Sage Journals: Discover world-class research

Abstract

Objective

Glioblastoma multiforme (GBM) is the most frequently occurring central nervous system tumor in adults. GBM patients exhibit poor survival outcomes following standard treatment, with drug resistance playing a critical role in disease progression. This study aimed to evaluate the effects of valsartan, a renin−angiotensin system inhibitor, on GBM cell lines with and without temozolomide (TMZ) resistance.

Methods

TMZ-resistant GBM clones were established by repeatedly exposing LN229 and GBM8401 human glioma cells to high doses of TMZ, followed by selective culture of the surviving populations. Tumorigenic potential was assessed using viability, sphere formation, invasion, and apoptosis assays. Gene expression was examined by sequencing and validated by quantitative polymerase chain reaction.

Results

Valsartan reduced the proportion of viable GBM cells regardless of TMZ sensitivity. Flow cytometry and western blotting revealed increased apoptosis in GBM following valsartan treatment. RNA sequencing revealed that valsartan regulates the cell cycle and induces G1-phase arrest, as evidenced by cell cycle flow cytometry. Moreover, APLN, an angiogenesis-related gene, was identified as a potential downstream target whose expression is significantly inhibited by valsartan.

Conclusions

This study revealed that valsartan is a novel strategy for treating gliomas with drug resistance.

Keywords

Glioblastoma renin−angiotensin system (RAS)valsartan APLN chemoresistance

Introduction

Glioblastoma multiforme

Glioma is a malignant intracranial tumor that primarily originates from glial cells and is among the most common types of brain tumors.¹ Among primary malignant brain tumors, glioblastoma multiforme (GBM) is the most malignant subtype. It is the most invasive and lethal type of brain tumor and is characterized by a high recurrence rate after treatment and a short survival period. The current standard clinical treatment for GBM includes surgical resection combined with whole-brain radiotherapy and oral chemotherapy with temozolomide (TMZ).² However, the survival time for GBM patients remains limited to 12–15 months.³ Furthermore, at least 50% of patients develop resistance to TMZ following treatment, indicating a need for additional treatment options.⁴ The mechanism of TMZ induces DNA mismatches during DNA replication, leading to cancer cell apoptosis.^3,5 O⁶-methylguanine-DNA methyltransferase (MGMT) is a DNA repair protein that can repair the mismatches induced by TMZ. The overexpression of MGMT is a key factor contributing to drug resistance in GBM patients.^6,7 To date, few treatment strategies that can effectively overcome GBM or its associated drug resistance have been established.

The renin−angiotensin system (RAS) is essential for regulating blood pressure and maintaining ionic balance within the body.⁸ Previous studies have shown that hyperactivation of the RAS is associated with oxidative stress,⁹ apoptosis, and inflammation.¹⁰ Furthermore, overexpression of RAS components is linked to cancer development and angiogenesis.¹¹

GBM is a highly vascular tumor characterized by extensive neovascularization. The RAS serves as a key component of the tumor microenvironment and plays a critical role in several cancer hallmarks, including increased angiogenesis, hypoxia,¹² and tumor cell proliferation.¹¹ Thus, blocking the RAS is a potential antitumor treatment strategy.

Angiotensin II type 1 receptor (AT-1R) blockers (ARBs), such as valsartan, can fully inhibit AT-1R signaling. ARBs exhibit notable anticancer effects both in vitro and in vivo in cancers such as prostate cancer,¹³ nasopharyngeal carcinoma,¹⁴ breast cancer,¹⁵ and colorectal cancer.¹⁶ Furthermore, ARB treatment enhances the efficacy of anti-PD-1 therapy in melanoma mouse models.¹⁷ Valsartan stands out for its strong antagonistic action and high binding affinity to AT-1R, suggesting its potential as a therapeutic agent for multiple cancer types. Based on statistical analyses, patients treated with valsartan have a lower incidence of lung cancer.¹⁸ Previous studies have demonstrated that orally administered valsartan can cross the blood−brain barrier, where it affects the brain.¹⁹ These reports inspired us to further investigate the effect of valsartan on brain tumors.

The results of this study demonstrate that valsartan has anti-GBM effects, as evidenced by decreased cell proliferation, induction of cell cycle arrest, induction of apoptosis, and suppression of invasion upon treatment. These findings highlight the potential value of valsartan as a candidate adjuvant in cancer treatment.

Materials and methods

Chemicals

Valsartan (SML0142, Sigma Aldrich, USA) was utilized in this study.

Cell culture

LN229 cells (RRID:CVCL_0393) purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA) and GBM8401 cells (RRID:CVCL_B051) purchased from the Bioresource Collection and Research Center (BCRC, Hsinchu, Taiwan) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 2% fetal bovine serum (FBS) and 1% penicillin/streptomycin. We generated and sustained LN229 and GBM8401 TMZ-resistant (TMZ-R) clones in our laboratory as previously described by Tsai et al.²⁰ LN229 and GBM8401 TMZ-R clones were maintained in Roswell Park Memorial Institute (RPMI) 1640 with 10% FBS, 1% penicillin/streptomycin, and 400 μM TMZ for LN229 TMZ-R or 200 μM TMZ for GBM8401 TMZ-R. Normal human astrocytes (NHAs) were maintained in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin, and 1× N-2. All cells were cultured at 37°C in a humidified incubator with 5% CO₂. This study was conducted in accordance with the Helsinki Declaration of 1975 as revised in 2024.

