNA-210 (miR-210) levels to discriminate between patients with nonsmall-cell lung cancer and healthy control subjects. Serum miR-210 yielded an area under the curve (AUC) of 0.775 (95% confidence interval 0.690, 0.872). The cut-off was 1.307 and there was 78.7% sensitivity and 74% specificity.

Table 1 presents the results of the correlation analysis between the relative miR-210 serum levels and clinicopathological features of NSCLC. There was no correlation between the relative miR-210 serum levels and age and sex, but the relative miR-210 serum levels were significantly positively correlated with TNM stage and the presence of lymph node metastasis (P < 0.05 for both comparisons). The relative miR-210 serum level was significantly higher in patients with stage III–IV NSCLC compared with patients with stage I–II disease (P < 0.001) and in patients with lymph node involvement compared with patients without lymph node involvement (P < 0.005).

Table 1.

Correlations between the relative level of microRNA-210 (miR-210) in the serum of patients with nonsmall-cell lung cancer (NSCLC) and clinicopathological features of NSCLC.

Feature	n	Relative miR-210 level (2^−ΔΔC^t)^a	Statistical significance^b
Age, years
<55	31	4.476 ± 0.618	NS
≥55	29	4.389 ± 0.627
Regional lymph node involvement
No	25	4.387 ± 0.512	P < 0.005
Yes	35	5.487 ± 0.798
Clinical stage
I–II	24	4.349 ± 0.519	P < 0.001
III–IV	36	5.678 ± 0.989
Sex
Male	42	4.471 ± 0.602	NS
Female	18	4.674 ± 0.711

Data presented as mean ± SD.

The relative amount of miR-210 was calculated using the 2^−ΔΔC^t method where ΔΔC_t = (C_t_miR-210 − C_t_miR-16) of the NSCLC group − (C_t_miR-210 − C_t_miR-16) of the control group.

Differences in the miR-210 levels were analysed using Student’s t-test.

NS, no statistically significant between-group differences (P ≥ 0.05).

A total of 36 patients with advanced NSCLC underwent two to three cycles of cisplatin-based chemotherapy and were followed-up for a mean ± SD of 25.0 ± 3.8 (range 5–48) months: 12 had PR, 11 had PD and 13 had SD, but none achieved CR after chemotherapy. The relative miR-210 serum level was significantly higher in the PD + SD group compared with the PR group (P < 0.05) and the healthy control group (P < 0.05), whereas there was no significant difference between the PR group and the healthy control group (Figure 2).

Figure 2.

Correlations between the relative level of microRNA-210 (miR-210) in the serum of 36 patients with nonsmall-cell lung cancer stratified according to their clinical outcomes (progressive disease or stable disease [PD + SD; n = 24] or partial remission [PR; n = 12]) following cisplatin-based chemotherapy compared with the healthy control group (Control; n = 30). *P < 0.05 for patients with PD + SD versus (i) the healthy control group and (ii) patients with PR; Student’s t-test.

Discussion

Tumour metastasis is one of the most important prognostic factors for advanced NSCLC. When it occurs it often results in treatment failure.²¹ The early detection of metastasis in patients with NSCLC using a convenient method is an important research goal. Circulating tumour-derived miRNAs were first described in peripheral blood by Mitchell et al,⁹ who found that circulating miRNAs had the potential to be new biomarkers in patients with prostatic cancers. These authors also showed that blood-derived miRNAs demonstrated high stability after prolonged incubation at room temperature and/or after multiple freezing–thawing processes.⁹ These previous findings stimulated the search for circulating miRNAs that could be used in the detection of patients with cancer, and several miRNAs have been reported to act as cancer-specific stable blood-based markers.^{6–11,18–20,22,23} Thus, identifying an miRNA that can diagnose patients with NSCLC, particularly at an early stage, may play an important role in the future treatment of this cancer.

