Sage Journals: Discover world-class research

Abstract

Clear cell renal cell carcinoma (ccRCC) is the most common malignant neoplasm of the kidney and belongs to the few human tumors known to develop from mutations of the VHL tumor suppressor gene. VHL germline mutations are associated with hereditary ccRCCs in VHL disease. However, somatic VHL gene defects may also occur in sporadic ccRCCs. In this study, we analyzed the frequency and the spectrum of VHL gene alterations in 35 Italian patients with sporadic renal cell carcinoma (RCC). Tumor-specific intragenic VHL pathogenic mutations were detected in 38% (11/29) of the ccRCC patients and 33% (2/6) of the patients with other types of RCC. One novel 18-bp in-tandem duplication and 4 previously unreported nucleotide changes in the VHL gene were described. Microsatellite analysis showed loss of heterozygosity for at least 1 informative marker in 43% (9/21) of the ccRCCs and 50% (3/6) of the non-ccRCCs; 5 of the 13 tumors (38%) harboring VHL gene alterations also had loss of heterozygosity for at least 1 microsatellite marker. Our results confirm that somatic inactivation of the VHL gene may play a pivotal role in the tumorigenesis of sporadic ccRCCs in Italian patients and suggests that mutation analysis of the VHL gene may be helpful for discriminating sporadic, VHL-gene-related ccRCCs from those related to VHL disease.

Keywords

VHL Mutations RCCs Sporadic

Introduction

Renal cell carcinoma (RCC) is a rare tumor and accounts for 2%-3% of all malignant diseases in adults (1). Clear cell renal cell carcinoma (ccRCC) (2) is the most common malignant neoplasm of the kidney, is usually a sporadic isolated tumor and belongs to the few human tumors known to develop from mutations of the Von Hippel-Lindau (VHL) tumor suppressor gene.

The human VHL gene (NM_000551) is a tumor suppressor located on the short arm of chromosome 3 (position 3p25.3) (3) and is widely expressed in both fetal and adult tissues (4). The VHL gene encodes 2 protein isoforms of 213 and 160 aminoacid residues, with a predominant cytoplasmic localization (5). One of the main functions of the VHL gene product is its involvement in hypoxia-induced angiogenesis through the formation of a multiprotein complex with elongin B, elongin C, and Cullin 2 (VCBCUL2 complex) (6 -9). This complex is best known for its ability to target hypoxia-inducible factors (HIF) for polyubiquitination and proteasomal degradation of several cellular proteins. Moreover, HIF-independent pVHL functions have also been described as being relevant to tumor development, including maintenance of the primary cilium, regulation of extracellular matrix formation and turnover, and modulation of cell death in certain types of cells (due to growth factor withdrawal or in response to other forms of stress) (10 -15). Germline mutations in the VHL gene lead to the development of the VHL disease (MIM# 193300), a rare dominantly inherited familial cancer syndrome with a marked phenotypic variability predisposing to central nervous system (CNS) and retinal hemangioblastomas, as well as to ccRCC and pheochromocytomas (16 -19). VHL somatic mutations have also been related to the pathogenesis of sporadic ccRCCs in 20%-82% of cases in the United States, Europe and Japan (20 -24) and in 8%-20% of cases in a Dutch study of ccRCCs (25). In the present study, we performed molecular analysis of the VHL gene on 35 tumor tissues of Italian patients affected by sporadic RCCs. Tumor-specific intragenic VHL mutations were detected in 11 out of 29 ccRCC patients (38%) and in 2 of the 6 (33%) non-ccRCC patients, confirming the involvement of somatic inactivation of the VHL gene in the tumorigenesis of sporadic ccRCCs in a sample of the Italian population.

Materials and Methods

Patients and Tissue Specimens

A total of 35 patients from Southern Italy with isolated RCC were recruited at the Department of Biomedical Sciences of the University of Foggia (Italy) between 2004 and 2006. For all cases, clinicopathological information including sex, age, tumor type, age at diagnosis, stage, and lymph node status were collected (Tab. I). Since the aim of this study was to evaluate the actual incidence of VHL somatic mutations in sporadic forms of RCC, patients with a family history of renal cancer or with a history of another malignancy were excluded. Following the revision and approval of the study by the local ethical committee, written and informed consent was obtained from each patient before enrollment. Peripheral blood and tissue samples were collected from all patients before and after surgical treatment. A dedicated pathologist reviewed all specimens, using the TNM 2009 for tumor staging. All tumor samples and paired tumor-free normal tissues were formalin-fixed and paraffin-embedded. Specifically, we collected 29 ccRCCs, 5 non-ccRCCs (2 papillary renal cell carcinomas [pRCC] and 3 chromofobe renal cell carcinomas [cRCC]) and 1 tumor tissue composed of both ccRCC and cRCC.