Cell lysis and protein quantification

Cells (5 × 10⁵ cells/well) were seeded in 10 cm dishes overnight and treated with valsartan (0–300 μΜ) for 48 h. RIPA lysis buffer (EMD Millipore Corp, MA, USA) supplemented with protease and phosphatase inhibitors (Sigma Aldrich, USA) was used to lyse the cells. Protein concentration was measured with a DC protein assay kit (Bio-Rad, USA).

Western blotting

Thirty-five micrograms of protein were loaded onto SDS−PAGE gels. Next, samples were transferred to a polyvinylidene difluoride membrane (0.22 μm pore; Millipore, USA). Membranes were blocked with 5% skim milk in TBS-T (Tris-buffered saline with 0.1% Tween 20 buffer) for 1 h. The membranes were incubated with primary antibodies overnight at 4°C, washed with TBS-T, and incubated with secondary antibodies for 45 min at room temperature. Antibodies used in this study are listed in Table 1. Finally, protein bands were detected using Clarity Western ECL Substrate (Bio-Rad, USA) and analyzed with ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Table 1.

The antibodies used in this study.

Antibody	Company	Catalog number	Dilution
α-Actinin	Santa Cruz Biotechnology	sc-17829	1:10000
Anti-mouse IgG-HRP	Cell Signaling Technology	#7076	1:10000
Anti-rabbit IgG-HRP	Cell Signaling Technology	#7074	1:20000
γ-H2AX	Abcam	ab81299	1:1000
MGMT	Abcam	ab108630	1:1000
Snail	Cell signaling Technology	#3895	1:1000
Survivin	Abcam	ab76424	1:1000

MGMT: methylguanine-DNA methyltransferase.

Cell viability assay

Cells (3 × 10³ cells/well) were seeded in 96-well plates and treated with drugs (0–400 μM TMZ; 0–400 μM valsartan) for 48 h. Cell viability was analyzed using the CellTiter-96 AQ One Solution Cell Proliferation Assay (MTS). After drug treatment, 20 μL of MTS reagent was added to each well, and the samples were incubated for 2 h. Absorbance was measured at 490 nm.

Apoptosis assay

The cells (2 × 10⁵ cells/well) were seeded in 6-well plates overnight and treated with valsartan (0–300 μΜ) for 48 h. After treatment, cells were resuspended in 1× binding buffer (1 × 10⁶ cells/mL) and stained with PE-conjugated Annexin V/7-AAD (#559763, PE-conjugated Annexin V Apoptosis Detection Kit I; BD Biosciences, USA). Cells were analyzed with a FACSCalibur flow cytometer.

Colony formation assay

Cells (2 × 10³ cells/well) were seeded in 6-well plates, incubated overnight, and treated with valsartan (0–300 μΜ) for 1 week. After 1 week of incubation, colonies were fixed with methanol for 20 min and stained with 0.005% crystal violet for 1 hour. Photographs were obtained after the samples were washed and air-dried. Colonies larger than 0.1 mm in diameter were counted via ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Cell proliferation assay

Cells (2 × 10⁵ cells/well) were seeded in 6-well plates overnight and treated with valsartan (0–300 μΜ) for 48 h. Cell proliferation was analyzed using BrdU Flow Kits (#559619, BD Biosciences, USA) according to the manufacturer's instructions and analyzed with a FACSCalibur flow cytometer.

Wound healing assay

Cells were seeded in 12-well plates and incubated until they reached at least 90% confluence. A P1000 pipette tip was used to scratch the cells, which were then photographed and treated with valsartan (0–300 μM) for 16 h. After incubation, images were captured under a microscope, and the wound healing rate was calculated using ImageJ software.

Cell cycle analysis

Cells (2 × 10⁵ cells/well) were seeded in 6-well plates overnight and treated with valsartan (0–300 μΜ) for 48 h. Cell cycle was analyzed using propidium iodide (#1932759, Invitrogen) according to the manufacturer's instructions and measured with a FACSCalibur flow cytometer.

Bioinformatics examination

To investigate the expression levels and prognostic value of APLN in glioma, several online bioinformatics platforms were utilized. We used Gene Expression Profiling Interactive Analysis (GEPIA, http://gepia.cancer-pku.cn/)²¹ and the Gene Expression Database of Normal and Tumor Tissues 2 (GENT2, http://gent2.appex.kr)²² to assess gene expression across different stages of gliomas. The association between APLN expression and patient survival was evaluated using GEPIA and the Chinese Glioma Genome Atlas (CGGA, http://www.cgga.org.cn/index.jsp)²³ to generate Kaplan–Meier survival plots. Differential gene expression analysis via GEPIA used a significance cutoff of log₂ fold change > 1 and p < 0.01. Kaplan–Meier survival curves generated by GEPIA were plotted based on the median stratification of APLN expression levels, with statistical significance defined as p < 0.05.

Gene expression profiling and biological pathway analysis

Total RNA extracted from LN229 and LN229 TMZ-R cells was analyzed via next-generation sequencing (Phalanx Biotech Group, Hsinchu, Taiwan). Fold changes were calculated as the ratio of the mean expression values in LN229 TMZ-R cells relative to those in LN229 cells.

RNA isolation

Total RNA was isolated from cells with TRI Reagent^® solution and 1-bromo-3-chloropropane (Sigma, USA), followed by reverse transcription into cDNA with the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, USA), following the manufacturer's instructions.

