Abstract
Objective
To investigate the role of insulin-like growth factor (IGF)-1 and its receptor (IGF1R) in the formation and development of colorectal carcinoma.
Methods
Colorectal tissue and matching serum samples were collected from patients with adenomatous polyps or carcinoma and healthy control subjects. IGF1R mRNA levels were determined via quantitative real-time reverse transcription–polymerase chain reaction. Serum IGF1 was quantified using enzyme-linked immunosorbent assay.
Results
Serum IGF1 concentrations and mucosal IGF1R mRNA levels were significantly higher in patients with adenomatous polyps (n = 24) or carcinoma (n = 13) compared with healthy control subjects (n = 13). There was a significant positive correlation between serum IGF1 and mucosal IGF1R mRNA in patients with adenomatous polyps.
Conclusions
High circulating IGF1 concentrations and mucosal IGF1R expression may play important roles in both the formation and development of colorectal carcinoma. IGF1 and its receptor may be activated before carcinogenesis, and may promote the growth and malignant transformation of adenomatous polyps. IGF1 and IGF1R may be useful biomarkers for evaluating the stage and risk of carcinogenesis.
Keywords
Introduction
The neoplastic initiation of colorectal cancer primarily begins with the formation of adenomatous polyps that can be detected by endoscopy. 1 The morphological transition from normal colorectal mucosa to adenomatous polyps, early cancer and eventually to advanced cancer is widely accepted as the neoplastic progression of colorectal cancer. This process is facilitated by abnormal cell proliferation, differentiation and apoptosis.2,3 In addition, multiple growth factors are believed to be involved in neoplastic progression.4–8 Investigating changes in growth factors and their receptors may reveal the mechanisms of neoplastic initiation and identify new molecular targets for anticancer strategies.
The insulin-like growth factor type 1 receptor (IGF1R) signalling pathway is activated by IGF1. 9 Growth hormone stimulates the production of IGF1 as an endocrine hormone, in addition to stimulation in a paracrine/autocrine manner;10,11 IGF1 then activates the transmembrane IGFR and its downstream signalling pathway.12,13 The IGF1/IGF1R system is highly conserved and is crucial in cell proliferation, differentiation and tissue development.14–17 These functions have raised interest in the role of the IGF pathway in carcinogenesis, which is closely related to abnormal cell proliferation, differentiation, apoptosis and transformation.18,19 Studies have linked IGF1 to human tumours, including colorectal cancer. 20 IGF1 also has been shown to induce the transcription of vascular endothelial growth factor, resulting in colorectal cancer development, angiogenesis and metastasis. 21 In addition, IGF1R was shown to be overexpressed in human colorectal tumours compared with normal colorectal tissue, resulting in enhanced tumour cell proliferation, malignant transformation and inhibition of apoptosis.22,23 An overactive abnormal IGF1R β-subunit induced oncogenic transformation of IGF-1R knockout mouse fibroblasts in vitro, indicating that activated IGF1R may have an important role in the neoplastic process.24,25
The effect of IGF1 and IGF1R on precancerous lesions (such as adenomatous polyps) has not been widely investigated: research has generally been limited to comparison with cancerous lesions. There are different pathological types of colorectal polyps, each with varying biological behaviour, morphological characteristics and malignant potential.26–28 Adenomatous polyps, which possess a highly disordered structure and cell atypia (moderate to severe dysplasia), are more likely to develop into cancer than hyperplastic and inflammatory polyps.29,30 Excessive cell proliferation caused by upregulation of IGF1/IGF1R greatly increases the probability of tumourigenesis, 24 and the IGF1 pathway may therefore have an important role, not only in malignant tumours but also in tumour initiation in precancerous lesions such as colorectal adenomatous polyps.
The aim of the present study was to determine whether serum IGF1 concentrations (quantified by enzyme linked immunosorbent assay [ELISA]) and/or IGF1R mRNA expression (quantified via quantitative real-time reverse transcription–polymerase chain reaction [RT–PCR]) in colorectal tissue are related to the occurrence of colorectal adenomatous polyps or carcinoma. We also investigated whether IGF1 and its receptor could be used as biomarkers to evaluate the risk of colorectal carcinogenesis.
Patients and methods
Study population
The study recruited patients undergoing surgical resection of colorectal adenocarcinoma or colonoscopy with polypectomy at the Sun Yat-sen University Cancer Centre, Guangzhou, China, between November 2009 and November 2010. The control group was recruited from individuals with symptoms including rectal bleeding, bloody stools, abdominal pain, constipation and diarrhoea who were attending the outpatient Clinic of Sun Yat-sen University Cancer Centre; these people subsequently had negative colonoscopy findings. Subjects with colitis, acromegaly, dwarfism, diabetes, cachexia, severe organ failure or other malignancies were excluded.