Table I

Pathological Characteristics Of The Rcc Patients’ Cohort

Age at diagnosis	Median (IQR)	67 (58-75)
Sex	Female	17 (49%)
	Male	18 (51%)
Tumor	T1	15 (42%)
	T2	3 (8%)
	T3	15 (42%)
	T4	2 (5%)
Lymph node status	N0	31 (86%)
	N1	4 (11%)
Metastases	M0	31 (86%)
	M1	4 (11%)
Histology	ccRCC	29 (80%)
	non-ccRCC	6 (17%)
Side	Left	18 (51%)
	right	16 (46%)
	bilateral	1 (3%)

DNA was extracted from paraffin-embedded tissues as previously described (26). Briefly, both normal and tumor tissue from unstained paraffin sections were reviewed by the pathologist; each block with tumor tissue was carefully microdissected to ensure that it contained more than 70% of tumor cells. Normal renal tissue was used as source of control DNA for each patient in loss of heterozygosity (LOH) experiments. It was previously reported that artifacts may occur when using archived paraffined material and that the chance of introducing these artificial mutations in formalin-fixed material was inversely correlated to the number of cells used for PCR (27). However, the number of cells in our analyses was large (>500 cells), since we used 10-μ slices of paraffin-embedded material.

DNA from peripheral blood lymphocyte (PBL) samples was extracted using the standard phenol-chloroform procedure (28). DNA concentration was quantified by measuring its absorbance at 260 nm and 280 nm, using a Nanodrop spectrophotometer.

Molecular genetic analysis

Mutation analysis

PCR amplification was performed for the entire VHL coding sequence and the promoter region, including exon-intron boundaries. The set of primers was original and is shown in Table II. PCR products were purified, using GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare, Buckinghamshire, UK), and sequenced. Sequencing reactions were loaded on an ABI 3100 capillary sequencer (Applied Biosystems, Foster City, CA) and analyzed using the Sequencing Analysis software v.3.7 (PE Applied Biosystems). Once mutations in the DNA from tumor samples were detected, we searched for the same mutations in the corresponding PBL, as to identify germline mutations.

Table II

Primer Sequences for VHL Gene Amplification and LOH Analysis

Exon	Primer name	Primer sequences (5→3′)	Tm (°C)	PCR product size (bp)
Promoter	5′UTR-prom_fw	TAGCCTCGCCTCCGTTACAA	58	297
	5′UTR-prom_rv	TTCTTCAGGGCCGTACTCTTCGA
1	VHL-ex1a_fw	GTCTGGATCGCGGAGGGAAT	60	260
	VHL-ex1a_rv	GGACTGCGATTGCAGAAGAT
	VHL-ex1b_fw	TGCGCTCGGTGAACTCGCGCGA	60	206
	VHL-ex1b_rv	TTCAGACCGTGCTATCGTCC
2	VHL-ex2_fw	CACCGGTGTGGCTCTTTAAC	56	241
	VHL-ex2_rv	TGGGCTTAATTTTTCAAGTGG
3	VHL-ex3_fw	GCAAAGCCTCTTGTTCGTTC	56	296
	VHL-ex3_rv	CCATCAAAAGCTGAGATGAAA
Flanking	D3S1335F	AAGGCACTGAGGAGATGAGA	LMS2	120
	D3S1335R	TAGGAAAATTAGACGGAAGCAA
	D3S1304F	TTCGCTCTTTGATAGGC	LMS2	253
	D3S1304R	ATTTCATTTGTAATTTACTAGCAG

The 18-bp duplication in exon 2 was characterized by cloning the PCR products from mutated samples into StrataClone™ PCR Cloning Vector pSC-A (Stratagene), amplifying the products directly from crude lysates of single bacterial colonies, and direct sequencing.

VHL gene deletions analysis

Analysis of genomic deletions in the VHL gene on DNA extracted from patients’ PBL was performed in long PCR by using a set of primer pairs previously described (29). Briefly, large fragments were amplified in a final volume of 25 μL, using 2U of Expand Long Template Enzyme (Roche), 20 pmol of each primer, 500 μM dNTPs, and 400 ng of template DNA.

Loss of heterozygosity (LOH) analysis

Fluorescent LOH analysis using genomic DNA from matched peripheral blood samples and tumor tissues was performed using 2 microsatellite markers flanking the VHL gene: D3S1335 and D3S1304. PCR was performed in a 50 μL reaction volume containing 2.5 μL of 10X PCR Buffer (Eppendorf), 0.25 nM dNTPs, 20 pmol of each primer, 1 U HotMaster Taq (Eppendorf) and 100 ng of DNA. Cycling conditions consisted of 40 cycles of the LMS2 (ABI Prism™ Linkage Mapping Set version 2) method, performed on a GeneAmp PCR System 9700 (Applied Biosystems) for all markers.