Real-time reverse transcription polymerase chain reaction

Quantitative real-time PCR was conducted using the IQ² EVA Green Fast qPCR System Master Mix-HIGH ROX (Biogenesis, Taiwan) on a StepOne™ Real-Time PCR System (Thermo Fisher Scientific, USA). Primer sequences are detailed in Table 2, and GAPDH was used as the internal control for normalization of the results.

Table 2.

The primer sequences used in this study.

Gene	Primer sequences
GAPDH	Forward: ACAACTTTGGTATCGTGGAAGG Reverse: GCCATCACGCCACAGTTTC
APLN	Forward: GCCTTTCTGAAGCAGGACTGAA Reverse: GAGCTGAATGGACGTGAGGC

Statistical analysis

Statistical analyses were performed using an unpaired two-tailed Student's t test. Specific details regarding the statistical tests employed are provided in the corresponding figure legends. All experiments were performed at least three times unless otherwise specified in the figure legends. Data are presented as the means ± SEMs, with significance levels indicated as ***p < 0.001, **p < 0.01, and *p < 0.05.

Results

A GBM cell line with TMZ resistance was successfully generated

TMZ is an alkylating prodrug that undergoes spontaneous chemical activation in vitro due to its pH-dependent instability.²⁴ Although originally developed for in vivo use, TMZ does not require enzymatic activation; its conversion into active metabolites occurs efficiently in vitro when exposed to neutral or mildly basic aqueous conditions.²⁵ To evaluate valsartan as a potential therapeutic agent for treating GBM in both TMZ-sensitive and TMZ-resistant clones, we first developed TMZ-resistant glioma cell lines by repeatedly culturing and selecting surviving LN229 and GBM8401 human glioma cells following exposure to high doses of TMZ.²⁰ The tolerance of TMZ was measured via MTS assays (Figure 1A). The results showed that the half-maximal inhibitory concentration (IC₅₀) values of TMZ in LN229 and GBM8401 cells were 249.94 and 220.78 μM, respectively. Compared with the parental cells, LN229 TMZ-R and GBM8401 TMZ-R cells had better tolerance to TMZ.

Figure 1.

Valsartan decreased the proportion of viable TMZ-S and TMZ-R GBM cells in a dose-dependent manner. (A) TMZ-resistant glioma clones were established through drug exposure. An MTS assay was used to determine the viability of the indicated cells treated with TMZ (0–400 μM for 48 h; n = 3). (B) (Left panel) Effects of treatment with different concentrations of valsartan for 48 h (0–400 µM, n = 3) on the viability of nontumor control cells (NHAs) and TMZ-S and TMZ-R LN229 and GBM8401 clones assessed via MTS assays. Gray represents normal NHAs, red represents LN229 cells, light blue represents LN229 TMZ-R cells, yellow represents GBM8401 cells, light green represents GBM8401 TMZ-R cells, and the black dotted line indicates the IC50. (Right panel) The IC50 value at 48 h was determined from the dose−response curve. (C) Expression of MGMT protein in TMZ-S and TMZ-R glioma cells treated with valsartan at the indicated dose, analyzed by western blotting. Representative images from two independent tests are shown.

Valsartan decreased the proportion of viable GBM cells regardless of TMZ sensitivity

To investigate the effects of valsartan on the viability of GBM cells harboring TMZ-sensitive and TMZ-resistant clones, we treated LN229 and GBM8401 cells with valsartan at concentrations of 0, 100, 200, 250, 300, and 400 μΜ for 48 h and then assessed cell viability via MTS assays (Figure 1B). The results showed that valsartan decreased the proportion of viable cells among both TMZ-sensitive and TMZ-resistant clones. The IC₅₀ values in LN229 and LN229 TMZ-R cells were 229.0 ± 6.7 μΜ and 239.8 ± 4.5 μΜ, respectively; the IC₅₀ values in GBM8401 and GBM8401 TMZ-R cells were 231.6 ± 3.4 μΜ and 290.3 ± 7.2 μΜ, respectively (Figure 1B). Additionally, the IC₅₀ in NHA cells was 359.5 ± 8.2 μΜ (Figure 1B), which was significantly greater than that observed in GBM cells. These findings suggest that valsartan has lower cytotoxicity toward normal control astrocytes than toward GBM cells. Next, we investigated whether valsartan can attenuate drug resistance in GBM cells by determining the expression of MGMT in TMZ-S and TMZ-R LN229 and GBM8401 cells using western blotting. The results indicate that valsartan had no significant effect on MGMT expression (Figure 1C). Taken together, these results suggest that valsartan robustly attenuates drug resistance in TMZ-S and TMZ-R LN229 and GBM8401 cells but not in normal NHA cells.

Valsartan inhibited the proliferation of both TMZ-S and TMZ-R glioma cells

The above results indicate that valsartan effectively decreased viability in TMZ-S and TMZ-R GBM cells. Therefore, we aimed to assess the proliferative capacity of these cells. We treated TMZ-S and TMZ-R GBM cells with valsartan at concentrations of 0, 100, 200, 300, and 400 μΜ for 48 h and stained them with BrdU. The results demonstrated that valsartan inhibited cell proliferation in a dose-dependent manner (Figure 2A–D). We subsequently performed colony formation assays to evaluate the prolonged impact of valsartan. Valsartan dose-dependently inhibited the colony formation of both TMZ-sensitive and TMZ-resistant clones (Figure 3A–D). In summary, our BrdU flow cytometry and colony formation assays indicated that valsartan significantly inhibited the proliferation of GBM cells.