MicroRNA-210 is one of the most widely studied miRNAs in cancer. miR-210 is upregulated in various types of human malignancy,^{12,13,24–26} suggesting that it has an important role in tumorigenesis. In this present study, the serum level of miR-210 in patients with NSCLC was compared with that of healthy control subjects. All of the samples of miRNA that were obtained in the present study were of good enough quality for RT–PCR amplification. The serum level of miR-210 in patients with NSCLC was significantly higher than that measured in healthy control subjects. This current result was in agreement with previous findings that miR-210 levels were increased in some cancer patients.^{12,13,24–26} The mechanism of upregulation of miR-210 is not completely understood, but recent data suggest that upregulation of miR-210 is related to the hypoxia-inducible factor (HIF)-1a signalling pathway.²⁵ Research has demonstrated that the miR-210 level in human breast cancer is not only a marker of tumour hypoxia in vivo but it is also regulated by HIF-1a in breast cancer through a hypoxia-responsive element.²⁴ Although the exact mechanism of action of miR-210 and its role in tumorigenesis need to be further clarified, there is considerable value in exploring its usefulness as a diagnostic tool in a range of cancers.

The objective of this present study was to evaluate the ability of circuiting miR-210 in serum samples to distinguish between patients with NSCLC and healthy control subjects. The current results showed that the level of miR-210 in serum was significantly higher in patients with NSCLC than in healthy control subjects: the difference could distinguish patients with NSCLC from healthy control subjects with a high degree of specificity and sensitivity. In addition, the serum level of miR-210 was significantly elevated in patients with stage III–IV disease compared with patients with stage I–II disease. Importantly, the relative level of miR-210 was significantly reduced in the partial remission group compared with the progressive disease and stable disease group, suggesting that serum miR-210 levels might correlate with sensitivity to chemotherapy in NSCLC. This present study also demonstrated that the serum levels of miR-210 were not significantly different between men and women, which was in accordance with previous findings.⁹ Results from studies have demonstrated that the circulating levels of miR-210 or the other miRNAs were potential diagnostic biomarkers in cancer.^4,9,12 An investigation of the levels of 12 miRNAs in plasma samples from patients with colorectal cancer found that miR-29a (AUC = 0.844) and miR-92a (AUC = 0.838) had significant diagnostic value for advanced cancer patients.²⁷ The mean serum level of miR-210 was shown to be significantly higher in patients with renal cell cancer compared with control subjects (P < 0.001).¹² Serum miR-221 levels were elevated in patients with epithelial ovarian cancer compared with control subjects and the serum miR-221 level was associated with the International Federation of Obstetricians and Gynaecologists stage and tumour grade.²⁸ These previous studies suggest that plasma/serum miRNAs may function as potential biomarkers for the noninvasive diagnosis and prognosis of cancers.

In conclusion, the present study showed that serum miR-210 levels were significantly elevated in patients with NSCLC compared with control subjects and that the circulating miR-210 was significantly elevated in patients with stage III–IV disease compared with patients with stage I–II disease. These findings indicate that serum miR-210 may have a role as a novel diagnostic and prognostic marker of NSCLC.

Footnotes

Declaration of conflicting interest

The authors declare that there are no conflicts of interest.

Funding

The authors gratefully acknowledge the financial support provided by The Development of Science and Technology Plan Projects of Jilin (no. 2012Z019).

References

Jemal

Bray

Center

. Global cancer statistics. CA Cancer J Clin 2011; 61: 69–90.

Miller

. Pathogenesis of lung cancer: 100 year report. Am J Respir Cell Mol Biol 2005; 33: 216–223.

Esquela-Kerscher

Slack

. Oncomirs- microRNAs with a role in cancer. Nat Rev Cancer 2006; 6: 259–269.

Chen

. Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 2008; 18: 997–1006.

Cheng

Tan

Yang

. A translational study of circulating cell-free microRNA-1 in acute myocardial infarction. Clin Sci (Lond) 2010; 119: 87–95.

Lodes

Caraballo

Suciu

. Detection of cancer with serum miRNAs on an oligonucleotide microarray. PLoS One 2009; 4: e6229–e6229.