After capillary array electrophoresis (ABI 3100, Applied Biosystems) and data analysis by the ABI Genescan and Genotyper Software 3.7 (Applied Biosystems), the LOH or allelic imbalance (AI) value was quantified using the following formula: (peak 1 height/peak 2 height in tumor DNA)/(peak 1 height/peak 2 height in normal DNA). For this calculation we followed more strict criteria than those indicated in a previous paper (30). In the present study, the cutoff values for defining a LOH were: <0.65 or >1.5. LOH was confirmed at least twice for each marker.

Methylation-specific PCR analysis

DNA extracted from tumor samples was subjected to bisulphite treatment and DNA purification using the Epitect Bisulfite kit (Qiagen Sci, MD USA) according to the manufacturer's instructions. Bisulphite-modified DNA was used as template for conventional methylation-specific PCR. Conventional methylation-specific PCR was carried out as previously described (31), by using the following primer pairs: U: GTTGGAGGATTTTTTTGTGTATGT (sense) and CCCAAACCAAACACCACAAA (antisense); M: TGGAGGATTTTTTTGCGTACGC (sense) and GAACCGAACGCCGCGAA (antisense) (32). A PCR reaction for the ACTB gene promoter region not containing CpGs was also performed as control of the bisulfite conversion. PCR conditions were the following: 35 cycles at 95°C for 1 minute, 64°C and 72°C for 1 minute. For each PCR reaction CpGenome Universal Methylated DNA (Serological Corp., Norcross GA) was used as positive control, and Universal Unmethylated DNA (Serological Corp., Norcross, GA) was used as negative control. PCR products were run on 3% agarose gel stained with ethidium bromide, and visualized at UV light.

Statistical methods

Associations between tumors pathological parameters and RCC mutational status were assessed by using the chi-square or Fisher tests. All analysis were 2-tailed, and p values <0.05 were considered statistically significant. Statistical analysis was performed with the SPSS 13.0 statistical software package.

Results

Study cohort

Thirty-six patients (18 males and 17 females) with a single isolated RCC and no evidence of VHL disease were investigated. Patients had a mean age of 67 years (range 58-75 years). Distribution of the patients according to the frequency of tumor cell histotypes and TNM stage is shown in Table I. Histological analysis of the surgical specimens showed a predominance of ccRCCs (29 cases; 80%).

Molecular findings

A total of 17 nucleotide changes in the VHL gene were detected in the 35 tumor tissues from RCC patients (46%), with 1 patient presenting 2 different coding mutations in the same sample. Tumor-specific intragenic VHL mutations were detected in 38% (11/29) of the ccRCC patients. One of these ccRCC-affected patients had a germline mutation, since the mutation was observed in both normal renal specimens and peripheral blood. No other germline mutations or large VHL gene deletions were observed in peripheral blood of patients. Most of the mutations were identified in ccRCC patients (15/17; 88%); the other 2 point mutations were identified in 1 case of cRCC and 1 case of mixed tumor type (cRCC and ccRCC). We did not find any significant correlation between the presence of mutations and several clinicopathological variables.

Two different types of mutation were detected in the coding VHL region: point mutations (16/17), and one 18-bp duplication, all in heterozygous state. Only 1 (H125H) of the point mutations identified in the VHL exons was a silent variant, here reported for the first time. The mutations found on codons 33, 73 and 120 (p.S33X and p.Q73X and p.R120X) and the splicing mutations (c.463+2 T>C) resulted in a stop codon and a truncated protein. One 18-bp in-tandem duplication was also found in the VHL gene (c.340_358 dup18), likely affecting protein function by in-frame insertion of 6 consecutive aminoacids (Tab. III). The remaining 8 mutations are single-base substitutions resulting in aminoacidic changes (p.G39D, p.P86L, p.W88C, p.L89H, p.S111N, p.F119L, p.V130F, p.R161G) (Tab. II). Mutations were detected mainly in the exon 1 of the VHL gene (7/13). One of the mutations, a heterozygous 18-bp duplication in exon 2, has not been previously described (Fig. 1). DNA obtained from peripheral blood was available for all patients but only patient RCC-23, with a p.P25L alteration, showed in the germline the same aminoacidic change detected in tumor tissue. However, this variant has been previously described (33 -35) and was not considered a mutation, but rather a polymorphism. The design of the primers here used allowed amplification and analysis of the 5'UTR and promoter regions of the VHL gene in the same electropherogram. Two point mutations were identified (c.1-28G>A and c.1-97T>C, rs34271731) in the 5'UTR and VHL promoter regions (Genbank accession No AF010238). In summary, 13 of the 17 mutations (all identified missense, non sense and frameshift mutations) detected in the VHL gene were considered to be serious and all were detected at somatic level.