Figure 2.

Valsartan dose-dependently inhibited cell proliferation. Cells were stained with BrdU and analyzed by flow cytometry to measure proliferation of LN229 TMZ-S (A), LN229 TMZ-R (B), GBM8401 TMZ-S (C), and GBM8401 TMZ-R (D) clones (0, 100, 200, and 300 μM, respectively, for 48 h; unpaired two-tailed Student's t test; n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).

Figure 3.

Valsartan inhibited colony formation in a dose-dependent manner. (A–D) Colony formation of LN229 TMZ-S (A), LN229 TMZ-R (B), GBM8401 TMZ-S (C), and GBM8401 TMZ-R (D) cells treated with 0, 100, 200, or 300 μM valsartan for 14 days (unpaired two-tailed Student's t test; n = 3; **p < 0.01, ***p < 0.001).

Valsartan-induced apoptosis in both TMZ-sensitive and TMZ-resistant glioma cell lines

Since valsartan did not significantly affect MGMT expression (Figure 1C), we investigated whether it induces apoptosis.²⁶ Both the TMZ-S and TMZ-R GBM cell lines were treated with valsartan (0, 100, 200, or 300 μM) for 48 h, followed by Annexin V and 7-AAD staining. Flow cytometry was used to quantitatively assess the extent of programmed cell death, specifically apoptosis. Compared with the control group, the proportion of apoptotic cells increased in a dose-dependent manner upon valsartan treatment (Figure 4A–D). Additionally, western blot analysis was performed to assess the expression levels of apoptosis-related proteins. The results demonstrated that the expression of the DNA damage marker γ-H2AX increased with increasing valsartan concentration, indicating that increased DNA damage contributes to the induction of apoptosis. Conversely, the expression of the antiapoptotic protein survivin was significantly reduced, further supporting the conclusion that valsartan promotes apoptosis (Figure 4E–4H). Therefore, these findings confirm that valsartan induces apoptosis in both TMZ-S and TMZ-R GBM cells.

Figure 4.

Valsartan-induced apoptosis in TMZ-S and TMZ-R glioma cells. (A–D) Apoptotic proportions of LN229 TMZ-S (A), LN229 TMZ-R (B), GBM8401 TMZ-S (C), and GBM8401 TMZ-R (D) clones treated with 0, 100, 200, or 300 μM valsartan, analyzed by flow cytometry based on annexin V and 7-AAD positivity. Bars indicate means ± SDs (unpaired two-tailed Student's t test; n = 3; **p < 0.01, ***p < 0.001). (E–H) Western blots showing γ-H2AX and survivin levels in LN229 TMZ-S (E), LN229 TMZ-R (F), GBM8401 TMZ-S (G), and GBM8401 (H) TMZ-R glioma cells treated with 0, 100, 200, and 300 μM valsartan for 48 h. Bars indicate means ± SDs (unpaired two-tailed Student's t test; n = 3, *p < 0.05, **p < 0.01, ***p < 0.001).

Valsartan inhibited the migration of both TMZ-sensitive and TMZ-resistant glioma cell lines

Enhanced cell migration, a hallmark of aggressive cancers, is closely linked to EMT and reflects the potential for tumorigenesis and metastasis. Therefore, in addition to promoting apoptosis, inhibiting cell migration is also critical for cancer drugs. In this study, we used a wound healing assay to evaluate the cellular migration process. A scratch was made in the monolayer of cells, followed by treatment with different concentrations of valsartan (0, 100, 200, 300 μM) for 16 h. Cells treated with valsartan exhibited slower wound closure, as the healing rate progressively decreased with increasing concentrations of valsartan (Figure 5A–D). Additionally, the expression levels of proteins associated with EMT markers were analyzed by western blotting, and the results revealed that the expression of Snail was inhibited by valsartan (Figure 5E–H). Briefly, these data confirm that valsartan inhibits the migration of TMZ-S and TMZ-R GBM cells by suppressing the expression of Snail.

Figure 5.

Valsartan inhibited the migration capacity of TMZ-S and TMZ-R glioma cells in a dose-dependent manner. (A–D) The migration capacity of LN229 TMZ-S (A), LN229 TMZ-R (B), GBM8401 TMZ-S (C), and GBM8401 TMZ-R (D) clones was analyzed via a wound healing assay. (E–H) Expression of EMT marker snail in TMZ-S and TMZ-R glioma cells was assessed by western blotting (0–300 μM, for 48 h; unpaired two-tailed Student's t test; n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).

Valsartan-induced G1-phase cell cycle arrest in both TMZ-sensitive and TMZ-resistant GBM clones

The above results indicate that valsartan inhibits tumorigenicity in GBM cells by inducing apoptosis and inhibiting cell proliferation and migration. To determine whether other pathways are affected by valsartan treatment, we used RNA sequencing. The top 10 pathways whose level of enrichment was most affected by valsartan in both TMZ-sensitive and TMZ-resistant clones were identified and compared, revealing a common pathway: the cell cycle (Tables 3 and 4). The effects of valsartan on the cell cycle were subsequently validated. The results demonstrated that the cell cycle was arrested at the G1 phase after valsartan treatment (Figure 6A–D). These findings suggest that valsartan induces G1 phase arrest, preventing cells from progressing to subsequent DNA replication and cell division stages, which likely accounts for the inhibition of cell proliferation and promotion of apoptosis observed in previous experiments.

Figure 6.