Blood (5 ml) was collected from each participant, then centrifuged at 1500
The study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of Sun Yat-sen University Cancer Centre. Participants were informed of the investigational nature of the study and provided their written informed consent.
IGF1R quantitative real-time RT–PCR
Tissue samples were frozen at −80℃ in RNAlater® (Qiagen, Valencia, CA, USA) immediately after collection. For RNA extraction, 20–50 mg of tissue was ground and incubated with 1 ml cell lysis buffer (Trizol®; Gibco, Gaithersburg, MD, USA) for 5 min and total RNA was isolated using the acid-guanidinium isothiocyanate phenol chloroform extraction method. 31 RNA concentration and purity were determined by ultraviolet spectrophotometry, and RNA was stored at −80℃ for future analysis.
Total RNA (4 µl) was incubated for 60 min at 37℃ in a 20 µl reaction volume comprising RT buffer (50 mM Tris‐HCl [pH 8.0], 50 mM potassium chloride, 4 mM magnesium chloride, 10 mM dithiothreitol), 0.25 mM dNTPs, 4 pmol random primers, and 200 U MMLV reverse transcriptase. The reaction was stopped by incubation at 95℃ for 3 min; samples were then placed on ice.
Quantitative real‐time PCR was performed with a SYBR®green‐based ABI 7500 Real‐Time PCR system (Life Technologies, Grand Island, NY, USA). Primer sequences were: IGF1R forward 5′‐GCCAAGCTAAACCGGCTAAA‐3′ and reverse 5′‐TATCCTGTTTTGGCCTGGACATA-3′; and ACTB (β-actin) forward 5′-GCATGGGTCAGAAGGATTCCT-3′ and reverse 5′-TCGTCCCAGTTGGTGACGAT-3′. PCR was carried out in a 50-µl reaction volume comprising PCR buffer (10 mM Tris-HCl [pH 8.0], 50 mM potassium chloride, 2 mM magnesium chloride), 200 µM dNTPs, 0.2 pmol/µl each primer, and 0.06 U/µl Taq DNA polymerase. The cycling programme involved preliminary denaturation at 95℃ for 3 min, followed by 36 cycles of denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s and elongation at 72℃ for 45 s, followed by a final elongation step at 72℃ for 7 min. The threshold cycle (CT) was used to determine the concentration of the target gene, with ACTB used as an internal control, and the ratio of IGF1R to ACTB representing the transcription level of IGF1R.
IGF1 ELISA
Serum IGF1 was quantified using a human IGF1 Quantikine® ELISA kit (R&D Systems, Minneapolis, MN, USA), according to the manufacturer’s instructions. Optical density at 450 nm was determined using a microplate reader, with wavelength correction of 540 nm. All samples, standards and controls were assayed in duplicate, and IGF1 was quantified by reference to a standard curve.
Statistical analyses
Data were presented as mean ± SD. Between-group differences in age and sex were analysed using one-way analysis of variance (ANOVA) and χ2-test, and one-way ANOVA with posthoc Bonferroni t-test was used for between-group comparisons of IGF1 and IGF1R levels. Spearman’s rank correlation analysis was used to determine the relationship between IGF1R mRNA levels and IGF1 concentration in patients with adenomatous polyps. All statistical analyses were performed with SPSS® software, version 17.0 (SPSS Inc., Chicago, IL, USA), and a P-value <0.05 was considered to be statistically significant.
Results
The study collected colorectal tissue samples from 24 patients undergoing colonoscopy and polypectomy (17 males/seven females; mean age 58.0 ± 13.9; age range 17–76 years), 13 patients undergoing surgical resection of colorectal adenocarcinoma (nine males/four females; mean age 49.7 ± 19. 8; age range 35–83 years) and 13 healthy control subjects (six males/seven females; mean age 57.0 ± 13.7; age range 22–82 years). There were no statistically significant between-group differences in age or sex distribution.
Serum insulin-like growth factor (IGF)-1 concentrations and IGF receptor 1 (IGF1R) mRNA levels in colorectal tissue samples from patients with colorectal adenomatous polyps or adenocarcinoma and healthy control subjects.
Data presented as mean ± SD.
Ratio of IGF1R to ACTB (β-actin) mRNA.
P < 0.01 versus control group; one-way analysis of variance with posthoc Bonferroni t-test.
Spearman’s rank correlation analysis revealed a significant correlation between serum IGF1 concentration and IGF1R mRNA tissue levels in patients with adenomatous polyps (rs = 0.552, P < 0.01).