Fig. 1

18-bp in tandem duplication of the VHL gene identified in a sporadic RCC case. Representative sequence electropherogram illustrating the sequence of VHL exon 2 region in the wild type (A) and mutated allele (B). The 18-bp duplicated sequence is marked by the bar drawn below the sequence.

Table III

Molecular Vhl Gene Alterations Detected In Renal Cell Carcinomas

ID Study Cases	Histology	pTNm³	Mutation analysis							DA⁴
ID Study Cases	Histology	pTNm³	Amplicon	Exon/Intron	Nucleotide change	Effect on coding¹	Reference²	LOH³	Methylation	DA⁴
RCC-1	ccRCC	T3aN0M0	2	2	c.340_358 dup18	p.R113_G114ins GHLWLF	This study	yes		yes
RCC-2	ccRCC	T3aN0M0	/	/	/	/	/	yes	nv	nv
RCC-4	ccRCC	T1bN0M0	/	/	/	/	/	yes	no	no
RCC-5	ccRCC	T1N0M0	2	2	c.388 G>T	p.V130F	This study	yes	no	yes
RCC-6	ccRCC	T1N0M0	1b	1	c.266 T>A	p.L89H	Ref. 20	no	nv	nv
RCC-7	ccRCC	T1bN0MO	1a	1	c.217 C>T	p.Q73X	Ref. 58	nv		nv
RCC-11	ccRCC	T3aN0M0	1b	1	c.332 G>A	p.S111N	Ref. 58	yes		yes
RCC-13	ccRCC	T3bN0M0	2	IVS2	c.463+2 T>C	fs	Ref. 39	no	no	no
RCC-14	ccRCC	T4N2M1	/	/	/	/	/	yes	no	no
RCC-17	ccRCC	T3bN0M0	1a	1	c.98 C>A	p.S33X	This study	nv		nv
RCC-21	ccRCC	T1N0M0	1a	1	c.264 G>C	p.W88C	This study	no		nv
RCC-23	ccRCC	T4N2MX	1a	1	c.74 C>T	p.P25L (rs35460768)	Ref. 59	no		nv
RCC-24	ccRCC	T1aN0M0	/	/	/	/	/	yes	no	no
RCC-25	ccRCC	T3aN0M0	5'UTR 3	3	c.1-28 G>A c.481 C>G	To be defined p.R161G	This study Ref. 60	no		nv
RCC-27			promoter	/	c.1-97 T>C	rs34271731	This study	no	yes	yes
RCC-28	ccRCC	T3aN0M0	2	2	c.358 A>T	p.R120X	This Study	no	no	no
RCC-30	ccRCC	T1bN0M0	1a	1	c.116 G>A	p.G39D	This study	nv	nv	nv
RCC-33	ccRCC	T3aN0M0	2	2	c.375 C>T	p.H125H	This Study	nv	nv	nv
RCC-31	ccRCC+cRCC	T3bN0M0	2	2	c.357 C>A	p.F119L	This Study	yes	no	yes
RCC-10	cRCC	T3aN0M0	/	/	/	/	/	yes	nv	nv
RCC-16	cRCC	T3bN0M1	1b	1	c.257 C>T	p.P86L	Ref. 58, 60	yes	no	yes
RCC-34	pRCC	T2N2M0	/	/	/	/	/	yes	no	no

GeneBank entry NM_000551.2; alterations were compared to the Human Mutation Database [http://www.umd.necker.fr:2005] to determine if they were previously known or unknown.

References indicate the fist citation of the reported VHL variations. ³LOH (L) was defined as allelic imbalance (AI) ≤0.5. ³pTNM tumor staging. DA⁴ = double alteration. ccRCC = clear cell renal cell carcinoma; pRCC = papillary renal cell carcinoma; cRCC = chromofobe renal cell carcinoma. NV = not evaluable.

The results of the LOH analysis are summarized in Table III. Allelic losses on chromosome 3p were found for at least 1 informative marker in 11 out 24 (46%) RCC tumors, mainly ccRCCs (Fig. 2). Finally, 5 of the tumors harboring VHL gene mutations also had LOH for at least 1 microsatellite marker, in agreement with the “two-hit” hypothesis for the inactivation of tumor suppressor genes (36).

Fig. 2

LOH of D3S1335 and D3S1304 microsatellite markers in RCC-2 and RCC-31 samples. The peak heights are measured in relative fluorescence units. (a) for RCC-2: QLOH = (267/1216)/(554/68) = 0.15; (b) for RCC-31: QLOH = (4576/3119)/(774/276) = 0.52.