Valsartan contributed to cell cycle arrest at the G1 phase in TMZ-S and TMZ-R glioma cells. Cell cycle analysis of LN229 TMZ-S cells. (A), LN229 TMZ-R (B), GBM8401 TMZ-S (C), and GBM8401 TMZ-R (D) clones were analyzed by flow cytometry via PI staining (0–300 μM, for 48 h; 6n = 3).

Table 3.

List of the top 10 enriched pathway terms associated with valsartan treatment in LN229 cells.

ID	pathway	count	p-value
hsa04110	Cell cycle	157	1.39.86E-07
hsa04613	Neutrophil extracellular trap formation	191	0.000501607
hsa05116	Human T-cell leukemia virus 1 infection	222	0.000748963
hsa05322	Systemic lupus erythematosus	137	0.00094871
hsa04371	Apelin signaling pathway	139	0.001069247
hsa04933	AGE-RAGE signaling pathway in diabetic complications	100	0.001230867
hsa03030	DNA replication	36	0.002341296
hsa04114	Oocyte meiosis	131	0.002341713
hsa04218	Cellular senescence	156	0.002696276
hsa05418	Fluid shear stress and atherosclerosis	139	0.003605373

Table 4.

List of the top 10 enriched pathway terms associated with valsartan treatment in LN229 TMZ-R cells.

ID	pathway	count	p-value
hsa04010	MAPK signaling pathway	301	0.000993915
hsa04110	Cell cycle	157	0.002013078
hsa05200	Pathways in cancer	531	0.002959253
hsa04360	Axon guidance	182	0.005387851
hsa05144	Human T-cell leukemia virus 1 infection	222	0.006541892
hsa04933	AGE-RAGE signaling pathway in diabetic complications	100	0.009875149
hsa04014	Ras signaling pathway	236	0.010662341
hsa04380	Osteoclast differentiation	135	0.014519422
hsa04080	Neuroactive ligand-receptor interaction	367	0.018935283
hsa04610	Complement and coagulation cascades	86	0.02112584

TMZ: temozolomide.

Valsartan inhibits the expression of APLN, which is related to angiogenesis

Valsartan functions by blocking the binding of angiotensin to its receptor, thereby inhibiting the RAS. Previous studies have demonstrated a connection between the RAS and vascular function. During our investigation of the genes affected by valsartan, we identified APLN as the most downregulated gene following treatment (Figure 7A). This gene has been shown to be associated with cardiovascular functions and vessel formation. To validate the involvement of the APLN signaling pathway, we analyzed APLN mRNA expression by qPCR. The results revealed that valsartan treatment suppressed APLN expression (Figure 7B–7E). Next, we investigated the relationship between APLN expression and GBM outcomes using publicly available databases. Analysis via GEPIA and GENT2 demonstrated that APLN expression is positively correlated with GBM progression (Figure 7F–7G). Moreover, data from GEPIA and the CGGA revealed a negative correlation between APLN expression and GBM prognosis; that is, high APLN expression was associated with poor outcomes (Figure 7H–7I).

Figure 7.

APLN is a potential downstream target of valsartan. (A) RNA sequencing revealed the top 10 upregulated and downregulated genes. (B–E) APLN mRNA expression in LN229 TMZ-S (B), LN229 TMZ-R (C), GBM8401 TMZ-S (D), and GBM8401 TMZ-R (E) clones was measured via RT−PCR after treatment with valsartan (0–300 μM, for 48 h, unpaired two-tailed Student's t test, n = 3, *p < 0.05, **p < 0.01, ***p < 0.001). Expression levels of APLN in different stages of glioma tissue were analyzed via GEPIA (F) and GENT2 (G). Kaplan–Meier survival analysis was performed using data from GEPIA (H) and the Chinese Glioma Genome Atlas (CGGA) (I). T: tumor; N: normal control; LGG: low-grade glioma; HR: hazard ratio; p(HR): pooled hazard ratio; TPM: transcripts per million. TMZ: temozolomide; GEPIA: Gene Expression Profiling Interactive Analysis; GENT2: Gene Expression Database of Normal and Tumor Tissues 2.

Discussion

At present, treatments for GBM are limited. Although bevacizumab, an antiangiogenic agent, can effectively inhibit angiogenesis and reduce tumor size, it does not significantly increase overall survival rates.²⁷ Moreover, resistance to TMZ decreases treatment efficacy. Therefore, identifying new therapeutic strategies remains a critical and pressing challenge. In this study, we focused on the effect of blocking the RAS via valsartan on GBM clones with and without TMZ resistance.

RAS is expressed in various tissues and affects tumor development by regulating cell proliferation.²⁸ Previous reports have shown that AT1-R activates multiple pathways, such as the Wnt/β-catenin, MAPK-STAT3 and PI3K-AKT pathways, thereby promoting cancer growth.^29,30 RAS inhibitors (RASis) have been shown to suppress tumor growth, metastasis, and cellular proliferation in various cancers.²⁸ For example, Uemura et al. reported that ARBs inhibit prostate cancer cell proliferation by suppressing MAPK-STAT3 signaling.³¹ Reddy et al. reported that RASis reduce K-ras expression, decrease the levels of proliferation markers such as PCNA and PKC-p, and hinder mitosis by modulating gene expression in pancreatic cancer.³² In this study, we observed that valsartan dose-dependently inhibited the survival, proliferation and colony formation of GBM clones with and without TMZ-R. Moreover, the RNA sequencing data revealed that the MAPK and RAS signaling pathways were significantly altered after valsartan treatment in GBM cells. These data are consistent with previous reports.