Discussion
Insulin-like growth factor 1 is known to be more important for the proliferation and growth of malignant cells in vitro than that of normal tissues,32,33 and circulating IGF1 levels are known to be increased in patients with cancer. 20 Serum IGF1 concentrations were significantly higher in patients with colorectal adenomatous polyps or adenocarcinoma than in healthy control subjects, in the present study. This suggests that high serum IGF1 concentrations may be important not only in malignant growth but also for benign precancerous growth. Cellular mutations accumulate with age and lead to apoptosis.34–36 IGF1 can protect malignant cells from apoptosis, 24 and continually high circulating IGF1 may allow malignant transformation of mutant epithelial cells.
An immunostaining study revealed that IGF1R levels were significantly higher in precancerous adenomatous polyps compared with normal mucosa, but remained low in inflammatory polyps. 37 These data are in accordance with the findings of the present study, where IGF1R mRNA was found at a higher level in both colorectal adenomatous polyps and adenocarcinoma compared with normal tissue. The IGF1R signalling pathway may therefore be involved in the proliferation of abnormal colorectal epithelia as early as the precancerous adenomatous polyp stage. The present finding, that IGF1R is expressed at a high level in the adenoma stage, indicates that the abnormal epithelia in adenomatous polyps may develop the capability to utilize IGF1 from the surrounding environment more efficiently than normal colorectal epithelia. Since overexpression of IGF1R is found in colorectal adenocarcinoma,22,27 the high level of IGF1R in adenomatous polyps suggests that both benign adenoma and malignant carcinoma cells utilize the same strategy to maintain rapid proliferation. Overexpression of IGF1R may be a molecular event associated with the precancerous transition of colorectal epithelial cells.
Pretreatment of A549 nonsmall cell lung cancer and Saos-2/B-10 osteoblastic osteosarcoma cell lines with IGF1 downregulated total and membrane surface-bound IGF1R and largely reduced the acute IGF1 response of cells in vitro. 38 Findings of the present study suggest a different pattern for the feedback loop between IGF1R and its ligands in vivo, since high levels of both IGF1 and IGF1R were present in colorectal adenoma and carcinoma tissues. The present data suggest that both circulating IGF1 and IGF1R expression in adenoma and carcinoma tissues play important roles in the proliferation of abnormal precancerous and malignant cells. The significant correlation between serum IGF1 concentration and IGF1R mRNA levels in patients with adenomatous polyps in the present study suggests the existence of a positive feedback loop. The regulation of IGF1 and its receptor therefore requires further investigation.
An inhibitor of the tyrosine kinase activity of IGF1R, NVP-AEW541 has been shown to inhibit proliferation of colorectal carcinoma cell lines and primary cell cultures by inducing apoptosis and cell-cycle arrest, and may represent a promising anticancer treatment for colorectal carcinoma. 39 The present findings suggest that high circulating IGF1 concentrations and IGF1R overexpression may play important roles in the development of both adenomatous polyps and colorectal carcinoma. Inhibition of IGF1R, reducing serum IGF1 concentrations or blocking IGF1/IGF1R binding may all be potential chemopreventive measures for colorectal cancer.
Because colorectal adenomatous polyps commonly develop into colorectal cancer, screening programs that rely on colonoscopies to detect and remove polyps have been shown to be effective in reducing the morbidity and mortality of colon cancer. 40 Colonoscopies are not widely accepted, however, due to poor compliance and heightened risk of complications. 41 Serum IGF1 concentrations and mucosal IGF1R mRNA levels may be useful biomarkers for evaluating the stage and risk of carcinogenesis during neoplastic initiation and colorectal cancer progression.
In conclusion, the present study found high serum IGF1 concentrations and IGF1R mRNA levels in adenomatous polyps and adenocarcinoma tissue compared with normal mucosa, suggesting that IGF1 and IGF1R are activated before carcinogenesis, and may play important roles in malignant transformation. Serum IGF1 concentrations and mucosal IGF1R mRNA levels may be useful in indicating the risk of adenomatous polyp formation or colorectal cancer progression. Further studies regarding regulation of the IGF1/IGF1R axis and IGF1R expression are required to elucidate the role of this signalling pathway in the initiation and progression of colorectal cancer.
Footnotes
Acknowledgements
We thank Dr Dong-Ping Rao (Department of Epidemiology, State Key Laboratory of Oncology in Southern China, Guangzhou, China) for assistance with statistical analyses.
Declaration of conflicting interest
The authors declare that there are no conflicts of interest.
Funding
This study was supported by Science and Technology Planning Project of Guangdong Province 2009B030801158, 2012B031800097, 2012B031800282.