Fig. 3

The aminoacidic changes are reported across the structure of the pVHL protein: the 3 exons and the UTR regions are indicated.

Methylation analysis by methylation-specific PCR was performed on 15 cases for which there was enough formalin-fixed, paraffin-embedded material available. Hypermethylation of the VHL gene promoter region was detected only in 1 of the analyzed samples. The lack of promoter hypermethylation was indicated by: (i) failure of amplification of the promoter fragment in all tumor samples and negative controls (Universal Unmethylated DNA, Serological Corp., Norcross, GA) that were tested with the specific primer pair; (ii) amplification of the positive control of PCR reaction CpGenome Universal Methylated DNA (Serological Corp., Norcross GA). ACTB control fragment was amplified correctly in all bisulphite treated DNA, positive and negative DNA controls.

VHL status by patient and tumor features

VHL alterations were stratified by tumor histopathology and patient features, as summarized in Table III. No significant correlations were found between the presence of mutations and the tumors’ or patients’ features examined.

Discussion

The VHL gene is considered a master tumor suppressor gene involved in cell cycle regulation, modulation of hypoxia-inducible genes and proper fibronectin assembly in extracellular matrix (37). Molecular studies examining tumor DNA from sporadic cases of RCC have provided strong evidence that VHL alteration is a common early event in the carcinogenesis process. It has been estimated that approximately 50%-70% of all sporadic ccRCCs harbor biallelic VHL defects (24, 25, 34, 35, 38, 39).

We examined VHL gene alterations using mutational analysis, LOH analysis and determination of promoter methylation status in a cohort of 35 Italian RCC patients. Sixty-eight percent of these patients were found to have at least 1 molecular alteration in the VHL gene (nucleotidic change, methylation or LOH). A total of 17 nucleotidic changes were identified in RCC tumor tissues. One novel mutation (c.340_358 dup18), located within exon 2 of the VHL gene and heavily affecting protein function, was identified in this study in a ccRCC sample. Moreover, 2 previously unreported nucleotidic changes (p.S33X and p.G39D) at the 5’ of codon 54 were identified in 2 different cases of ccRCCs. These changes are unusual and would be expected to affect only the pVHL30 translation product at a specific region, which is known to interact with fibronectin and was recently described as an important mediator for tumor invasion (40 -42). In addition, other 12 mutations (8 missense, 3 nonsense and 1 splicing mutation), affecting mainly the first exon of the gene and located into the interaction sites of pVHL with HIF-1α, are functionally related to the development of the disease (43). To note, a double inactivation (a missense mutation and a LOH) were found in a cRCCs case (RCC-16), confirming the recently reported involvement of the VHL gene alterations in the pathogenesis of this type of renal tumor (44, 45).

Several studies have previously examined VHL alterations in different patient populations and have reported significant differences in the prevalence of these mutations, which ranged from 42% to 87% in frozen samples (34, 38, 46, 47) and from 20% to 61% in formalin-fixed, paraffin-embedded tissues (35, 38, 48 -52). This is the first study analyzing the VHL genetic alterations in an Italian cohort of sporadic ccRCC cases that reports an incidence of VHL genetic alterations consistent with the lower limit of the range reported in other geographical areas. The slight difference in mutation prevalence could be due to several factors, including the limit of detection of mutant alleles using Sanger sequencing analysis (approximately 15%-20%), the patients’ population examined, the type of material analyzed (archived paraffin material instead of fresh material) and tumor histopathology (53 -55). In addition, LOH analysis was performed on all RCC samples, and allelic loss of the VHL gene region was demonstrated in 46% (11/24) of the cases. The existing discrepancy between this latter finding and the previously published data on LOH frequency (which report values ranging from 78% to 93%) is probably due to the more strict criteria used to discriminate loss and retention of VHL alleles than those more frequently used (cutoff value for defining a LOH was lowered to 0.65) (35, 40, 47). Interestingly, 5 cases harboring VHL mutations also showed allelic loss at the VHL locus, suggesting that both alleles are inactivated. Inactivation of the VHL gene can also occur by promoter hypermethylation (36, 53, 57). Due to the low amounts of DNA obtained from formalin-fixed, paraffin-embedded specimens, we could only analyze 15 cases, of which only one (1/15; 7%) showed promoter hypermethylation. This is not surprising if we consider that the previously reported prevalence was of 5%-17% (13, 15, 35, 52).

Finally, we examined possible correlations between our genetic findings and patients’ clinical and descriptive features. The prevalence of mutations was not associated with any of the parameters examined in terms of tumors’ or patients’ features. In accordance with previous reports, our findings confirm that functional alterations of the VHL gene may also play a pivotal role in RCC tumorigenesis, especially in cases of ccRCCs and, to a more limited degree, in cases of cRCCs. Our findings further support the concept that mutation analysis of the VHL gene is of striking importance for discriminating the sporadic forms of cancer from those related to VHL disease.