Gilad

Meiri

Yogev

. Serum microRNAs are promising novel biomarkers. PLoS One 2008; 3: e3148–e3148.

Chen

Zhao

. Serum microRNA signatures identified in a genome-wide serum microRNA expression profiling predict survival of non-small-cell lung cancer. J Clin Oncol 2010; 28: 1721–1726.

Mitchell

Parkin

Kroh

. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A 2008; 105: 10513–10518.

10.

Shen

Todd

Zhang

. Plasma microRNAs as potential biomarkers for non-small-cell lung cancer. Lab Invest 2011; 91: 579–587.

11.

Zheng

Haddadin

Wang

. Plasma microRNAs as novel biomarkers for early detection of lung cancer. Int J Clin Exp Pathol 2011; 4: 575–586.

12.

Zhao

Péoc'h

. Serum miR-210 as a novel biomarker for molecular diagnosis of clear cell renal cell carcinoma. Exp Mol Pathol 2013; 94: 115–120.

13.

Huang

Cao

. Circulating miR-210 as a novel hypoxia marker in pancreatic cancer. Transl Oncol 2010; 3: 109–113.

14.

Grosso

Doyen

Parks

. miR-210 promotes a hypoxic phenotype and increases radioresistance in human lung cancer cell lines. Cell Death Dis 2013; 4: e544–e544.

15.

Puisségur

Mazure

Bertero

. miR-210 is overexpressed in late stages of lung cancer and mediates mitochondrial alterations associated with modulation of HIF-1 activity. Cell Death Differ 2011; 18: 465–478.

16.

Tio

. The TNM staging system. Gastrointest Endosc 1996; 43: S19–S24.

17.

Miller

Hoogstraten

Staquet

. Reporting results of cancer treatment. Cancer 1981; 47: 207–214.

18.

Wong

Liu

Wong

. Mature miR-184 as potential oncogenic microRNA of squamous cell carcinoma of tongue. Clin Cancer Res 2008; 14: 2588–2592.

19.

Chong

Jin

. Differential expression of microRNAs in plasma of patients with colorectal cancer: a potential marker for colorectal cancer screening. Gut 2009; 58: 1375–1381.

20.

Heneghan

Miller

Lowery

. Circulating microRNAs as novel minimally invasive biomarkers for breast cancer. Ann Surg 2010; 251: 499–505.

21.

Van Schil

Hendriks

Hertoghs

. Current surgical treatment of non-small-cell lung cancer. Expert Rev Anticancer Ther 2011; 11: 1577–1585.

22.

Kuehbacher

Urbich

Dimmeler

. Targeting microRNA expression to regulate angiogenesis. Trends Pharmacol Sci 2008; 29: 12–15.

23.

Davidson-Moncada

Papavasiliou

Tam

. MicroRNAs of the immune system: roles in inflammation and cancer. Ann N Y Acad Sci 2010; 1183: 183–194.

24.

Camps

Buffa

Colella

. hsa-miR-210 is induced by hypoxia and is an independent prognostic factor in breast cancer. Clin Cancer Res 2008; 14: 1340–1348.

25.

Neal

Michael

Rawlings

. The VHL-dependent regulation of microRNAs in renal cancer. BMC Med 2010; 8: 64–64.

26.

Cohen

McGovern

. Renal-cell carcinoma. N Engl J Med 2005; 353: 2477–2490.

27.

Huang

. Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer. Int J Cancer 2010; 127: 118–126.

28.

Hong

. Prognostic significance of serum microRNA-221 expression in human epithelial ovarian cancer. J Int Med Res 2013; 41: 64–71.

Prognostic significance of serum microRNA-210 levels in nonsmall-cell lung cancer

Abstract

Objective

Methods

Results

Conclusions

Keywords

Introduction

Patients and methods

Study population

Chemotherapy regimen and the evaluation of therapeutic efficacy

RNA extraction and quantitative RT–PCR analysis of miR-210

Statistical analyses

Results

Discussion

Footnotes

Declaration of conflicting interest

Funding

References