TMZ IC₅₀ values in glioma cell lines vary widely, ranging from low to high micromolar ranges. For instance, Yoshino et al. reported TMZ IC₅₀ values for seven malignant glioma cell lines ranging from 22.5 to 441.6 μM. After using a cDNA microarray to explore mechanisms associated with TMZ sensitivity in various glioma cells, they reported that MGMT expression plays a dominant role.³³ Moreover, Perazzoli et al. analyzed TMZ sensitivity in four nervous system cancer cell lines, A172, LN229, SF268, and SK-N-SH. Unlike a previous study, they reported the values of TMZ IC₅₀ positively correlated with the level of MGMT expression.³⁴ Based on these studies, we evaluated TMZ IC₅₀ and MGMT expression in TMZ-sensitive and -resistant LN229 and GBM8401 cells.

Overcoming TMZ resistance in GBM cells often involves strategies that induce apoptosis.²⁶ For example, Li et al. reported that pyrvinium pamoate increases the sensitivity of GBM cells to TMZ chemotherapy by downregulating MGMT expression through strong suppression of Wnt signaling and repression of survivin, an antiapoptotic protein.³⁵ Tsai et al. described SNAP, a nitric oxide donor, as an effective agent for counteracting TMZ resistance in human GBM cells. The mechanism involves suppression of MGMT expression while promoting apoptosis, a process linked to elevated levels of cleaved PARP and cytochrome C, two key apoptosis-related proteins.²⁰ This study demonstrated that increasing the valsartan dosage triggered apoptotic pathways by reducing survivin expression while promoting the accumulation of γ-H2AX foci, indicating persistent DNA damage.

RNA sequencing revealed that the anti-GBM mechanism of valsartan involves the apelin signaling pathway, as APLN expression was significantly downregulated upon treatment. Previous studies have shown that this pathway plays an essential role in tumor angiogenesis^36–38 and that APLN expression is negatively correlated with hepatocellular carcinoma prognosis.³⁹ Additionally, knockout of APLN in mice has been shown to suppress angiogenesis in the context of malignant melanoma, thereby inhibiting the growth of this vasculature-dependent tumor and improving survival rates in mice.⁴⁰ Anne et al. reported that apelin/APLNR signaling is essential for tumor angiogenesis, as evidenced by orthotopic GBM mouse models. Moreover, APLN-knockout mice exhibited significant suppression of vascular-dependent tumor growth.⁴¹ In this study, we confirmed that valsartan suppressed APLN mRNA expression in both parental and TMZ-R GBM cells. Experiments are needed in the future to verify whether apelin signaling is associated with TMZ resistance.

Although the current results demonstrate that valsartan has therapeutic effects on GBM cells, this study has several limitations, including the lack of in vivo validation of these findings. Further validation of apoptosis-related mechanisms through various pathways may also be conducted in the future. While the concentrations of valsartan employed in this study (up to 300 µM) exceed those typically attainable in vivo due to its limited oral bioavailability (∼23%) and pharmacokinetic constraints,⁴² they were selected to assess the maximal cytotoxic potential of the compound in GBM cell lines, independent of its established antihypertensive function. To address translational limitations associated with these in vitro concentrations, potential strategies for enhancing central nervous system delivery need to be developed. These include nanoparticle-based formulations and lipid carriers designed to improve blood–brain barrier permeability,⁴³ as well as localized delivery methods such as convection-enhanced delivery that may achieve higher regional drug concentrations.⁴⁴ Furthermore, valsartan may serve as a sensitizing agent in combination with other therapies, such as metformin, a metabolic modulator,⁴⁵ and vorinostat, a histone deacetylase inhibitor,⁴⁶ both of which have been confirmed to inhibit the growth of GBM cell lines. The dosage of valsartan can potentially be reduced to clinically feasible levels through synergistic interactions with other therapeutic compounds.

Conclusion

In this study, GBM cell lines with and without TMZ resistance were utilized to simulate clinical conditions. The experimental results support the anti-GBM effects of valsartan. However, the mechanism underlying the regulation of TMZ resistance by valsartan requires further investigation.

Footnotes

Acknowledgements

AI-based tools were employed in this study to identify and correct grammatical errors.

ORCID iDs

Jia-Rong Hu

Chia-Kuang Tsai

Ethics committee

Ethical approval (TSGHIRB No. E202416006) was granted by the Ethics Committee of Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan, on March 12, 2024.

Authors’ contributions

CKT and DYH conceptualized and designed the study. JRH, YK, YLC, CKT, and DYH conducted the research and contributed to the development of the methodology. The initial draft of this manuscript was authored by JRH and CKT. Data interpretation was carried out by JRH, YK, YLC, FCY, CKT, and DYH. All authors have reviewed and approved the final version for submission. The corresponding authors confirm that all listed authors have fulfilled the necessary authorship criteria and that no eligible contributors have been omitted.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Tri-Service General Hospital, National Science and Technology Council, Ministry of National Defense Medical Affairs Bureau, (grant number TSGH_E_114252, TSGH-C02-112031 and TSGH-C03-113039, NSTC 113-2321-B-016-005 and NSTC 112-2314-B-016−, MND-MAB-D-112075, MND-MAB-D-113058, MND-MAB-D-1130).

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data availability statement

The data that support the findings of this study are available from the corresponding authors, Chia-Kuang Tsai and Dueng-Yuan Hueng, upon reasonable request.