Footnotes

Acknowledgements

The authors thank Chiara Di Giorgio (translator and medical writer, BioAgromed, University of Foggia) for linguistic revision.

Financial Support: This study was supported by the “Ricerca Corrente” 2007 and 2012 funding, granted by the Italian Ministry of Health, and by the “5×1013” voluntary contributions.

Conflict of Interest Statements: The authors state that the manuscript has not been published elsewhere, that there is no conflict of interest and that the paper has been read and approved by all authors.

References

Rini

B.I.

, Campbell

S.C.

, Escudier

Renal cell carcinoma. Lancet 2009; 373: 1119–32.

Gnarra

J.R.

, Tory

, Weng

Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet 1994; 7: 85–90.

Latif

, Tory

, Gnarra

Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 1993; 260: 1317–20.

Richards

F.M.

, Schofield

P.N.

, Fleming

, Maher

E.R.

Expression of the von Hippel-Lindau disease tumour suppressor gene during human embryogenesis. Hum Mol Genet 1996; 5: 639–44.

Lee

, Chen

D.Y.

, Humphrey

J.S.

, Gnarra

J.R.

, Linehan

W.M.

, Klausner

R.D.

Nuclear/cytoplasmic localization of the von Hippel-Lindau tumor suppressor gene product is determined by cell density. PNAS USA 1996; 93: 1770–5.

Duan

D.R.

, Pause

, Burgess

W.H.

Inhibition of transcription elongation by the VHL tumor suppressor protein. Science 1995; 269: 1402–6.

Stebbins

C.E.

, Kaelin

W.G.

Jr. , Pavletich

N.P.

Structure of the VHL-ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 1999; 284: 455–61.

Ohh

, Kaelin

Jr. The von Hippel-Lindau tumour suppressor protein: new perspectives. Mol Med Today 1999; 5: 257–63.

Megumi

, Miyauchi

, Sakurai

Multiple roles of Rbx1 in the VBC-Cul2 ubiquitin ligase complex. Genes Cells 2005; 10: 679–91.

10.

Iliopoulos

, Levy

A.P.

, Jiang

, Kaelin

W.G.

Jr. , Goldberg

M.A.

Negative regulation of hypoxia-inducible genes by the von Hippel-Lindau protein. PNAS U S A 1996; 93: 10595–9.

11.

Maxwell

P.H.

, Wiesener

M.S.

, Chang

G.W.

The tumor suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 1999; 399: 271–5.

12.

Kamura

, Sato

, Iwai

, Czyzyk-Krzeska

, Conaway

R.C.

, Conaway

J.W.

Activation of HIF1alpha ubiquitination by a reconstituted von Hippel-Lindau (VHL) tumor suppressor complex. PNAS USA 2000; 97: 10430–5.

13.

Knauth

, Bex

, Jemth

, Buchberger

Renal cell carcinoma risk in type 2 von Hippel-Lindau disease correlates with defects in pVHL stability and HIF-1alpha interactions. Oncogene 2007; 25: 370–7.

14.

Kaelin

Jr. The von Hippel-Lindau tumour suppressor protein: O2 sensing and cancer. Nat Rev Cancer 2008; 8: 865–73.

15.

Kaelin

Jr. Treatment of kidney cancer: insights provided by the VHL tumor-suppressor protein. Cancer 2009; 15: 2262–72.

16.

Choyke

P.L.

, Glenn

G.M.

, Walther

M.M.

, Patronas

N.J.

, Linehan

W.M.

, Zbar

von Hippel-Lindau disease: genetic, clinical, and imaging features. Radiology 1995; 194: 629–42.

17.

Linehan

W.M.

, Lerman

M.I.

, Zbar

Identification of the von Hippel-Lindau (VHL) gene. Its role in renal cancer. Jama 1995; 273: 564–70.

18.

Maher

E.R.

, Kaelin

Jr. von Hippel-Lindau disease. Medicine (Baltimore) 1997; 76: 381–91.

19.

Clifford

S.C.

, Maher

E.R.

Von Hippel-Lindau disease: clinical and molecular perspectives. Adv Cancer Res 2001; 82: 85–105.

20.

Foster

, Prowse

, van den Berg

Somatic mutations of the von Hippel-Lindau disease tumour suppressor gene in non-familial clear cell renal carcinoma. Hum Mol Genet 1994; 3: 2169–73.

21.

Whaley

J.M.

, Naglich

, Gelbert

Germ-line mutations in the von Hippel-Lindau tumor-suppressor gene are similar to somatic von Hippel-Lindau aberrations in sporadic renal cell carcinoma. Am J Hum Genet 1994; 55: 1092–102.

22.

Shuin

, Kondo

, Torigoe

Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human renal cell carcinomas. Cancer Res 1994; 54: 2852–5.

23.

Bailly

, Bain

, Favrot

M.C.

, Ozturk

Somatic mutations of von Hippel-Lindau (VHL) tumor-suppressor gene in European kidney cancers. Int J Cancer 1995; 63: 660–4.

24.

Kenck

, Wilhelm

, Bugert

, Staehler

, Kovacs

Mutation of the VHL gene is associated exclusively with the development of non-papillary renal cell carcinomas. J Pathol 1996; 179: 157–61.

25.

van Houwelingen

K.P.

, van Dijk

B.A.

, Hulsbergen-van de Kaa

C.A.

Prevalence of von Hippel-Lindau gene mutations in sporadic renal cell carcinoma: results from the Netherlands cohort study. BMC Cancer 2005; 2: 57.

26.

Parrella

, Sidransky

, Merbs

S.L.

Allelotype of posterior uveal melanoma: implications for a bifurcated tumor progression pathway. Cancer Res 1999; 59: 3032–7.

27.

Coura

, Prolla

J.C.

, Meurer

, Ashton-Prolla

An alternative protocol for DNA extraction from formalin fixed and paraffin wax embedded tissue. J Clin Pathol 2005; 58: 894–5.

28.

Sambrook

, Fritsch

E.F.

, Maniatis

Molecular cloning: a laboratory manual; in New York: Cold Spring Harbor Laboratory, 1989; E3–E4.

29.

Cybulski

, Krzystolik

, Maher

E.R.

Long polymerase chain reaction in detection of germline deletions in the von Hippel-Lindau tumour suppressor gene. Hum Genet 1999; 105: 333–6.

30.

Skotheim

R.I.

, Diep

C.B.

, Kraggerud

S.M.

Evaluation of loss of heterozygosity/allelic imbalance scoring in tumor DNA. Cancer Genet Cytogenet 2001; 127: 64–70.

31.

Herman

J.G.

, Graff

J.R.

, Myöhänen

, Nelkin

B.D.

, Baylin

S.B.

Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. PNAS USA 1996; 93: 9821–6.

32.

Kuroki

, Trapasso

, Yendamuri

Allele loss and promoter hypermethylation of VHL, RAR-beta, RASSF1A, and FHIT tumor suppressor genes on chromosome 3p in esophageal squamous cell carcinoma. Cancer Res 2003; 63: 3724–8.

33.

Rothberg

P.G.

, Bradley

J.F.

, Baker

D.W.

, Huelsman

K.M.

Is the P25L a “real” VHL mutation?

Mol Diagn 2001; 6: 49–54.

34.

Banks

R.E.

, Tirukonda

, Taylor

Genetic and epigenetic analysis of von Hippel-Lindau (VHL) gene alterations and relationship with clinical variables in sporadic renal cancer. Cancer Res 2007; 66: 2000–11.

35.

Nickerson

M.L.

, Jaeger

, Shi

Improved identification of von Hippel-Lindau gene alterations in clear cell renal tumors. Clin Cancer Res 2008; 14: 4726–34.

36.

Knudson

Jr. Overview: genes that predispose to cancer. Mutat Res 1991; 247: 185–190.

37.

Nyhan

M.J.

, O'Sullivan

G.C.

, McKenna

S.L.

Role of the VHL (von Hippel-Lindau) gene in renal cancer: a multifunctional tumor suppressor. Biochem Soc Trans 2008; 36: 472–8.

38.

Gallou

, Joly

, Mejean

Mutations of the VHL gene in sporadic renal cell carcinoma: definition of a risk factor for VHL patients to develop an RCC. Hum Mutat 1999; 13: 464–75.

39.

Kondo

, Yao

, Yoshida

Comprehensive mutational analysis of the VHL gene in sporadic renal cell carcinoma: relationship to clinicopathological parameters. Genes Chromosomes Cancer 2002; 34: 58–68.

40.

Iliopoulos

, Ohh

, Kaelin

Jr. pVHL19 is a biologically active product of the von Hippel-Lindau gene arising from internal translation initiation. PNAS USA 95; 1998: 11661–6.

41.

Blankenship

, Naglich

J.G.

, Whaley

J.M.

, Seizinger

, Kley

Alternate choice of initiation codon produces a biologically active product of the von Hippel Lindau gene with tumor suppressor activity. Oncogene 1999; 18: 1529–35.

42.

Lolkema

M.P.

, Gervais

M.L.

, Snijckers

C.M.