References

Zhan

Cui

, et al. Blood exosomes-based targeted delivery of cPLA2 siRNA and metformin to modulate glioblastoma energy metabolism for tailoring personalized therapy. Neuro Oncol 2022; 24: 1871–1883.

Miller

Ostrom

Kruchko

, et al. Brain and other central nervous system tumor statistics, 2021. CA Cancer J Clin 2021; 71: 381–406.

Wen

Weller

Lee

, et al. Glioblastoma in adults: a society for neuro-oncology (SNO) and European society of neuro-oncology (EANO) consensus review on current management and future directions. Neuro Oncol 2020; 22: 1073–1113.

Delello Di Filippo

Hofstatter Azambuja

Paes Dutra

, et al. Improving temozolomide biopharmaceutical properties in glioblastoma multiforme (GBM) treatment using GBM-targeting nanocarriers. Eur J Pharm Biopharm 2021; 168: 76–89.

Singh

Miner

Hennis

, et al. Mechanisms of temozolomide resistance in glioblastoma - a comprehensive review. Cancer Drug Resist 2021; 4: 17–43.

Tan

Ashley

Lopez

, et al. Management of glioblastoma: state of the art and future directions. CA Cancer J Clin 2020; 70: 299–312.

Sipos

Raposa

Freihat

, et al. Glioblastoma: clinical presentation, multidisciplinary management, and long-term outcomes. Cancers (Basel) 2025; 17: 20250105.

Nehme

Zouein

Zayeri

, et al. An update on the tissue renin angiotensin system and its role in physiology and pathology. J Cardiovasc Dev Dis 2019; 6: 20190329.

Karnik

Unal

Kemp

, et al. International union of basic and clinical pharmacology. XCIX. Angiotensin receptors: interpreters of pathophysiological angiotensinergic stimuli [corrected]. Pharmacol Rev 2015; 67: 754–819.

10.

Poznyak

Bharadwaj

Prasad

, et al. Renin-angiotensin system in pathogenesis of atherosclerosis and treatment of CVD. Int J Mol Sci 2021; 22: 20210622.

11.

Afsar

Ertuglu

, et al. Renin-angiotensin system and cancer: epidemiology, cell signaling, genetics and epigenetics. Clin Transl Oncol 2021; 23: 682–696.

12.

Morato

Reina-Couto

Pinho

, et al. Regulation of the renin-angiotensin-aldosterone system by reactive oxygen species. Renin-Angiotensin System - Past, Present and Future 2017.

13.

Woo

Jung

. Angiotensin II receptor blockers induce autophagy in prostate cancer cells. Oncol Lett 2017; 13: 3579–3585.

14.

Lin

Wang

Tsai

, et al. Angiotensin II receptor blockers valsartan and losartan improve survival rate clinically and suppress tumor growth via apoptosis related to PI3 K/AKT signaling in nasopharyngeal carcinoma. Cancer 2021; 127: 1606–1619.

15.

Mansour

AMA

Khattab

El-Khatib

, et al.

Valsartan as a prophylactic treatment against breast cancer development and niche activation: what molecular sequels follow chronic AT-1R blockade?

Life Sci 2024; 353: 122939.

16.

Asgharzadeh

Mostafapour

Ebrahimi

, et al. Inhibition of angiotensin pathway via valsartan reduces tumor growth in models of colorectal cancer. Toxicol Appl Pharmacol 2022; 440: 115951.

17.

Nakamura

Kiniwa

Okuyama

. CCL5 Production by fibroblasts through a local renin-angiotensin system in malignant melanoma affects tumor immune responses. J Cancer Res Clin Oncol 2021; 147: 1993–2001.

18.

Wang

Wei

Yin

, et al. Angiotensin receptor blocker associated with a decreased risk of lung cancer: an updated meta-analysis. J Pers Med 2023; 13: 20230129.

19.

Cai

Zeng

, et al. Valsartan alleviates the blood-brain barrier dysfunction in db/db diabetic mice. Bioengineered 2021; 12: 9070–9080.

20.

Tsai

Huang

, et al. SNAP reverses temozolomide resistance in human glioblastoma multiforme cells through down-regulation of MGMT. FASEB J 2019; 33: 14171–14184.

21.

Tang

Kang

, et al. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 2017; 45: W98–W102.

22.

Park

Yoon

Kim

, et al. GENT2: An updated gene expression database for normal and tumor tissues. BMC Med Genomics 2019; 12: 1101.

23.

Zhao

Zhang

Wang

, et al. Chinese Glioma Genome Atlas (CGGA): a comprehensive resource with functional genomic data from Chinese glioma patients. Genomics Proteomics Bioinformatics 2021; 19: 1–12.

24.

Zhang

Stevens

Bradshaw

. Temozolomide: mechanisms of action, repair and resistance. Curr Mol Pharmacol 2012; 5: 102–114.

25.

Yang

Wei

Dai

, et al. C8-substituted imidazotetrazine analogs overcome temozolomide resistance by inducing DNA adducts and DNA damage. Front Oncol 2019; 9: 485.

26.

Tang

Ren

Bai

, et al. Novel strategies to overcome chemoresistance in human glioblastoma. Biochem Pharmacol 2024; 230: 116588.

27.

Gramatzki

Roth

Rushing

, et al. Bevacizumab may improve quality of life, but not overall survival in glioblastoma: an epidemiological study. Ann Oncol 2018; 29: 1431–1436.

28.