Tumor suppression by the von Hippel-Lindau protein requires phosphorylation of the acidic domain. J Biol Chem 2005; 280: 22205–11.

43.

Forman

J.R.

, Worth

C.L.

, Bickerton

G.R.

, Eisen

T.G.

, Blundell

T.L.

Structural bioinformatics mutation analysis reveals genotypephenotype correlations in von Hippel-Lindau disease and suggests molecular mechanisms of tumorigenesis. Proteins 2009; 77: 84–96.

44.

Barnabas

, Amin

M.B.

, Pindolia

, Nanavati

, Amin

M.B.

, Worsham

M.J.

Mutations in the von Hippel-Lindau (VHL) gene refine differential diagnostic criteria in renal cell carcinoma. J Surg Oncol 2002; 80: 52–60.

45.

Petersson

, Gatalica

, Grossman

Sporadic hybrid oncocytic/chromophobe tumor of the kidney: a clinicopathologic, histomorphologic, immunohistochemical, ultrastructural, and molecular cytogenetic study of 14 cases. Virchows Arch 2010; 456: 355–65.

46.

Brauch

, Weirich

, Brieger

VHL alterations in human clear cell renal cell carcinoma: association with advanced tumor stage and a novel hot spot mutation. Cancer Res 2000; 60: 1942–8.

47.

Yao

, Yoshida

, Kishida

VHL tumor suppressor gene alterations associated with good prognosis in sporadic clear-cell renal carcinoma. J Natl Cancer Inst 2002; 94: 1569–75.

48.

, Yang

, Lindblad

, Egevad

, Hemminki

VHL gene alterations in renal cell carcinoma patients: novel hotspot or founder mutations and linkage disequilibrium. Oncogene 2001; 20: 5393–400.

49.

Schraml

, Struckmann

, Hatz

VHL mutations and their correlation with tumor cell proliferation, microvessel density, and patient prognosis in clear cell renal cell carcinoma. J Pathol 2002; 196: 186–93.

50.

Kim

J.H.

, Jung

C.W.

, Cho

Y.H.

Somatic VHL alteration and its impact on prognosis in patients with clear cell renal cell carcinoma. Oncol Rep 2005; 13: 859–64.

51.

Rini

B.I.

, Jaeger

, Weinberg

Clinical response to therapy targeted at vascular endothelial growth factor in metastatic renal cell carcinoma: impact of patient characteristics and von Hippel-Lindau gene status. BJU Int 2007; 98: 756–62.

52.

Moore

L.E.

, Nickerson

M.L.

, Brennan

Von Hippel-Lindau (VHL) inactivation in sporadic clear cell renal cancer: associations with germline VHL polymorphisms and etiologic risk factors. PLoS Genet 2011; 10: e1002312.

53.

Nollau

, and Wagener

Methods for detection of point mutations: performance and quality assessment. The IFCC Scientific Division, Committee on Molecular Biology Techniques. J Int Fed Clin Chem 1997; 9: 162–70.

54.

Tsiatis

, Norris-Kirby

, Rich

Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications. J Mol Diagn 2010; 12: 425–32.

55.

Verhoest

, Patard

J.J.

, Fergelot

Paraffin-embedded tissue is less accurate than frozen section analysis for determining VHL mutational status in sporadic renal cell carcinoma. Urol Onc 2012; 30: 469–75.

56.

Gossage

, Eisen

Alterations in VHL as potential biomarkers in renal-cell carcinoma. Nat Rev Clin Oncol 2010; 7: 277–88.

57.

Chen

, Kishida

, Yao

Germline mutations in the von Hippel-Lindau disease tumor suppressor gene: correlations with phenotype. Hum Mutat 1995; 5: 66–75.

58.

Oberstrass

, Reifenberger

, Wechsler

, Collins

V.P.

Mutation of the Von Hippel-Lindau tumour suppressor gene in capillary haemangioblastomas of the central nervous system. J Pathol 1996; 179: 151–6.

59.

Kishida

, Stackhouse

T.M.

, Chen

, Lerman

M.I.

, Zbar

Cellular proteins that bind the von Hippel-Lindau disease gene product: mapping of binding domains and the effect of missense mutations. Cancer Res 1995; 55: 4544–8.

VHL Gene Alterations in Italian Patients with Isolated Renal Cell Carcinomas

Abstract

Keywords

Introduction

Materials and Methods

Patients and Tissue Specimens

Molecular genetic analysis

Mutation analysis

VHL gene deletions analysis

Loss of heterozygosity (LOH) analysis

Methylation-specific PCR analysis

Statistical methods

Results

Study cohort

Molecular findings

VHL status by patient and tumor features

Discussion

Footnotes

Acknowledgements

References