Hassani

Attar

Firouzabadi

. The renin-angiotensin-aldosterone system (RAAS) signaling pathways and cancer: foes versus allies. Cancer Cell Int 2023; 23: 254.

29.

Ichihara

Yatabe

. The (pro)renin receptor in health and disease. Nat Rev Nephrol 2019; 15: 693–712.

30.

Wang

Nishiyama

Matsuyama

, et al. The (pro)renin receptor: a novel biomarker and potential therapeutic target for various cancers. Cell Commun Signal 2020; 18: 39.

31.

Uemura

Ishiguro

Nakaigawa

, et al. Angiotensin II receptor blocker shows antiproliferative activity in prostate cancer cells: a possibility of tyrosine kinase inhibitor of growth factor. Mol Cancer Ther 2003; 2: 1139–1147.

32.

Reddy

Baskaran

Molteni

. Inhibitors of angiotensin-converting enzyme modulate mitosis and gene expression in pancreatic cancer cells. Proc Soc Exp Biol Med 1995; 210: 221–226.

33.

Yoshino

Ogino

Yachi

, et al. Gene expression profiling predicts response to temozolomide in malignant gliomas. Int J Oncol 2010; 36: 1367–1377.

34.

Perazzoli

Prados

Ortiz

, et al. Temozolomide resistance in glioblastoma cell lines: implication of MGMT, MMR, P-glycoprotein and CD133 expression. PLoS One 2015; 10: e0140131.

35.

Liu

Jin

, et al. Pyrvinium pamoate regulates MGMT expression through suppressing the wnt/beta-catenin signaling pathway to enhance the glioblastoma sensitivity to temozolomide. Cell Death Discov 2021; 7: 288.

36.

Cox

D'Agostino

Miller

, et al. Apelin, the ligand for the endothelial G-protein-coupled receptor, APJ, is a potent angiogenic factor required for normal vascular development of the frog embryo. Dev Biol 2006; 296: 177–189.

37.

Helker

Eberlein

Wilhelm

, et al. Apelin signaling drives vascular endothelial cells toward a pro-angiogenic state. Elife 2020; 9: 20200921.

38.

Kalin

Kretz

Meyer

, et al. Paracrine and autocrine mechanisms of apelin signaling govern embryonic and tumor angiogenesis. Dev Biol 2007; 305: 599–614.

39.

Mao

Zhu

Pan

, et al. Apelin (APLN) is a biomarker contributing to the diagnosis and prognosis of hepatocellular carcinoma. Sci Rep 2024; 14: 20441.

40.

Inukai

Kise

Hayashi

, et al. Cancer apelin receptor suppresses vascular mimicry in malignant melanoma. Pathol Oncol Res 2023; 29: 1610867.

41.

Frisch

Kalin

Monk

, et al. Apelin controls angiogenesis-dependent glioblastoma growth. Int J Mol Sci 2020; 21: 20200611.

42.

Prieto

Evtoski

Pardo-Figuerez

, et al. Nanostructured valsartan microparticles with enhanced bioavailability produced by high-throughput electrohydrodynamic room-temperature atomization. Mol Pharm 2021; 18: 2947–2958.

43.

Sabry

Abd El Razek

Nabil

, et al. Brain-targeted delivery of valsartan using solid lipid nanoparticles labeled with rhodamine B; a promising technique for mitigating the negative effects of stroke. Drug Deliv 2023; 30: 2179127.

44.

Bhandari

Jaiswal

Singh

, et al. Convection-enhanced delivery of antiangiogenic drugs and liposomal cytotoxic drugs to heterogeneous brain tumor for combination therapy. Cancers (Basel) 2022; 14: 20220829.

45.

Yang

, et al. Metformin upregulates circadian gene PER2 to inhibit growth and enhance the sensitivity of glioblastoma cell lines to radiotherapy via SIRT2/G6PD pathway. Front Pharmacol 2025; 16: 1563865.

46.

Diss

Nalabothula

Nguyen

, et al. Vorinostat(SAHA) promotes hyper-radiosensitivity in wild type p53 human glioblastoma cells. J Clin Oncol Res 2014; 2.

Therapeutic potential of valsartan in overcoming chemoresistance in human glioblastoma

Abstract

Objective

Methods

Results

Conclusions

Keywords

Introduction

Glioblastoma multiforme

Materials and methods

Chemicals

Cell culture

Cell lysis and protein quantification

Western blotting

Cell viability assay

Apoptosis assay

Colony formation assay

Cell proliferation assay

Wound healing assay

Cell cycle analysis

Bioinformatics examination

Gene expression profiling and biological pathway analysis

RNA isolation

Real-time reverse transcription polymerase chain reaction

Statistical analysis

Results

A GBM cell line with TMZ resistance was successfully generated

Valsartan decreased the proportion of viable GBM cells regardless of TMZ sensitivity

Valsartan inhibited the proliferation of both TMZ-S and TMZ-R glioma cells

Valsartan-induced apoptosis in both TMZ-sensitive and TMZ-resistant glioma cell lines

Valsartan inhibited the migration of both TMZ-sensitive and TMZ-resistant glioma cell lines

Valsartan-induced G1-phase cell cycle arrest in both TMZ-sensitive and TMZ-resistant GBM clones

Valsartan inhibits the expression of APLN, which is related to angiogenesis

Discussion

Conclusion

Footnotes

Acknowledgements

ORCID iDs

Ethics committee

Authors’ contributions

Funding

Declaration of conflicting interests

Data availability statement

References